Stem-loop hsa-mir-382

Accession

MI0000790

Symbol

HGNC: MIR382

Description

Homo sapiens hsa-mir-382 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR382 is a candidate miRNA that has been identified as a potential modulator of KIF14 mRNA levels in ovarian cancer (OvCa) tumors [PMC3953446]. It has also been shown to reduce the expression of SLC7A11, promoting ferroptosis [PMC8572460]. Inhibition of MIR382 can increase PTEN levels, leading to the inhibition of the PI3K/AKT/mTOR pathway and a decrease in HIF-1α [PMC4081109]. Increased expression of MIR382 has been found to inhibit HIV-1 replication in macrophages through sequence complementarity and binding to viral mRNA [PMC4406127]. Overexpression of MIR382 can decrease voluntary intake and preference for ethanol [PMC5836055]. Decreased expression of MIR382 has been associated with poor outcomes in osteosarcomas [PMC3953446]. In a study involving BMSCs, silencing HDAC3 resulted in a decrease in exosomal expression of miR380 and MIR382 [PMC6883144]. Increased expression of MIR382 has also been observed in ON-derived cells from individuals with schizophrenia and bipolar disorder, suggesting its potential role in these psychiatric disorders [PMC4354342] [PMC7527411]. MIR382 is an important miRNA that plays diverse roles in various biological processes, including cancer development, viral replication inhibition, alcohol preference modulation, and psychiatric disorders. Further research is needed to fully understand the mechanisms by which MIR382 exerts its effects.

Literature search

69 open access papers mention hsa-mir-382
(451 sentences)

Sequence

27144 reads, 205 reads per million, 86 experiments

uacuugaagaGAAGUUGUUCGUGGUGGAUUCGcuuuacuuaugacgAAUCAUUCACGGACAACACUUuuuucagua
((((.(((((((.(((((((((((..(((((((.........).))))))..)))))))))))..)))))))))))

Structure

    u       -A           UG      - uuu 
uacu gaagaGA  GUUGUUCGUGG  GAUUCG c   a
|||| |||||||  |||||||||||  |||||| |   c
auga cuuuuUU  CAACAGGCACU  CUAAgc g   u
    -       CA           UA      a uau 

Annotation confidence High

Genome context

chr14: 101054306-101054381 [+]

Clustered miRNAs

14 other miRNAs are < 10 kb from hsa-mir-382

Disease association

hsa-mir-382 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-382-5p

• Accession: MIMAT0000737
• Description: Homo sapiens hsa-miR-382-5p mature miRNA
• Sequence: 11 - GAAGUUGUUCGUGGUGGAUUCG - 32
• Evidence: experimental ; cloned [1-3]

Mature hsa-miR-382-3p

• Accession: MIMAT0022697
• Description: Homo sapiens hsa-miR-382-3p mature miRNA
• Sequence: 47 - AAUCAUUCACGGACAACACUU - 67
• Evidence: not_experimental

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706


3. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267