miRBase entry: hsa-mir-382

Stem-loop hsa-mir-382


Accession
MI0000790
Symbol
HGNC: MIR382
Description
Homo sapiens hsa-mir-382 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR382 is a candidate miRNA that has been identified as a potential modulator of KIF14 mRNA levels in ovarian cancer (OvCa) tumors [PMC3953446]. It has also been shown to reduce the expression of SLC7A11, promoting ferroptosis [PMC8572460]. Inhibition of MIR382 can increase PTEN levels, leading to the inhibition of the PI3K/AKT/mTOR pathway and a decrease in HIF-1α [PMC4081109]. Increased expression of MIR382 has been found to inhibit HIV-1 replication in macrophages through sequence complementarity and binding to viral mRNA [PMC4406127]. Overexpression of MIR382 can decrease voluntary intake and preference for ethanol [PMC5836055]. Decreased expression of MIR382 has been associated with poor outcomes in osteosarcomas [PMC3953446]. In a study involving BMSCs, silencing HDAC3 resulted in a decrease in exosomal expression of miR380 and MIR382 [PMC6883144]. Increased expression of MIR382 has also been observed in ON-derived cells from individuals with schizophrenia and bipolar disorder, suggesting its potential role in these psychiatric disorders [PMC4354342] [PMC7527411].

MIR382 is an important miRNA that plays diverse roles in various biological processes, including cancer development, viral replication inhibition, alcohol preference modulation, and psychiatric disorders. Further research is needed to fully understand the mechanisms by which MIR382 exerts its effects.

Literature search
69 open access papers mention hsa-mir-382
(451 sentences)

Sequence

27144 reads, 205 reads per million, 86 experiments
uacuugaagaGAAGUUGUUCGUGGUGGAUUCGcuuuacuuaugacgAAUCAUUCACGGACAACACUUuuuucagua
((((.(((((((.(((((((((((..(((((((.........).))))))..)))))))))))..)))))))))))

Structure
    u       -A           UG      - uuu 
uacu gaagaGA  GUUGUUCGUGG  GAUUCG c   a
|||| |||||||  |||||||||||  |||||| |   c
auga cuuuuUU  CAACAGGCACU  CUAAgc g   u
    -       CA           UA      a uau 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101054306-101054381 [+]
Clustered miRNAs
14 other miRNAs are < 10 kb from hsa-mir-382
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-382 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-382-5p

Accession MIMAT0000737
Description Homo sapiens hsa-miR-382-5p mature miRNA
Sequence 11 - GAAGUUGUUCGUGGUGGAUUCG - 32
Evidence experimental
cloned [1-3]
Database links
Predicted targets

Mature hsa-miR-382-3p

Accession MIMAT0022697
Description Homo sapiens hsa-miR-382-3p mature miRNA
Sequence 47 - AAUCAUUCACGGACAACACUU - 67
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267