miRBase entry: hsa-mir-382

Stem-loop hsa-mir-382


Accession
MI0000790
Symbol
HGNC: MIR382
Description
Homo sapiens hsa-mir-382 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR382 is a microRNA implicated in various cellular processes and diseases, including ovarian cancer (OvCa), where it may modulate KIF14 mRNA levels and contribute to KIF14 mRNA overexpression in tumors [PMC3953446]. It also plays a role in epigenetic regulation by reducing SLC7A11 expression, thereby promoting ferroptosis [PMC8572460]. Furthermore, MIR382 is involved in cellular pathways by influencing the PI3K/AKT/mTOR pathway through the regulation of PTEN levels, which affects HIF-1α synthesis [PMC4081109]. In the context of viral infections, MIR382 expression has been shown to inhibit HIV-1 replication in macrophages [PMC4406127]. Additionally, overexpression of MIR382 can decrease ethanol intake and preference by influencing expression levels [PMC5836055]. In osteosarcomas, lower expression of MIR382 has been associated with poorer outcomes [PMC3953446], while its decreased exosomal expression was observed when HDAC3 was silenced in BMSCs [PMC6883144]. In psychiatric disorders such as schizophrenia and bipolar disorder, altered MIR382 levels have been reported in ON-derived cells and are consistent with changes observed in postmortem brain studies [PMC4354342]. Lastly, significant enrichment of MIR382 has been found in samples from high-fat diet groups, suggesting its involvement in dietary response mechanisms [PMC7527411].

Literature search
69 open access papers mention hsa-mir-382
(451 sentences)

Sequence

27144 reads, 57 reads per million, 86 experiments
uacuugaagaGAAGUUGUUCGUGGUGGAUUCGcuuuacuuaugacgAAUCAUUCACGGACAACACUUuuuucagua
((((.(((((((.(((((((((((..(((((((.........).))))))..)))))))))))..)))))))))))

Structure
    u       -A           UG      - uuu 
uacu gaagaGA  GUUGUUCGUGG  GAUUCG c   a
|||| |||||||  |||||||||||  |||||| |   c
auga cuuuuUU  CAACAGGCACU  CUAAgc g   u
    -       CA           UA      a uau 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr14: 101054306-101054381 [+]
Clustered miRNAs
14 other miRNAs are < 10 kb from hsa-mir-382
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-382 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-382-5p

Accession MIMAT0000737
Description Homo sapiens hsa-miR-382-5p mature miRNA
Sequence 11 - GAAGUUGUUCGUGGUGGAUUCG - 32
Evidence experimental
cloned [1-3]
Database links
Predicted targets

Mature hsa-miR-382-3p

Accession MIMAT0022697
Description Homo sapiens hsa-miR-382-3p mature miRNA
Sequence 47 - AAUCAUUCACGGACAACACUU - 67
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267