WARNING: This summary was generated by AI. MIR382 is a microRNA implicated in various cellular processes and diseases, including ovarian cancer (OvCa), where it may modulate KIF14 mRNA levels and contribute to KIF14 mRNA overexpression in tumors [PMC3953446]. It also plays a role in epigenetic regulation by reducing SLC7A11 expression, thereby promoting ferroptosis [PMC8572460]. Furthermore, MIR382 is involved in cellular pathways by influencing the PI3K/AKT/mTOR pathway through the regulation of PTEN levels, which affects HIF-1α synthesis [PMC4081109]. In the context of viral infections, MIR382 expression has been shown to inhibit HIV-1 replication in macrophages [PMC4406127]. Additionally, overexpression of MIR382 can decrease ethanol intake and preference by influencing expression levels [PMC5836055]. In osteosarcomas, lower expression of MIR382 has been associated with poorer outcomes [PMC3953446], while its decreased exosomal expression was observed when HDAC3 was silenced in BMSCs [PMC6883144]. In psychiatric disorders such as schizophrenia and bipolar disorder, altered MIR382 levels have been reported in ON-derived cells and are consistent with changes observed in postmortem brain studies [PMC4354342]. Lastly, significant enrichment of MIR382 has been found in samples from high-fat diet groups, suggesting its involvement in dietary response mechanisms [PMC7527411].
u -A UG - uuu
uacu gaagaGA GUUGUUCGUGG GAUUCG c a
|||| ||||||| ||||||||||| |||||| | c
auga cuuuuUU CAACAGGCACU CUAAgc g u
- CA UA a uau
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000737 |
| Description | Homo sapiens hsa-miR-382-5p mature miRNA |
| Sequence | 11 - GAAGUUGUUCGUGGUGGAUUCG - 32 |
| Evidence |
experimental
cloned [1-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022697 |
| Description | Homo sapiens hsa-miR-382-3p mature miRNA |
| Sequence | 47 - AAUCAUUCACGGACAACACUU - 67 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|