sort by

236 publications mentioning rno-mir-21 (showing top 100)

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-21. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 503
Other miRNAs from this paper: ocu-mir-21
The major findings of this study include the following: (1) our real-time PCR and quantitative analyses revealed that RAP -induced AF significantly down-regulated Smad7 expression, which was associated with an increase in TGF-β [1] and collagen I/III; (2) the AF -induced up-regulation of miR-21 was negatively correlated with Smad7 expression; (3) in isolated adult rat cardiac fibroblasts, treatment with TGF-β [1] caused the down-regulation of Smad7 expression and increased the levels of miR-21 and collagen I/III; (4) the luciferase reporter assays suggested that Smad7 is a validated miR-21 target in CFs; and (5) in the presence of TGF-β [1], inhibiting or upregulating miR-21 could increase and decrease Smad7 expression, respectively, indicating that the TGF-β [1] -induced decrease in Smad7 expression might be mediated by miR-21. [score:26]
T, unpaired t test; n = 10 independent samples for each group) Over -expression of TGF-β [1] induces Smad7 down-regulation through miRNA-21Our results indicated that TGF-β [1] -induced collagen I/III expression might occur through the up-regulation of miR-21, meanwhile we found in our previous studies that the over -expression of TGF-β [1] induced the degradation of Smad7 which may decrease the inhibitory feedback regulation of TGF-β [1]/Smad signaling pathway, so we sought to determine the relationship between miR-21 and Smad7 in TGF-β [1] -induced collagen expression. [score:18]
More interestingly, the molecular mechanism underlying this phenomenon is as follows: the expression of TGF-β [1] leads to miR-21 up-regulation, and miR-21 over -expression directly down-regulates Smad7 expression, which leads to amplification of TGF-β [1] signaling and ultimately results in RAP -induced fibrosis. [score:14]
T, unpaired t test; n = 10 independent samples for each group) Our results indicated that TGF-β [1] -induced collagen I/III expression might occur through the up-regulation of miR-21, meanwhile we found in our previous studies that the over -expression of TGF-β [1] induced the degradation of Smad7 which may decrease the inhibitory feedback regulation of TGF-β [1]/Smad signaling pathway, so we sought to determine the relationship between miR-21 and Smad7 in TGF-β [1] -induced collagen expression. [score:13]
Thus, we speculate that miR-21 over -expression significantly enhances TGF-β [1] -induced collagen expression and that Smad7 can directly inhibit collagen expression in RAP -induced myocardial fibrosis. [score:10]
Interesting, inhibiting miR-21 expression weakened the TGF-β [1] -mediated down-regulation of Smad7 expression. [score:10]
At the end of the experiment, we found that miR-21 expression was significantly lower in the hearts of treated animals (Fig.   2a–c, p < 0.05), suggesting that miR-21 inhibitor lentiviral vectors can inhibit miR-21 expression in the heart. [score:9]
Taken together, our data show that miR-21 over -expression directly down-regulates Smad7 expression. [score:9]
The expression of the wild-type luciferase-Smad7-3′UTR reporter was remarkably lower than the mutant luciferase-Smad7-3′UTR reporter and control plasmid (Fig.   5a, b), suggesting that Smad7 is a validated miR-21 target in CFs and that miR-21 can inhibit Smad7 expression, leading to the further amplification of TGF-β [1] signaling. [score:9]
In vitro, we found that miR-21 over -expression increased collagen I/III expression and that miR-21 over -expression after treatment with TGF-β [1] further increased collagen I/III expression. [score:9]
Interestingly, we found that miR-21 inhibition significantly weakened TGF-β [1] -induced Smad7 mRNA down-regulation in the CFs that treated with TGF-β [1] plus the miR-21 inhibitor (Fig.   5d). [score:8]
These data show that the miR-21 inhibitor could inhibit myocardial fibrosis by up -regulating Smad7 expression in vivo. [score:8]
Interestingly, we found that miR-21 inhibition significantly weakened TGF-β [1] -induced collagen I/III mRNA expression in the CFs that were treated with TGF-β [1] plus the miR-21 inhibitor. [score:7]
Next, CFs were transfected with miR-control and miR-21 over -expression lentiviral vectors before being transfected with TGF-β [1] (10 ng/ml) for 48 h. TGF-β [1] plus miR-21 overexpression enhanced collagen I/III mRNA expression more significantly than TGF-β [1] treatment alone (Fig.   4h, i). [score:7]
The miR-21 inhibitor decreased miR-21 expression in the heart of experimental rabbits (rabbits were treated with the miR-21 inhibitor and RAP for 4 weeks). [score:7]
In summary, our data demonstrate that TGF-β [1] -induced miR-21 over -expression enhances TGF-β [1] -induced collagens expression by directly down -regulating Smad7. [score:7]
In this study, the cells were divided into the following groups: cells without transfection (blank control group, Group CR), cells transfected with the miR-control lentiviral vector (30 μM) (miR-control group, Group M), cells transfected with the pre-miR-21 (miR-21 over -expression) (30 μM) lentiviral vector (pre-miR-21 group, Group PM), cells treated with 10 ng/ml TGF-β [1] (TGF-β [1] group, Group T), cells treated with 10 ng/ml TGF-β [1] plus the pre-miR-21 vector (30 μM) (TGF-β [1] + pre-miR-21 group, Group TP), and cells treated with 10 ng/ml TGF-β [1] plus the miR-21 inhibitor (30 μM) (TGF-β [1] + miR-21 inhibitor group, Group TI). [score:7]
f Northern blot verifying the down-regulation of miR-21 in rat fibroblasts after transfection with the miR-21 inhibitor. [score:6]
Adam recently confirmed miR-21 levels were significantly higher in patients with atrial fibrillation, and the up-regulation of miR-21 target genes can increase fibrin deposition [19]. [score:6]
The expression of endogenous miR-21 in the heart and the up-regulation of miR-21 were verified with Northern blot analysis (Fig.   1b, c). [score:6]
Over -expression of TGF-β [1] induces Smad7 down-regulation through miRNA-21. [score:6]
In the present study, our aim was to determine if miR-21 up-regulation could enhance TGF-β [1] -induced myocardial fibrosis by inhibiting Smad7. [score:6]
Next, we tested the effect of miR-21 overexpression on TGF-β [1] -induced Smad7 down-regulation. [score:6]
Furthermore, miR-21 over -expression significantly enhanced TGF-β [1] -induced Smad7 down-regulation. [score:6]
Thus, our study further suggested that miR-21 may be involved in the regulation of RAP -induced myocardial fibrosis, and we speculate that miR-21 over -expression significantly enhances TGF-β [1] -induced collagen expression. [score:6]
MicroRNA-21 (miR-21) is consistently reported to be upregulated in both cancer and various forms of cardiovascular disease [13, 14]. [score:6]
In addition, blocking miR-21 expression reverses the TGF-β [1-]induced up-regulation of collagen I/III. [score:6]
In vivo, we found that RAP induced TGF-β [1] and miR-21 up-regulation with the increased expression of collagen. [score:6]
Male New Zealand rabbits (2.0–2.5 kg) were randomly divided into 4 groups (n = 10 for each group): normal control (CR), sham control (SH), rapid atrial pacing (RAP) and RAP + miR-21 inhibitor(the miR-21 inhibitor was administered to this group through a lentiviral vector, Genechem, Shanghai, China). [score:5]
Fig.  3Effect of the miR-21 inhibitor on RAP -induced Smad7 and collagen I/III expression in vivo. [score:5]
Furthermore, through the computational prediction of target genes, we identified Smad7 as a potential target for miR-21. [score:5]
Taken together, our results demonstrate that TGF-β [1] -induced collagen I/III expression might result from the expression of miR-21 in vitro. [score:5]
It reported that miR-21 is expressed much higher in cardiac fibroblasts and accompanied by the increased expression of collagen in pathological states of heart failure [42]. [score:5]
Next, we found that the incidence of atrial fibrillation after transfection with the miR-21 inhibitor lentiviral vector decreased from 89 % in the RAP group to 50 % in the lentiviral group (8 of 9 in the RAP group, 5 of 10 in the RAP+miR-21 inhibitor group). [score:5]
c Mean miR-21 expression levels in the CR group and the RAP+miR-21 inhibitor group. [score:5]
The inhibition of miR-21 by synthetic miRNA antagonists improved heart function in a cardiac disease mo del [16– 19]. [score:5]
More importantly, Smad7 expression increased after transfection with miR-21 inhibitor, whereas collagen I/III decreased (Fig.   3, p < 0.05). [score:5]
We found that miR-21 over -expression decreases Smad7 expression, which was similar to the change that occurred with TGF-β [1] treatment. [score:5]
miR-21 overexpression enhances the TGF-β [1] -induced epithelial-to-mesenchymal transition by targeting Smad7 and aggravates renal damage in diabetic nephropathy. [score:5]
These results strongly suggest that the miR-21 -mediated degradation of Smad7 might decrease the inhibitory feedback regulation of TGF-β1/Smad signaling and serves as a new insight into the development of atrial fibrosis due to atrial fibrillation. [score:5]
a qRT-PCR demonstrating that TGF-β1 (10 ng/ml) and TGF-β1 inhibitor(10 μg/ml) induces and decrease miR-21 expression at 48 h. b Representative Northern blot showing miR-21. [score:5]
miR-21 has therefore emerged as an interesting candidate for the development of therapeutic strategies against many forms of heart disease. [score:4]
Animal experiments found that miR-21 expression affected the TGF-β [1] -induced renal tubular epithelial-to-mesenchymal transition in diabetic nephropathy by regulating Smad7 [25]. [score:4]
In a rat mo del of myocardial infarction, the down-regulation of miR-21 can reduce the degree of atrial fibrosis and the incidence of AF [43]. [score:4]
It has been reported that TGF-β [1] can increase miR-21 expression in cardiac fibroblasts and may be involved in the regulation of myocardial fibrosis [22, 24]. [score:4]
d Northern blot verifying the upregulation of miR-21 in rats fibroblast after transfection with pre-miR-21. [score:4]
Fig.  5Effect of miR-21 on the TGF-β [1] -mediated down-regulation of Smad7. [score:4]
The same beneficial effects were observed in miR-21 knockout mice subjected to pressure-overload of the left ventricle, underlining the potential of miR-21 as a therapeutic target [20]. [score:4]
TGF-β1 induces myocardial fibrosis by upregulating miR-21. [score:4]
The results of this assay demonstrated that miR-21 over -expression significantly enhanced TGF-β [1] -induced Smad7 down-regulation compared with the TGF-β [1] group and the miR-control group (Fig.   5d). [score:4]
The GFP reporter gene was inserted at the 3′ end of the miR-21 inhibitor gene. [score:3]
Next, TGF-β [1] -treated CFs were transfected with the miR-control and miR-21 over -expression lentiviral vectors. [score:3]
Cardiac fibroblasts were treated with TGF-β [1] in the presence or absence of miR-21 for 48 h. d Quantitative analysis of Smad7 expression by qRT-PCR. [score:3]
Transfection with the miR-21 inhibitor caused a significant decrease in hydroxyproline content, collagen I and collagen III deposition, left atrial weight, and left atrial mass index and attenuated the progression of RAP -induced atrial fibrosis. [score:3]
Next, we investigated whether miR-21 over -expression promoted the TGF-β [1] -induced expression of collagen I/III, which were detected by qRT-PCR and. [score:3]
The miR-21 inhibitor, but not pre-miR-21, increased the accumulation of Smad7 (Fig.   5c). [score:3]
First, miR-21 expression in the presence of TGF-β [1] (10 ng/ml) was examined by qRT-PCR and Northern blot. [score:3]
Before treating the cells with TGF-β [1], CFs were transfected with miR-control and miR-21 over -expression lentiviral vectors. [score:3]
c Mean Smad7 protein levels in the CR, RAP and RAP + miR-21 inhibitor groups. [score:3]
CFs were co -transfected with the GV306 vector containing the Smad7 3′-UTR and the miR-21 overexpression plasmid using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:3]
However, whether miR-21 over -expression enhanced TGF-β [1] -induced myocardial fibrosis in AF remained elusive. [score:3]
g qRT-PCR demonstrating that miR-21 levels deceased in rat fibroblasts after transfection with the miR-21 inhibitor. [score:3]
MiR-control lentivirus vectors (109 TU/ml, 4 μl/day) and miR-21 inhibitor lentivirus vectors (109 TU/ml, 4 μl/day) were injected 2 times/per week for 4 weeks. [score:3]
h Mean collagen I and III protein levels in the CR, RAP and RAP + miR-21 inhibitor groups. [score:3]
Down -expression of miR-21 ameliorates myocardial fibrosis in vivo. [score:3]
Fig.  2The effect of a miR-21 inhibitor in RAP -induced myocardial fibrosis in vivo. [score:3]
These findings prompted us to focus on exploring the role of miR-21 in AF and the association with Smad7 expression. [score:3]
CR, unpaired t test; n ≥ 9 independent samples for each group) On the basis of the above findings, we decided to examine whether reduced expression of miR-21 ameliorates myocardial fibrosis in AF. [score:3]
Effect of TGF-β [1] on miR-21 expression in vitro. [score:3]
RAP caused significant collagen deposition in the left atria that was attenuated by the miR-21 inhibitor (* p < 0.05 vs. [score:3]
c Values of miR-21 expression are the mean ± SE. [score:3]
The transcript for the miR-21 inhibitor was PCR purified and inserted into the lentiviral vector under the control of the CMV promoter. [score:3]
c Mean miR-21 expression levels in the control group (CR), sham group (SH), and rapid atrial pacing group (RAP) groups. [score:3]
In recent years, additional roles of miR-21 in cardiovascular and pulmonary diseases have been described, including cardiac and pulmonary fibrosis as well as myocardial infarction [21– 23]. [score:3]
Fig.  4Effect of miR-21 on TGF-β [1] -induced collagen I/III expression. [score:3]
k Mean collagen I and III levels in the control (CR), miR-control (M), pre-miR-21 (PM), TGF-β [1] (T), TGF-β [1] + pre-miR-21 (TP) and TGF-β [1] + miR-21 inhibitor (TI) groups (* p < 0.05 vs. [score:3]
f Mean Smad7 protein levels in the control (CR), miR-control (M), pre-miR-21 (PM), TGF-β [1] (T), TGF-β [1] + pre-miR-21 (TP) and TGF-β [1] + miR-21 inhibitor (TI) groups (* p < 0.05 vs. [score:3]
a Alignment of hsa-miR-21 and mmu-miR-21 with human Smad7 3′-UTR and mouse Smad7 3′-UTR based on TargetScan and Pictar software (http://www. [score:3]
In contrast to the RAP group (89 % incidence of AF), treatment with the miR-21 inhibitor decreased the incidence of AF to 50 % (* p < 0.05). [score:3]
First, miR-21 inhibitor lentiviral vectors were injected into the jugular vein of rabbits 2 times per week for 4 weeks. [score:3]
Before treatment with TGF-β [1], CFs were transfected with the miR-control and miR-21 over -expression lentiviral vectors. [score:3]
We found that TGF-β [1] can enhance miR-21 expression (Fig.   4a–c, p < 0.05). [score:3]
e Masson trichrome staining of rabbit atrial samples from the CR, RAP, and RAP+miR-21 inhibitor groups. [score:3]
To examine whether Smad7 is a valid target of miR-21, a single copy of the putative miR-21-recognition element from the 3′-UTR of the Smad7 gene was cloned into the GV306 plasmid vector downstream of the dual luciferase reporter gene (Genechem, Shanghai, China). [score:3]
Increasing evidence indicates that targeting TGF-β [1]/Smad-specific miRNAs related to fibrosis may be a better approach for combating heart disease [38– 40], with miR-21 being the best characterized miRNA associated with TGF-β [1] -mediated fibrosis [41]. [score:3]
miR-21 over -expression increased collagen I/III mRNA and protein levels. [score:3]
Transfection with the miR-21 inhibitor, we found it reduce the incidence of AF and ameliorated RAP -induced atrial fibrosis. [score:3]
b Representative Northern blot depicts the expression of miR-21 mRNA. [score:3]
RAP caused a significant increase in miR-21 expression. [score:3]
de/) and previous experiments, Smad7 is a validated target of miR-21 [25, 33]. [score:3]
After treatment with the miR-21 inhibitor, the level of collagen I and III decreased significantly compared with the CR and RAP group (* p < 0.05 vs. [score:2]
TaqMan MicroRNA Reverse transcription reactions and TaqMan MicroRNA quantitative polymerase chain reactions (qPCR) were performed to detect miR-21 and an endogenous control, RNA U6 small nuclear (RNU6B) expression using the MicroRNA TaqMan Reverse Transcription Kit and the TaqMan MicroRNA Assays (Applied BioSystems, Carlsbad, CA, USA) according to manufacturer’s instructions. [score:2]
RAP, n ≥ 9 independent protein samples for each group) Effect of TGF-β [1] on miR-21 expression in vitroEarlier reports have shown that miR-21 is extensively involved in myocardial fibrosis, and miR-21 is considered to be associated with TGF-β [1] -induced myocardial fibrosis [22, 32]. [score:2]
However, the regulation mechanism linking miR-21 and Smad7 in RAP -induced myocardial fibrosis was unclear. [score:2]
In this assay, we found that miR-21 over -expression decreased Smad7 mRNA levels. [score:2]
Moreover, bioinformatics and the luciferase reporter assays showed that Smad7 is a validated target of miR-21. [score:2]
Fibroblasts in the cardiovascular system are enriched in miR-21, which contributes to the development of fibrosis and heart failure [15]. [score:2]
Therefore, to further confirm that Smad7 is a validated miR-21 target in CFs, we performed luciferase reporter assays. [score:2]
MiRNA-21 expression profile in atrial tachypacing -induced rabbit mo del of AF. [score:2]
After treatment with the miR-21 inhibitor, the level of Smad7 increased significantly compared with the CR group and the RAP group. [score:2]
For example, miR-21 and Smad7 are critical regulators of TGF-β [1] signaling during the induction of carcinoma -associated fibroblast formation [33, 45, 46]. [score:2]
When the cells reached 70–80 % confluency, they were transfected with pre-miR-21 or control pre-miR (Ambion, Austin, TX, USA) using the TransIT T KO transfection reagent (Mirus Bio, Madison, WI, USA). [score:1]
These data suggest that RAP -induced atrial fibrosis may be ameliorated by blocking miR-21 in the heart. [score:1]
T, unpaired t test; n = 10 independent samples for each group) In this study, we examined the relationship between miR-21 and TGF-β [1]/Smad7 signaling in AF -induced atrial fibrosis. [score:1]
To investigate the role of miR-21 in TGF-β [1] -induced collagen expression, we performed miR-21 transfection experiments in CFs. [score:1]
The miRNA expression levels were calculated as the cycle threshold (- delta CT) of miR-21 and normalized with an endogenous control. [score:1]
b Representative Northern blot showing miR-21. [score:1]
However, mechanistic data on the relationship between miR-21 and the TGF-β [1]/Smad7 signaling pathway in AF are still missing. [score:1]
These findings prompted us to focus on exploring the role of miR-21 in AF and the associated atrial remo deling. [score:1]
In this study, we explored the relationship between miR-21 and TGF-β [1] in cardiac fibroblasts. [score:1]
Next, we investigated the effect of miR-21 over -expression on Smad7 mRNA and protein, which were detected by RT-PCR and western blot. [score:1]
e qRT-PCR demonstrating that miR-21 levels increased in rat fibroblasts after transfection with pre-miR-21. [score:1]
Several nucleotides in the 50-region of miR-21 (human and mouse) contain a perfect match with the 3′-UTR sequences of the human and mouse Smad7 genes. [score:1]
As shown in Fig.   1a, qRT-PCR analysis confirmed that miR-21 was elevated by 4.5 times in RAP samples over control samples (Fig.   1a). [score:1]
a miR-21 mRNA levels were examined by qRT-PCR. [score:1]
T, unpaired t test; n = 10 independent samples for each group) As shown in Fig.   1a, qRT-PCR analysis confirmed that miR-21 was elevated by 4.5 times in RAP samples over control samples (Fig.   1a). [score:1]
However, there are few reports about the role of miR-21 in AF. [score:1]
[1 to 20 of 117 sentences]
2
[+] score: 382
Other miRNAs from this paper: rno-mir-30a, rno-mir-34a, rno-mir-708
Taken together, these results suggested that metformin effectively ameliorated IR by directly upregulating smad7 expression of miR-21 target and indirectly downregulating smad3 expression, and that miR-21 may be one of therapeutic targets of metformin for amelioratings IR. [score:17]
Taken together, these results suggested that metformin effectively ameliorated IR by directly upregulating smad7 expression of miR-21 target and indirectly downregulated TGF-β1/smad3 expression. [score:15]
Taken together, our data demonstrated that miR-21 over -expression could directly down-regulate smad7 and indirectly up-regulate smad3 expression, and that miR-21 can result in the degradation of smad7 and further lead to amplification of TGF-β1/Smad3 signaling. [score:13]
Inversely, there were the decrease of TGF-β1/smad3 and the increase of smad7 expression in down-miR-21 group (Figure 2C, 2D, p<0.05), suggesting that miR-21 over -expression could downregulate smad7 and upregulate smad3 expression, and that miR-21 can result in the degradation of smad7 and further lead to amplification of TGF-β1/Smad3 signaling. [score:13]
Next, to further testify the function of miR-21, smad7 expression was examined by fluorescent immunohistochemistry (FIHC), the results showed that miR-21 overexpression inhibited smad7 and anti-miR-21 upregulated smad7 protein expression (Figure 3E, 3F, p<0.05). [score:12]
Thus, we speculated that miR-21 and TGF-β1/Smad3 formed a double -positive feedback loop to enhance IR by downregulating smad7 expression, Figure 2 (A) Scheme showing that the process of miR-21 and TGF-β1 interact to regulate IR, miR-21 is upregulated by TGF-β1, which in turn inhibited Smad7 leading to amplification of TGF-β1 signaling finally resulting in IR. [score:12]
Thus, we speculated that miR-21 and TGF-β1/Smad3 formed a double -positive feedback loop to enhance IR by downregulating smad7 expression, Figure 2 (A) Scheme showing that the process of miR-21 and TGF-β1 interact to regulate IR, miR-21 is upregulated by TGF-β1, which in turn inhibited Smad7 leading to amplification of TGF-β1 signaling finally resulting in IR. [score:12]
Our results demonstrated that miR-21 was involved in IRSM by directly downregulating smad7 and indirectly upregulating smad3 expression. [score:11]
More importantly, metformin ameliorated IRSM by inhibiting miR-21 expression, and inhibition of miR-21 may be an effective target for directly alleviating IR. [score:10]
Overall, our results demonstrated that smad7 was a validated target of miR-21, which could directly down-regulate smad7 expression. [score:9]
In summary, our data demonstrated that miR-21 was involved in IRSM by directly downregulating smad7 and indirectly up -regulating smad3 expression. [score:9]
Next, to determine the effect of miR-21 overexpression on TGF-β1/smads in vitro, we performed cells transfection experiments, L6-SMCs with the addition of transfection agent and miR-control lentivirus vector (miR-control group), miR-21 overexpression lentivirus vector (pre-miR-21 group or miR-21 overexpression group), miR-21 inhibitor lentivirus vector(down-miR-21 group) and L6-SMCs without transfection were used as blank control group (blank group). [score:9]
As described above, miR-21 over -expression decreased smad7 expression in vitro, then, miR-21 over -expression was how to decrease smad7 expression. [score:9]
Metformin ameliorated insulin resistance by upregulating smad7 expression of miR-21 target. [score:8]
More importantly, metformin improve IRSM by inhibiting miR-21 expression, and that miR-21 may be one of the therapeutic targets for IR. [score:7]
After the treatment of metformin(0.2mmol/l) for 48h, metformin -treated L6-SMCs were transfected with miR-21 over -expression lentivirus vector, the results demonstrated that metformin could remarkably inhibit the decrease of miR-21 overexpression induced-smad7 mRNA. [score:7]
To examine whether smad7 was a validated target of miR-21, a putative single copy of miR-21-recognition element from the 3′-UTR of smad7 gene was cloned into downstream of the dual luciferase reporter gene of GV306 plasmid vector (Genechem, Shanghai, China), L6-SMCs were co -transfected with the GV306 vector containing smad7 3′-UTR and miR-21 overexpression plasmid by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), and the co-transfection with non -targeting negative control RNA was performed as control. [score:7]
To determine the between miR-21 with TGF-β1/smads signal in L6-SMCs, our experiment results showed that TGF-β1 could increase miR-21 expression, and miR-21 overexpression could increase TGF-β1/smad3 and decrease smad7 expression, consistent with the previous experiment [41]. [score:7]
For transfection experiments, L6-SMCs were seeded at a density of 2×10 [4] cells/cm [2] in serum-free MEM, with the addition of transfection agent and miR-control lentivirus vector (miR-control group), miR-21 overexpression lentivirus vector (pre-miR-21 group or miR-21 overexpression group), miR-21 inhibitor lentivirus vector(down-miR-21 group) and L6-SMCs without transfection were used as blank group (blank control group). [score:7]
To determine whether metformin has effect on TGF-β1/smad3 and smad7 expression by inhibiting miR-21 expression in vivo, the expression of TGF-β1/smad3 and smad7 were measured by WB and/or ICC at the end of the study. [score:7]
Due to miRNA's expression had spatio-temporal specificity in different tissues, cells and different phase of diseases, it remained unclear whether miR-21 was involved in IRSM by regulating smad7. [score:6]
Next, to further investigate the effect of metformin on smad7 expression of miR-21 target in L6-SMCs, before the treatment of metformin(0.2mmol/l), L6-SMCs were transfected with miR-control and miR-21 over -expression lentivirus vector, compared with miR-control group, miR-21 over -expression significantly decreased smad7 mRNA in vitro (Figure 4D, P<0.05). [score:6]
However, it remained elusive whether metformin improved skeletal muscle insulin resistance (IRSM) by regulating miR-21 and its target signal TGF-β1/smad7 expression. [score:6]
Next, to further investigate the effect of metformin on smad7 expression of miR-21 target in L6-SMCs, before and after the treatment of metformin, L6-SMCs were transfected with miR-control and miR-21 over -expression lentivirus vector, compared with miR-control group, miR-21 over -expression significantly decreased smad7 mRNA in vitro. [score:6]
In the present study, our aim was to determine whether miR-21 was involved in IRSM by regulating smad7 and metformin improved IRSM by inhibiting miR-21 expression. [score:6]
More importantly, our previous experiments demonstrated that miR-21 overexpression enhanced TGF-β1 -induced renal tubular EMT by inhibiting smad7 [19]. [score:5]
miR-21 may be a new therapeutic target for metabolic diseases such as T2DM and obesity [15]. [score:5]
More importantly, after L6-SMCs were treated with the different of metformin (0.1-0.5mmol/l), we found that metformin obviously decreased miR-21 expression at the concentration of 0.2-0.5mmol/l, whereas miR-21 expression was unchanged at the concentration of 0.1mmol/l (Figure 1F). [score:5]
Taken together, these results demonstrated that miR-21 expression was closely correlated with IRSM and metformin can ameliorate IR by decreasing miR-21 expression in concentration -dependent way. [score:5]
The results demonstrated that metformin can remarkably inhibit the decrease of miR-21 overexpression induced-smad7 mRNA. [score:5]
In our experiment, firstly, to determine the effect of metformin on miR-21 expression in vivo and in vitro, the results showed that metformin can reduce the level of miR-21 expression. [score:5]
Overexpression of miR-21 enhanced TGF-β1/smad3 and decreased smad7 expression in L6-SMCs. [score:5]
Metformin obviously inhibited miR-21 expression in vivo (P≤0.05). [score:5]
Effect of miR-21 overexpression on TGF-β1/smad3/smad7 expression in L6-SMCs. [score:5]
TGF-β regulates TGFBIp expression in corneal fibroblasts via miR-21 signaling [18]. [score:4]
To confirm the relationship between miR-21 andIR, firstly, miR-21 expression was detected by RT-PCR, the results showed that miR-21 expression was significantly increased in IR mo del group compared with NC group (Figure 1A, p≤0.01), accompanied by the increase of HOMA-IR, FIN, FBG, HbA1C, BW and TC. [score:4]
As for miR-21 and TGF-β1/smads, smad3 -mediated upregulation of miR-21 promotes epithelial to mesenchymal transition (EMT) [16]. [score:4]
Firstly, to explore the effect of TGF-β1 on miR-21 expression in L6-SMCs, L6-SMCs were treated with TGF-β1 (10ng/ml) at different length of time (24, 36, 48, 60,72h), the results showed that miR-21 expression was significantly elevated in TGF-β1 group compared with NC group at 48h (Figure 2B, p≤0.05). [score:4]
Next, we determined the effect of metformin on miR-21 expression in vivo and in vitro by RT-PCR, the results showed that metformin could reduce the level of miR-21 expression compared with IR mo del group, accompanied by the decrease of FIN, HOMA-IR, FBG, HbA1C,BG and TC(Figure 1A, 1B, 1C, p≤0.05). [score:4]
There were the increase of TGF-β1/smad3 and the decrease of smad7 expression in miR-21 overexpression group compared with miR-control group and blank control group (Figure 2C, 2D, p≤0.05). [score:4]
Our RT-PCR results exhibited that miR-21 expression was significantly increased in IR group, accompanied by the increase of HOMA-IR and the decrease of HOMA-ISI. [score:3]
More importantly, metformin (at the concentration of 0.2-0.5mmol/l) can decrease miR-21 expression in concentration -dependent way. [score:3]
However, the relationship between miR-21 and TGF-β1/smad3/smad7 expression and metformin intervention in L6-SMCs remained unclear. [score:3]
Meantime, miR-21 expression was detected at the different concentration of metformin (0.1-0.5mmol/l). [score:3]
Interestingly, the level of miR-21 expression was positively correlated with HOMA-IR(r=0.786, p≤0.05) and negatively correlated with HOMA-ISI(r=-0.833, p≤0.01) by Pearson analysis (Figure 1D, 1E, p≤0.01). [score:3]
Thereby, we speculated that miR-21 expression was closely correlated with IRSM. [score:3]
However, miR-21 was how to affect TGF-β1/smad3 and smad7 expression in L6-SMCs remained unclear. [score:3]
Figure 3 (A) Alignment of hsa-miR-21 and mmu-miR-21 with human smad7 3′-UTR and mouse smad7 3′-UTR based on targetScan software, several nucleotides in the 5′-region of miR-21 (human and mouse) contain a perfect match with the 3′-UTR sequence of the human and mouse smad7 genes. [score:3]
Smad7, but not TGF-β1/Smad3, was a validated miR-21 target in skeletal muscle cells. [score:3]
Additionally, we observed that metformin whether affects the expression of miR-21. [score:3]
Smad7, but not TGF-β1/ Smad3, was a validated miR-21 target in skeletal muscle cells. [score:3]
In addition, effect of TGF-β1 (10ng/ml) on miR-21 expression was detected in L6-SMCs at the time of time (24, 36, 48, 60,72h). [score:3]
miR-21 was involved in the pathogenesis of IR and diabetic mellitus -induced non-alcoholic fatty liver disease [14]. [score:3]
miR-21 may be as a therapeutic target in burn -induced IR [11]. [score:3]
miR-21 was positively correlated with HOMA-IRI and metformin decreased miR-21 expression in concentration -dependent way. [score:3]
Thus, we concluded that miR-21 and TGF-β1/smad3 formed a double -positive feedback loop to enhance IRSM by inhibiting smad7. [score:3]
Interestingly, the level of miR-21 expression was positively correlated with HOMA-IR and negatively correlated with HOMA-ISI. [score:3]
org/), Smad7, but not TGF-β [1]and Smad3, was a potential target of miR-21(Figure 3A). [score:3]
Additionally, TGF-β1/smad3-3′UTR reporter gene for luciferase activity was detected, to further identify whether TGF-β1/smad3 was a validated target of miR-21. [score:3]
miR-21 reverses high glucose and high insulin induced IR in 3T3-L1 adipocytes through targeting phosphatase and tensin homologue [15]. [score:3]
Figure 1 (A) compared with NC group, miR-21 expression was a significant difference in the IR group (P≤0.05). [score:2]
Accumulating evidences demonstrated that TGF-β1/smads signal and miR-21 existed in a complex regulation relationship, and play a pivotal role in IR [5, 19], smad3 and smad7 have an antagonistic effect on IR [16]. [score:2]
Meantime, to further confirm whether TGF-β1/smad3 was a validated miR-21 target in L6-SMCs, we performed the luciferase report gene assays for TGF-β1/smad3. [score:2]
The results exhibited that wild-type luciferase-smad7-3′UTR reporter gene for luciferase activity was remarkably decreased compared with mutant luciferase-smad7-3′UTR reporter and control plasmid, suggested that smad7 was a validated miR-21 target in L6-SMCs (Figure 3B, p<0.05). [score:2]
Therefore, to further confirm whether smad7 was a validated miR-21 target in L6-SMCs, we performed the luciferase report gene assays. [score:2]
More importantly, luciferase report gene assays showed that smad7 was a validated miR-21 target in L6-SMCs. [score:2]
The results exhibited that wild-type luciferase-TGF-β1/smad3-3′UTR reporter gene for luciferase activity was no difference compared with mutant luciferase-TGF-β1/smad3-3′UTR reporter and control plasmid, suggested that TGF-β1/smad3 was not a validated miR-21 target in MFCs (Figure 3C, 3D, p>0.05). [score:2]
Recent studies have indicated that miR-21 plays a crucial role in IR and skeletal muscle biological processes. [score:1]
These findings strongly suggested that miR-21 not only participated in IR, but also was closely related to TGF-β1/smads. [score:1]
miR-21 was involved in bovine skeletal muscle satellite cell myogenic differentiation [13]. [score:1]
However, it remained elusive whether miR-21 was involved in IRSM. [score:1]
Recent studies have indicated that miR-21 plays a crucial role in IR and skeletal muscle biological processes, but also associated with TGF-β1/smads signal. [score:1]
After the transfection of pre-miR-21 lentivirus vector, cells treated with 0.2mmol/l metformin for 72h as pre-miR-21+metformin group. [score:1]
miR-21 plays an important role in skeletal muscle growth in chicken [12]. [score:1]
Before the transfection, L6-SMCs were treated with 0.2mmol/l metformin for 72h, and then, pre-miR-21 lentivirus vector was transfected into L6-SMCs as metformin+pre-miR-21 group. [score:1]
[1 to 20 of 75 sentences]
3
[+] score: 365
Other miRNAs from this paper: rno-mir-370
To determine whether downregulating miR-21 impacted on ERK1 signaling and HSC activation, we transfected TGFβ1 -treated primary HSCs and HSC-T6 cells with miR-21 inhibitors and found that miR-21 inhibitors markedly reduced the levels of miR-21 along with an apparent decline in the mRNA transcript levels of ERK1 and its downstream target RSK2 (Fig. 5A and 5D). [score:10]
Downregulation of miR-21 targets ERK1 signaling and SPRY2 in HSC activation and blocks EMT of TGFβ1 -treated hepatocytes by targeting HNF4α. [score:8]
Downregulating miR-21 suppressed ERK1 signaling, inhibited HSC activation, and blocked EMT in TGFβ1 -treated hepatocytes. [score:8]
Moreover, our previous study showed that TGFβ1 negatively regulated sprouty2 (SPRY2) expression in HSC activation and ectopic HNF4α expression in the hepatocytes of rats with fibrotic livers was associated with blocked EMT and reduced miR-21 expression. [score:8]
As expected, inhibiting miR-21 upregulated SPRY2 and restrained ERK1 signaling in activated HSCs, and subsequently suppressed the migration of activated HSCs. [score:8]
Expectedly, our data suggested that miR-21 could contribute to the accumulation of fibroblasts not only by stimulating HSC activation via inhibiting SPRY2 expression to increase ERK1 signaling, but also by triggering EMT of hepatocytes via downregulating HNF4α. [score:8]
The results showed that downregulation of miR-21 could inhibit ERK1 signaling and HSC activation by targeting SPRY2. [score:8]
The above data further showed that downregulated miR-21 expression exerted the inhibitory effects on ERK1 signaling in HSCs and EMT of hepatocytes simultaneously during hepatic fibrosis. [score:8]
Expectedly, miR-21 inhibitors markedly reduced the expression of profibrotic genes in activated HSCs, including TGFβ1, α-SMA, Col I and III, and TIMP1, and augmented the expression of MMP-9 and MMP-13 (Fig. 5B, E and 5F). [score:7]
Quantitative RT-PCR examination of the expression of miR-21 and its targeted genes SPRY2 and HNF4α, ERK1 and its downstream target RSK2, and epithelial-mesenchymal transition (EMT) -associated genes E-cadherin and vimentin in the liver tissues of cirrhotic patients (n = 7) (C) and rats (n = 10) (D). [score:7]
Screening for targets of miR-21 using Target Scan and PicTar yielded SPRY2 and HNF4α as the putative targets. [score:7]
Interestedly, our results showed miR-21 and SPRY2/ HNF4α mutually modulated the expression of each other, suggesting that there was a regulatory feedback loop between miR-21 and its target genes. [score:6]
Given our current finding that miR-21 directly targeted HNF4α and our previous finding that HNF4α significantly suppressed the EMT of hepatocytes [16], we further examined the effects of miR-21 and HNF4α on each other and on the EMT of primary hepatocytes. [score:6]
The migration ability of HSC-T6 cells was also significantly suppressed by miR-21 downregulation (Fig. 5G and 5H). [score:6]
As our computational algorithm analysis showed that SPRY2 and HNF4α were candidate target genes of miR-21, we investigated whether miR-21 directly targeted SPRY2 and HNF4α expression by co-transfecting SPRY2 or HNF4α 3′-UTR reporter plasmids containing putative miR-21 binding sites and miR-21 mimics into HEK-293 cells. [score:6]
MiR-21 inhibitors target ERK1 signaling and SPRY2 in HSC activation and block EMT of TGFβ1 -treated hepatocytes by targeting HNF4α. [score:6]
Furthermore, miR-21 inhibitors significantly upregulated the mRNA transcript levels of SPRY2. [score:6]
The data revealed that decreased miR-21 expression could block the TGFβ1 -induced EMT process in hepatocytes by directly promoting HNF4α expression. [score:6]
These results indicated that miR-21 directly targeted SPRY2 and HNF4α mRNA to modulate their expression. [score:6]
Each value in (A), (B), (D), (E) and (F) represents the mean with the SD (error bars) for triplicate samples of at least three independent experiments and miR-21 expression was normalized against Rnu6-2 and mRNA expression was normalized against β-actin. [score:5]
Our luciferase reporter assays further demonstrated that miR-21 downregulated SPRY2 and HNF4α expression. [score:5]
Moreover, we demonstrated that decreased miR-21 expression in hepatocytes undergoing EMT could increase levels of HNF4α and epithelial markers, restore expression of certain liver specific genes in hepatocytes. [score:5]
Moreover, AdERK1 is synergetic with miR-21 mimics for the activation of ERK1 signaling in primary HSCs, and AdshERK1 could enhance the inhibitory effect of miR-21 inhibitor on the ERK1 signaling pathway in activated HSCs (Fig. S4A and S4B). [score:5]
Liver fibrosis is associated with broad changes in the expression of miR-21 and its targeted genes, ERK1 signaling and EMT -associated genes. [score:5]
Our data strongly indicated the presence of broad changes in miR-21 expression and its targeted genes, ERK1 signaling and EMT -associated genes in hepatic fibrosis and that miR-21 may be a central player in hepatic fibrogenesis. [score:5]
Target sites of miR-21 were predicted using TargetScan (www. [score:5]
Moreover, miR-21 inhibitors also caused a significant increase in the mRNA and protein levels of HNF4α, along with enhanced mRNA transcript levels of E-cadherin and certain liver specific genes, and attenuated the expression of a cluster of mesenchymal markers and profibrotic genes in TGFβ1 -treated hepatocytes (Fig. 5I-5K). [score:5]
In addition, AdSPRY2 infection of primary HSCs treated with TGFβ1 for 48 h suppressed the expression of miR-21 accompanied by a marked decline in the mRNA transcript levels of ERK1 and RSK2 (Fig. 3D), whereas miR-21 level slightly increased after primary HSCs were transfected with siRNA against SPRY2 (Fig. S3). [score:5]
Quantitative RT-PCR examination of the expression of miR-21 and its targeted genes SPRY2 and HNF4α, ERK1 and RSK2, E-cadherin, vimentin and MMP-9, liver fibrogenesis -associated genes α -SMA and TIMP1, and liver specific genes ALB and CYP1a2. [score:5]
Luciferase assay revealed suppressed SPRY2 and HNF4α expression by miR-21. [score:4]
The findings are consistent with the report of upregulated miR-21 in fibrotic liver biopsies of HCV patients [22]. [score:4]
In order to determine the effects of upregulating miR-21 on HSC activation and hepatocyte EMT, cells were cultured in medium without TGFβ1 and transfected with miR-21 mimics (100 pmol), or the control miRNA (100 pmol) for 48 h using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA) as instructed by the manufacturer. [score:4]
To examine the effect of downregulating of miR-21 on HSCs and hepatocytes, the cells were treated with TGFβ1 (3 ng/ml) for 48 h for hepatocytes and 5 days for HSCs. [score:4]
MiR-21 expression was normalized against Rnu6-2 and mRNA expression was normalized against β-actin. [score:4]
Previous studies have shown that miR-21 contributes to colon cancer and gliomas along with downregulation of SPRY2 to stimulate ERK signaling [44], [45]. [score:4]
We also found that overexpression of SPRY2 and HNF4α led to significantly subdued levels of miR-21 in HSCs and hepatocytes, suggesting the presence of autoregulatory feedback loops between miR-21 and SPRY2 or HNF4α. [score:4]
Interestingly, our computational prediction suggests that miR-21 may directly target the 3′-UTR of SPRY2 and HNF4α. [score:4]
Primary rat HSCs were treated with AdERK1 and miR-21 mimic (A) or primary HSCs were treated with TGFβ1 for 48 h followed by AdshERK1 and miR-21 inhibitor transfection for 48 h (B). [score:3]
The 280-bp fragment of the SPRY2 3′-UTR containing the miR-21 target sequence was amplified from total DNA of primary rat HSCs by PCR and cloned into the psiCHECK-2 dual luciferase reporter plasmid (Promega, Madison, WI) at the 3′-end of the coding sequence of Renilla reniformis luciferase to produce psiCHECK-2-SPRY2. [score:3]
Similarly, the luciferase reporter plasmid psiCHECK-2-HNF4α containing a 280-bp fragment of the HNF4α 3′-UTR with the miR-21 target sequence was prepared. [score:3]
MiR-21 directly targets the 3′-UTR of SPRY2 and HNF4α. [score:3]
We first examined the expression of miR-21 in the serum of patients with hepatic cirrhosis or rats with dimethylnitrosamine -induced liver cirrhosis, which was confirmed by histopathologic examination (Fig. S1A and S1B). [score:3]
MiR-21 regulates ERK1 signaling in HSCs by targeting SPRY2. [score:3]
Primary HSCs were treated with TGFβ1 for 5 d followed by transfection with miR-21 inhibitors. [score:3]
Hepatocytes were treated with TGFβ1 for 48 h followed by transfection with miR-21 inhibitors. [score:3]
We found that HNF4α significantly suppressed miR-21 and the mRNA transcript levels of vimentin while it markedly increased the mRNA transcript levels of E-cadherin (Fig. 4E), indicating that HNF4α may function downstream of miR-21. [score:3]
Ectopic miR-21 stimulated ERK1 signaling in HSCs and induced hepatocyte EMT by targeting SPRY2 or HNF4α. [score:3]
MiR-21 modulates ERK1 signaling and EMT in liver fibrosis by regulating SPRY2 and HNF4α expression. [score:3]
was performed to assess the effects of miR-21 on its predicted target genes SPRY2 and HNF4α. [score:3]
HSC-T6 cells were transfected with miR-21 inhibitors. [score:3]
MiR-21 mimic, miR-21 inhibitor (anti-miR-21), the control miRNA and small interfering RNAs (siRNAs) against SPRY2, ERK1 and HNF4α were synthesized by GenePharma (Shanghai, China). [score:3]
Quantitative RT-PCR was used to determine miR-21 and the expression of SPRY2, HNF4α and other genes. [score:3]
Primary HSCs and hepatocytes were treated with miR-21 mimics/inhibitors or appropriate adenoviral vectors to examine the relation between miR-21 and SPRY2 or HNF4α. [score:3]
MiR-21 and HNF4α mutually modulate the expression of each other in regulating EMT of primary hepatocytes. [score:3]
Based on these findings, we speculated that miR-21 could modulate hepatic fibrogenesis by targeting SPRY2 and HNF4α in HSCs and hepatocytes. [score:3]
Quantitative RT-PCR was carried out to detect miR-21 expression. [score:3]
MiR-21 expression was normalized against miR-238 in serum. [score:3]
Briefly, 1×10 [4] cells transfected with miR-21 inhibitors or the control miRNA were seeded in transwell inserts with 8.0- µm-pore transwell filters (BD, NJ), and the wells under the inserts were coated with fibronectin (50 µg/ml) and 500 µl DMEM containing 10% FBS was added as chemoattractants. [score:3]
MiR-21 and SPRY2 mutually modulate the expression of each other in regulating ERK1 signaling in HSCs. [score:3]
To determine sequence specificity, we also constructed the plasmids psiCHECK-2-mt-SPRY2 or psiCHECK-2-mt-HNF4α in which the conserved targeting sequence of miR-21 was mutated (from AUAAGCU to CUCGAGC). [score:3]
Taken together, our results revealed significant elevation of circulating, hepatic and cellular miR-21 expression, which is associated with ERK1 signaling and EMT in liver fibrosis. [score:3]
Aberrant expression of miRNAs has recently been documented in hepatic fibrogenesis, including miR-21, 122, -29, -19, -200, and -34 [29]– [34]. [score:3]
Co-transfection of miR-21 mimics and SPRY2 or HNF4α 3′-UTR reporter plasmids containing mutant miR-21 binding sites, on the other hand, failed to suppress luciferase activities (Fig. 2A and 2B). [score:3]
Then, the cells were transfected with miR-21 inhibitors (100 pmol) or its control miRNA (100 pmol) for 48 h. Additionally, cells were infected with appropriate adenoviral vectors at a multiplicity of infection (MOI) of 50 as detailed elsewhere in the text. [score:3]
HSC-T6 cells were transfected with miR-21 inhibitors and transwell cell migration assays were performed as described in methods (G, H). [score:2]
MiRNA-21 is highly expressed at the onset of fibrosis in many organs, including the human liver [20]– [22]. [score:2]
In view of previous studies and our present work, miR-21 is integrally involved in multiple pathways and profibrotic network in fibroblast transformation of quiescent HSCs and hepatocytes, including TGFβ1/smad, NF-κB, ERK1 signaling and EMT, suggesting that miR-21 may serve as a ‘super’ regulatory miRNA in liver fibrosis. [score:2]
MiR-21 may serve as a potentially biomarker as well as intervention target for hepatic cirrhosis. [score:2]
MiR-21 overexpression was associated with enhanced ERK1 signaling and EMT in liver fibrosis. [score:2]
To further confirm that dysregulated miR-21 simultaneously promotes fibrotic transformation of HSCs and hepatocytes, we treated primary HSCs or hepatocytes with miR-21 mimics. [score:2]
Prominent among these dysregulated miRNAs is miR-21, which has been shown to promote fibrogenic activation of fibroblasts [20], [35] and to be implicated in the amplification of a series of important cellular signaling pathways [21], [36], [37]. [score:2]
MiR-21 could serve as a potentially clinically useful biomarker and represent a promising molecular target for hepatic fibrosis. [score:2]
MiR-21 targets the 3′-UTR of SPRY2 and HNF4α. [score:2]
However, up to date, whether miR-21 could regulate multiple signaling pathways simultaneously in hepatic fibrogenesis is still unclear. [score:2]
MiR-21 promotes EMT of primary hepatocytes by targeting HNF4α. [score:2]
The sequences of putative miR-21 binding sites in the 3′-UTR of SPRY2 and HNF4α are shown (upper panels, A and B) with the mutated sequences CUCGAGC. [score:1]
Primary hepatocytes were transfected with miR-21 mimics followed by AdHNF4α (E) or AdshHNF4α (F) infection 48 h later. [score:1]
MiR-21 directly interacts with the 3′-UTR of SPRY2 and HNF4α, leading to enhanced ERK1 signaling in HSCs and hepatocyte EMT. [score:1]
Primary HSCs treated with TGFβ1 for 48 h were infected by AdSPRY2 (D) and primary quiescent HSCs were transfected with miR-21 mimics followed by AdSPRY2 infection 48 h later (E). [score:1]
In the current study, we examined serum and hepatic content of miR-21 in patients with liver cirrhosis and in rats with dimethylnitrosamine -induced hepatic cirrhosis. [score:1]
AdshHNF4α and miR-21 alone or in combination reduced the mRNA transcript levels of E-cadherin, but increased the mRNA-transcript levels of vimentin. [score:1]
Figure S5 Combined effect of miR-21 mimics and TGFβ1 on EMT in primary rat hepatocytes. [score:1]
The serum content of miR-21 was 2.3 fold higher in patients with liver cirrhosis than in healthy control subjects (Fig. 1A). [score:1]
MicroRNA-21 (miR-21) plays an important role in the pathogenesis and progression of liver fibrosis. [score:1]
Serum miR-21 contents in cirrhotic patients (n = 20) and normal subjects (n = 20) (A) and in rats with dimethylnitrosamine -induced liver cirrhosis (B). [score:1]
We further examined the effects of miR-21 and SPRY2 on each other and on ERK1 signaling in HSCs. [score:1]
Effects of miR-21 on SPRY2 and HNF4α in HSCs and hepatocytes were also examined. [score:1]
We found that AdshHNF4α slightly enhanced miR-21 level in primary hepatocytes (Fig. 4F). [score:1]
As shown in Fig. 4A, 4B and 4C, miR-21 mimics caused a marked reduction in the mRNA and protein levels of HNF4α in primary isolated hepatocytes along with a noticeable increase in the mRNA and protein levels of vimentin and a significant decrease in the mRNA transcript levels of E-cadherin. [score:1]
The serum and hepatic content of miR-21 was significantly higher in cirrhotic patients and rats. [score:1]
We then transfected primary hepatocytes with miR-21 mimics followed by AdHNF4α infection 48 h later. [score:1]
Here, we determined the serum and hepatic content of miR-21 in patients with liver cirrhosis and rats with dimethylnitrosamine -induced hepatic cirrhosis and examined the effects of miR-21 on SPRY2 and HNF4α in modulating ERK1 signaling in hepatic stellate cells (HSCs) and epithelial-mesenchymal transition (EMT) of hepatocytes. [score:1]
Figure S3 Effect of siRNA against SPRY2 on miR-21 level. [score:1]
Figure S4 Associative action of ERK1 and miR-21. [score:1]
We found that SPRY2 significantly attenuated miR-21 -induced increase in the mRNA transcript levels of ERK1 and RSK2 (Fig. 3E), suggesting that SPRY2 may function downstream of miR-21. [score:1]
These results suggest the presence of a modulatory loop between miR-21 and SPRY2. [score:1]
These results suggest the presence of a modulatory loop between miR-21 and HNF4α. [score:1]
Significantly higher serum miR-21 content was also seen in the cirrhotic rats (Fig. 1B). [score:1]
Primary rat hepatocytes were treated with miR-21 mimics for 48 h. MiR-21 and the mRNA transcript levels of HNF4α, EMT associated genes E-cadherin, vimentin and slug (A), MMP-2 and MMP-9, fibrogenesis -associated genes α -SMA and TIMP1 and liver specific genes ALB, CYP1a2 and AFP (B) were examined by quantitative RT-PCR. [score:1]
Primary HSCs were treated with miR-21 mimics for 48 h, MiR-21 and the mRNA transcript levels of SPRY2, ERK1 and RSK2 (A), MMP-9 and MMP-13, fibrogenesis -associated genes α -SMA, TIMP1, Col I and Col III (B) were examined by quantitative RT-PCR. [score:1]
Meanwhile, we observed that miR-21 mimics caused a noticeable increase in the mRNA transcript and protein levels of ERK1 and RSK2. [score:1]
To examine the level of miR-21 in serum, we used RT and qPCR kits specifically for accurate miRNA analysis (Applied Biosystems). [score:1]
Additionally, TGFβ1 markedly increased miR-21 levels in primary HSCs and hepatocytes of rats in a time -dependent manner (Fig. 1E and 1F). [score:1]
The enhanced effect of miR-21 on EMT and ERK1 singling prompted us to propose that inhibiting miR-21could ameliorate biological characteristics of activated HSCs as well as block EMT of TGFβ1 -treated hepatocytes. [score:1]
Quantitative RT-PCR was carried out to detect the levels of miR-21, ERK1, RSK2 and α-SMA. [score:1]
AdHNF4α infection of primary hepatocytes that had been treated by TGFβ1 for 48 h decreased miR-21 levels, along with a significant reduction in the mRNA transcript levels of vimentin and a noticeable increase in the mRNA transcript levels of E-cadherin (Fig. 4D). [score:1]
HEK-293 cells were transfected with miR-21 mimics and SPRY2 (A) or HNF4α 3′-UTR reporter plasmids (B) containing putative wild type miR-21 binding sites or mutant miR-21 binding sites. [score:1]
Primary rat hepatocytes were treated with miR-21 mimics and TGFβ1 for 48 h. MiR-21 level was examined by quantitative RT-PCR (A). [score:1]
We found that miR-21 mimics caused a marked reduction in the mRNA transcript and protein levels of SPRY2 in primary quiescent HSCs (Fig. 3A–3C). [score:1]
Consistently, we also observed a marked increase in the miR-21 content in the cirrhotic liver tissues of humans and rats (Fig. 1C and 1D). [score:1]
To our knowledge, this is the first report of the roles of miR-21 in simultaneous myofibrobalst transformation of both liver parenchymal and mesenchymal cells in liver fibrosis. [score:1]
Furthermore, we transfected primary hepatocytes with miR-21 mimics followed by AdshHNF4α infection 48 h later. [score:1]
We then transfected primary quiescent HSCs with miR-21 mimics followed by AdSPRY2 infection 48 h later. [score:1]
Importantly, miR-21 stimulates the proliferation and activation of fibroblasts in different organs with fibrosis, which may involve the PTEN/Akt, NF-kappa B (NF-κB) and ERK1 signaling pathways [20]– [25]. [score:1]
In the current study, we observed markedly increased miR-21 contents in the serum and hepatic tissues of patients with liver cirrhosis and rats with dimethylnitrosamine -induced hepatic cirrhosis. [score:1]
Additional studies further implicate miR-21 in the activation of HSCs [21]. [score:1]
In this study, a computational algorithm analysis suggested that SPRY2 and HNF4α contain putative miR-21 binding sites. [score:1]
0108005.g001 Figure 1. Serum miR-21 contents in cirrhotic patients (n = 20) and normal subjects (n = 20) (A) and in rats with dimethylnitrosamine -induced liver cirrhosis (B). [score:1]
To examine the level of miR-21 in tissues, RNA (2 µg) was polyadenylated with ATP using a poly (A) polymerase (New England BioLabs, Ipswich, MA) at 37°C for 2 h, reverse-transcribed with Super Script III (Invitrogen) and a poly (T) adapter, and subjected to SYBR Green -based real-time PCR analysis (Takara, Dalian, China). [score:1]
MiR-21 was normalized against miR-238 in the serum and against Rnu6-2 in liver tissues. [score:1]
[1 to 20 of 120 sentences]
4
[+] score: 312
The study’s principal findings are that: (1) mir-21 mediates collagen synthesis by activating the ERK/NF-κB/NLRP3 inflammsome pathway via targeting Spry1 in lung fibroblasts; (2) mir-21 is up-regulated in primary lung fibroblasts treated with AngII and in BLM -induced pulmonary fibrosis; and (3) mir-21 mediates the inhibitory effect of ACE2/Ang(1–7) on AngII -induced NLRP3 inflammasome activation by targeting Spry1 in lung fibroblasts. [score:10]
Therefore, we hypothesized that ACE2/Ang(1–7) prevents AngII -induced pulmonary fibrosis by inhibiting the expression of mir-21, and that mir-21 mediates the inhibitory effect of ACE2/Ang(1–7) on AngII -induced-NLRP3 inflammasome activation via the ERK/NF-κB pathway by targeting Spry1 in lung fibroblasts. [score:9]
Overexpression of mir-21 inhibited apoptosis and up-regulated a-collagen I synthesis in lung fibroblasts (Fig.   1C,E) accompanied by increased p-ERK- NLRP3 inflammasome complex (NLRP3, Pro-caspase-1), Pro-IL-1β, and IL-1β protein levels, but decreased Spry1 protein levels (Fig.   1B,C). [score:8]
Consistent with these results, we found that mir-21 l was markedly up-regulated in the lung of BLM -treated rats in vivo, and that over -expression of mir-21 inhibited lung fibroblast apoptosis and promoted collagen synthesis in vitro. [score:8]
It has been reported that mir-21 levels are up-regulated in fibrosis of the kidneys [31], heart [32], liver [9], and lungs [7], and that targeting mir-21 therapeutically may have the ability to prevent development of organ fibrosis [4]. [score:7]
Increasing additional roles 28– 30 in other diseases suggest that elevated mir-21 expression may represent a common feature of pathological progression, including fibrotic diseases. [score:7]
By inhibiting ERK and NF-κB, U0126 and BAY 117082 inhibited mir-21 over -expression -induced activation of the NLRP3 inflammasome complex. [score:7]
Figure 1Over -expression of mir-21 inhibited apoptosis and promoted collagen synthesis by activating the ERK/NF-κB /NLRP3 inflammasome pathway via targeting Spry1 in lung fibroblasts. [score:7]
Adam et al. [24] have also reported that AngII up-regulates the expression of mir-21 in cardiac fibroblasts, resulting in their activation and atrial fibrosis. [score:6]
Both clinical and experimental animal studies have revealed that aberrant expression of miRNAs is associated with the development of fibrotic diseases 4– 6. Recent studies have shown that microRNA-21 (mir-21) is increased in the lung of bleomycin (BLM) -treated mice as well as in patients with idiopathic pulmonary fibrosis (IPF) [2], and that it mediates lung fibroblast activation and fibrosis [7]. [score:6]
In this study, we have demonstrated that AngII -upregulated mir-21 activates the NLRP3 inflammasome by targeting Spry1, which promoted lung fibroblast collagen synthesis and exacerbated BLM -induced fibrosis. [score:6]
In 2012, Adam et al. [24] reported that AngII up-regulates the expression of mir-21 in cardiac fibroblasts. [score:6]
In BLM -treated rats, constant infusion of exogenous AngII significantly up-regulated the expression of mir-21 and aggravated lung fibrosis. [score:6]
Up-regulated mir-21 enhances transcription of fibronectin (FN) and α-smooth muscle actin (α-SMA), but gene silencing of mir-21 inhibits collagen deposition and myofibroblast differentiation [4]. [score:6]
Figure 3ACE2/Ang(1–7) inhibited AngII -induced apoptosis resistance and collagen synthesis by inhibiting the mir-21 -mediated Spry1/ERK/NF-κB NLRP3 inflammasome pathway. [score:5]
Spry1, a direct target of mir-21, augments extracellular signal-regulated kinase (ERK) activity in cardiac fibroblasts [8] and hematopoietic stem cells (HSCs) [9]. [score:5]
Overall, these data suggest that mir-21 mediates the inhibitory effect of ACE2/Ang (1–7) on AngII -induced activation of the NLRP3 inflammasome by targeting Spry1 in lung fibroblasts. [score:5]
Taken together, these data demonstrate that mir-21 mediates the inhibition of ACE2/Ang (1–7) on angiotensin II induced-NLRP3 inflammasome activation via ERK/NF-κB pathway by targeting Spry1 in lung fibroblasts (Fig.   6). [score:5]
Wu K Inhibiting miR-21 attenuates experimental hepatic fibrosis by suppressing both the ERK1 pathway in HSC and hepatocyte EMTClin. [score:5]
In this study, overexpression of mir-21 promoted ERK phosphorylation and NF-κB nuclei translocation by inhibiting the Spry1 gene. [score:5]
To test whether AngII promotes mir-21 expression in lung fibroblasts, the cells were treated with AngII (10 [−7] mmol/L) at different time points, and the expression of mir-21 was determined. [score:5]
In contrast, ACE2/Ang(1–7) prevented AngII -induced collagen synthesis in lung fibroblasts and BLM -induced pulmonary fibrosis by inhibiting the expression of mir-21. [score:5]
Figure 2Inhibition of mir-21 suppressed AngII -induced apoptosis resistance, collagen synthesis, and the Spry1/ERK/NF-κB /NLRP3 inflammasome pathway in lung fibroblasts. [score:5]
In accordance with these results, we found that AngII -induced mir-21 inhibited fibroblast apoptosis by the Spry1/ERK/ NF-κB pathway by targeting Spry1 degradation. [score:5]
Other recent studies have shown that AngII promotes mir-21 expression 20, 21, and 1 study found that Ang(1–7) reduces mir-21 expression in muscle [22]. [score:5]
Ning et al. [18] discovered that Spry1, an important target gene of mir-21, can inhibit the ERK/NF-κB pathway, which is involved in liver fibrosis [18]. [score:5]
ACE2/Ang(1–7) failed to inhibit NLRP3 inflammasome activation and a-collagen I induced by mir-21 over -expression. [score:5]
Liu X Transforming growth factor-β-sphingosine kinase 1/S1P signaling upregulates microRNA-21 to promote fibrosis in renal tubular epithelial cellsExp. [score:4]
Consequently, down-regulation of mir-21 may be a promising strategy for the prevention and treatment of pulmonary fibrosis. [score:4]
Similarly, knocking down mir-21 inhibited the effect on apoptosis resistance of AngII (Fig.   2F). [score:4]
Li S Liang Z Xu L Zou F MicroRNA-21: a ubiquitously expressed pro-survival factor in cancer and other diseasesMol. [score:4]
AngII‒up-regulated mir-21 led to apoptosis resistance and collagen synthesis in lung fibroblasts. [score:4]
Exogenous ACE2/Ang(1–7) over -expression protected against BLM -induced pulmonary fibrosis by down -regulating mir-21. [score:4]
ACE2 degrades AngII to produce Ang(1–7), which reverses the AngII’s profibrotic effect via downregulating mir-21. [score:4]
However, ACE2/Ang(1–7) antagonized the pro-fibrotic effect of AngII by down -regulating mir-21 expression. [score:4]
AngII binds with AT1R in lung fibroblasts to enhance the expression level of mir-21, the recognized pro-fibrotic factor. [score:3]
As shown in Fig.   3A, ACE2/Ang(1–7) markedly decreased the expression of mir-21 induced by AngII. [score:3]
Thus, mir-21 activated the NLRP3 inflammasome /IL-1β secretion axis via the ERK/NF-κB pathway by targeting Spry1. [score:3]
Ling et al. [17] and Ning et al. [18] have confirmed that mir-21 activates ERK/NF-κB by promoting degradation of the target gene Spry1. [score:3]
We found that the effect of AngII -induced mir-21 was abolished by ACE2/Ang(1–7) in lung fibroblasts in vitro, and that exogenous Ang(1–7) infusion or lentiACE2 intratracheal instillation significantly decreased mir-21 expression and attenuated lung fibrosis induced by BLM in vivo. [score:3]
Jafarinejad-Farsangi S Inhibition of microRNA-21 induces apoptosis in dermal fibroblasts of patients with systemic sclerosisInt. [score:3]
These data indicate that mir-21 inhibited apoptosis and promoted a-collagen I synthesis by activating the NLRP3 inflammasome via the Spry1/ERK/NF-κB pathway in lung fibroblasts. [score:3]
In accordance with these results, we found the NLRP3 inflammasome/IL-1β secretion axis was activated by AngII or mir-21 over -expression in lung fibroblasts, and that this can be reversed by anti-mir-21 probes. [score:3]
Hence, it can be inferred that mir-21 activates the NLRP3 inflammasome via the ERK/NF-κB pathway by targeting Spry1 in lung fibroblasts. [score:3]
Although the mir-21 level was markedly reduced by infusion of Ang(1–7) or over -expression of ACE2, it was augmented by Ang II treatment (Fig.   5D,E). [score:3]
Neither ACE2 nor Ang(1–7) influenced the function or the downstream molecular signaling of mir-21, but they did influence its expression. [score:3]
These in vitro results suggest that mir-21 mediated the inhibitory effect of ACE2/Ang(1–7) on AngII -induced apoptosis resistance and a-collagen I synthesis in lung fibroblasts. [score:3]
Conversely, U0126 and BAY117082 inhibited NF-κB translocation, the protein levels of Pro-IL-1β, IL-1β, NLRP3 inflammasome complex, and caspase-1 induced by pre-mir-21 (Fig.   1B,C,E), as well as apoptosis resistance and a-collagen I synthesis. [score:3]
Mir-21 antisense probes were used to reduce mir-21 expression level in AngII -treated cells (Fig.   2B). [score:3]
We demonstrated that AngII -induced mir-21 activated the NLRP3 inflammasome in lung fibroblasts by targeting Spry1, resulting in apoptosis resistance and collagen synthesis. [score:3]
However, it has not been determined whether mir-21 mediates pulmonary fibrosis via the ERK signaling pathway by targeting Spry1. [score:3]
Collectively, we demonstrated that AngII -induced mir-21 mediated ERK/NF-κB pathway activation by targeting Spry1 in lung fibroblasts. [score:3]
Moreover, the effects of AngII in inhibiting apoptosis and promoting collagen synthesis can be reversed by silencing mir-21 in lung fibroblasts. [score:3]
Similarly, mir-21 has been shown to be involved in apoptosis resistance in a variety of disease states 29, 30, 44, 45. [score:3]
In exploring whether these responses of ACE2/Ang1–7 were mediated by mir-21, we found that activation of the Spry1/ERK/ NF-κB pathway and the NLRP3 inflammasome/IL-1β secretion axis by over -expression of mir-21 could not be reversed by ACE2/Ang(1–7). [score:3]
In this study, we have shown that mir-21 over -expression or AngII -induced mir-21 significantly increased p-ERK and NF-κB nucleoprotein levels, but decreased the Spry1 protein level in lung fibroblasts. [score:3]
Moreover, mir-21 silencing inhibited the Spry1/ERK/ NF-κB pathway activation. [score:3]
Mir-21 has been shown to play an important role in fibrotic diseases. [score:2]
Mir-21 inhibited apoptosis, promoted collagen synthesis, and activated the NLRP3 inflamasome via the Spry1/ERK/NF-κB pathway in lung fibroblasts. [score:2]
Ning, Z. W. et al. MicroRNA-21 mediates angiotensin II -induced liver fibrosis by activating NLRP3 inflammasome/IL-1β axis via targeting Smad7and Spry1. [score:2]
Cheng M Celastrol -induced suppression of the MiR-21/ERK signalling pathway attenuates cardiac fibrosis and dysfunctionCell. [score:2]
Furthermore, ACE2/Ang(1–7) reversed the anti-apoptosis effect of AngII by down -regulating mir-21. [score:2]
Ling M Regulation of miRNA-21 by reactive oxygen species-activated ERK/NF-κB in arsenite -induced cell transformationFree Radic. [score:2]
Mir-21 mediated the inhibitory effect of ACE2/Ang(1–7) on AngII -induced apoptosis resistance and a-collagen I synthesis in lung fibroblasts. [score:2]
Mir-21 promotes ERK phosphorylation and NF-κB nuclei translocation by targeting Spry1 degradation, following NLRP3 inflammasome activation. [score:2]
These findings suggest a critical role of mir-21 in both the pro-fibrotic effect of AngII and the anti-fibrotic effect of ACE2/ Ang(1–7) in BLM -induced pulmonary fibrosis. [score:1]
Lorenzen JM Osteopontin is indispensible for AP1 -mediated angiotensin II-related miR-21 transcription during cardiac fibrosisEur. [score:1]
AngII, the principal effector peptide of the vasoconstrictor arm of the renin-angiotensin system (RAS), has a key role in the initiation and perpetuation of inflammation and fibrosis in experimental lung fibrosis [34], and it is now becoming apparent that mir-21 is transcriptionally activated in cardiac fibrosis related to AngII [32]. [score:1]
As shown in Fig.   2A, the mir-21 level increased significantly in a time -dependent manner after treatment with AngII. [score:1]
Hence, AngII -induced mir-21 promoted collagen synthesis in lung fibroblasts and exacerbated BLM -induced lung fibrosis. [score:1]
Figure 4ACE2/Ang-(1–7) had no influence on the downstream pathway of mir-21. [score:1]
2016.06.012 27320964 6. Li G Fibroproliferative effect of microRNA-21 in hypertrophic scar derived fibroblastsExp. [score:1]
In situ hybridization (ISH) Lung sections were treated with an acetylation solution and proteinase K. The sections were then blocked with hybridization solution and incubated with digoxigenin-conjugated mir-21 probes (Exiqon, Denmark). [score:1]
Together with the in vitro results, we concluded that ACE2/Ang(1–7) attenuated and AngII exacerbated BLM -induced lung fibrosis by modulation of mir-21. [score:1]
Thus, mir-21 mediated AngII -induced apoptosis resistance and a-collagen I synthesis in lung fibroblasts. [score:1]
Figure 5Bleomycin (BLM) -induced pulmonary fibrosis was attenuated by ACE2/Ang(1–7) and exacerbated by AngII via different effects on the mir-21 -mediated Spry1/ERK/NF-κB/NLRP3 pathway. [score:1]
The mir-21 levels were detected by qRT-PCR. [score:1]
Guo Q MicroRNA-21 regulates non-small cell lung cancer cell proliferation by affecting cell apoptosis via COX-19Int. [score:1]
Primary lung fibroblasts were transfected with control miRNA precursors (pre-NC) or mir-21 precursors (pre-21) for 48 h and then treated with U0126 (10 [−5] mol/L) or BAY 117082 (10 [−5] mol/L). [score:1]
In conclusion, our study has demonstrated that AngII induction of mir-21 is a crucial factor that mediates pulmonary fibrosis by activating the NLRP3 inflammasome/IL-1β secretion axis via the Spry1/ERK/NF-κB pathway. [score:1]
We therefore investigated whether ACE2 and Ang(1–7) interfere with the effects of AngII on mir-21 expression. [score:1]
As a result, mir-21 and NLRP3 inflammasome play a key in local RAAS imbalance induced lung fibrosis. [score:1]
Immunofluorescence staining showed that mir-21 induced co-localization of NLRP3 and caspase-1 in cytoplasm, which could be abolished by U0126 and BAY 117082 (Fig.   1D). [score:1]
Although the pro-fibrotic effect of mir-21 is clear, the precise molecular mechanism by which it exerts this effect needs to be elucidated. [score:1]
However, how mir-21 exerts this effect remains to be elucidated. [score:1]
Primary lung fibroblasts were transfected with mir-21 precusors (pre-21) after the cells had been transfected with lentiACE2 or pretreated with Ang(1–7) for 24 h. (A) The mir-21 levels were detected by qRT-PCR. [score:1]
Consistent with previous findings, we found that mir-21 levels were significantly increased in lung fibroblasts treated with AngII. [score:1]
Thus, mir-21 has a potential role in activation of the NLRP3 inflammasome/IL-1β secretion axis. [score:1]
A number of signaling pathways have been identified as being involved in the fibrogenensis mediated by mir-21 in different organs, including PTEN/Akt, NF-κB, ERK, TGF-β1/Smad, and IL-13/Smad signaling pathways [35]. [score:1]
Mir-21 is recognized as an oncomiR due to its activity on cellar proliferation, differentiation, and apoptosis. [score:1]
200912-1840OC 20581171 2. Yamada M The increase of microRNA-21 during lung fibrosis and its contribution to epithelial-mesenchymal transition in pulmonary epithelial cellsRespir. [score:1]
Lung sections were treated with an acetylation solution and proteinase K. The sections were then blocked with hybridization solution and incubated with digoxigenin-conjugated mir-21 probes (Exiqon, Denmark). [score:1]
We therefore explored whether the effects of AngII are mediated by mir-21. [score:1]
AngII -induced changes of protein levels of the Spry1/ERK/NF-κB/NLRP3 inflammasome pathway and a-collagen I were restored by mir-21 antisense probes (Fig.   2C,E). [score:1]
In investigating the links of ACE2 /Ang(1–7) and mir-21 in pulmonary fibrosis, we found that the protein levels of ERK/NF-κB, the NLRP3 inflammasome, and collagen were increased, but Spry1 was decreased by over -expression of mir-21, and these effects could not be reversed by ACE2/Ang(1–7) [Fig.   4A,B,C,D]. [score:1]
2016.05.013 27207585 7. Liu G miR-21 mediates fibrogenic activation of pulmonary fibroblasts and lung fibrosisJ. [score:1]
Furthermore, recent studies have shown that mir-21 is involved in the promotion of fibrogenic activation of fibroblasts in different organs [2]. [score:1]
Adam O Role of miR-21 in the pathogenesis of atrial fibrosisBasic Res. [score:1]
Thus, we propose that the pro-fibrotic effect of AngII may be associated with its augmentation of mir-21. [score:1]
[1 to 20 of 99 sentences]
5
[+] score: 284
Other miRNAs from this paper: rno-mir-133a, rno-mir-1, rno-mir-133b, rno-mir-133c
Knockdown of miR-21 abolished the effects of IPostC on alleviating I/R injury and suppressing apoptosis by upregulating PDCD4 and Fas-L. HIF-1α inhibition downregulated miR-21 and abolished the protective effects of IPostC mediated by the inhibition of apoptosis. [score:14]
To further examine the role of apoptosis in I/R -induced intestinal injury and the protective effects of IPostC, we examined TUNEL-stained sections and assessed the expression of PDCD4 and Fas-L. HIF-1α inhibition increased the apoptosis index (35.9 ± 3.1% vs 14.9 ± 2.1%; P < 0.01) and upregulated PDCD4 and Fas-L in tissues exposed to IPostC, whereas knockdown of miR-21 under these conditions had no effect on apoptosis or PDCD4 and Fas-L expression (Fig.   6A–C). [score:11]
miR-21 is downregulated in cardiomyocytes in response to hypoxia, and its overexpression decreases infarct size, exerting an antiapoptotic effect by suppressing the expression of Fas-L [16]. [score:10]
In the present study, we showed that IPostC suppressed apoptosis and I/R injury by upregulating miR-21 and downregulating PDCD4 and Fas-L. miR-21 was shown to protect rat hearts against I/R injury by decreasing apoptosis via the modulation of PDCD4 [10]. [score:9]
In addition, PDCD4 expression in intestinal epithelial cells was upregulated by anti-miR-21 (1.62 ± 0.07 vs 1.0 ± 0.05, P < 0.01), but downregulated by pre-miR-21 (0.76 ± 0.04 vs 1.0 ± 0.05, P < 0.01) (Fig.   3C). [score:9]
The protective effect of ischemic preconditioning in the heart was shown to be mediated by the upregulation of miR-21 and the downregulation of its target PDCD4 [10]. [score:9]
Furthermore, the upregulation of miR-21 by IPostC was associated with the activation of HIF-1α, the suppression of apoptosis, and the downregulation of PDCD4 and Fas-L. We examined the levels of HIF-1α during I/R and IPostC to clarify the roles of hypoxia, HIF-1α, miR-21, and apoptosis in IPostC. [score:9]
Western blot and qRT-PCR analyses demonstrated that HIF-1α and miR-21 expression in intestinal tissues was upregulated by I/R and further upregulated by IpostC (3.59 ± 0.40, 4.81 ± 0.29 vs 1.0 ± 0.16; P < 0.01) (Fig.   1E and F). [score:9]
As well, Fas-L expression in intestinal epithelial cells was upregulated by anti-miR-21 (1.46 ± 0.06 vs 1.0 ± 0.04, P < 0.01), but downregulated by pre-miR-21 (0.68 ± 0.03 vs 1.0 ± 0.04, P < 0.01) (Fig.   3F). [score:9]
In a rat mo del of myocardial infarction, miR-21 was shown to be downregulated in infarcted areas, and its overexpression inhibited apoptosis through the modulation of PDCD4 [22]. [score:8]
IPostC attenuates intestinal I/R injury by suppressing apoptosis via a regulatory axis involving the induction of miR-21 by HIF-1α, leading to the downregulation of the apoptotic mediators PDCD4 and Fas-L. Further research is necessary to confirm these findings and to clarify the role of other survival mediators and pathways in the protective effect of IPostC against intestinal injury. [score:7]
Our results showed that HIF-1α was upregulated in intestinal tissues exposed to I/R, whereas IPostC reduced the injury score and apoptosis concomitant with a further upregulation of HIF-1α and miR-21. [score:7]
Inhibition of HIF-1α resulted in a significant downregulation of miR-21 (0.39 ± 0.05 vs 1.0 ± 0.11; P < 0.01) concomitant with a significant increase in the intestinal injury score (3.3 ± 0.32 vs 1.3 ± 0.19; P < 0.01) in rats exposed to IPostC, and this effect was not enhanced by treatment with anti-miR-21 (Fig.   5B–D), indicating that the protective effects of IPostC may be mediated by a regulatory loop involving HIF-1α and miR-21 in response to hypoxia. [score:7]
Figure 5HIF-1α inhibition downregulated miR-21 and abolished the protective effects of IPostC. [score:6]
miR-21 is upregulated by IPostC and has a protective effect against I/R injury in the heart through target programmed cell death 4 (PDCD4) [10]. [score:6]
Intermittent hypoxia could further up-regulate the expression of HIF-1α and miR-21, making it more likely to counteract the damage caused by hypoxia. [score:6]
The upregulation of HIF-1α and miR-21 by hypoxia was abolished by siRNA -mediated silencing of HIF-1α, confirming the modulation of miR-21 expression by HIF-1α. [score:6]
siRNA -mediated silencing of HIF-1α in IE-6 cells abolished the effect of hypoxia on the upregulation of HIF-1α and miR-21 expression, as determined by western blotting and qRT-PCR (Relative 1.2 ± 0.15 vs. [score:6]
In parallel with HIF-1α expression, miR-21 was significantly upregulated by hypoxia and its levels were restored by re-oxygenation (Relative 3.7 ± 0.41, 8.1 ± 0.79, 1.3 ± 0.17 vs sham) (Fig.   2B). [score:6]
Western blot analysis showed that PDCD4 and Fas-L were downregulated by IPostC, whereas their levels were restored by miR-21 knockdown (Fig.   4F). [score:5]
After 3 hours of reperfusion, miR-21 was upregulated in the intestinal mucosa in IPostC-pretreated rats relative to the I/R group (relative 4.2 ± 0.39 vs 3.4 ± 0.31; P < 0.01), and this effect was abolished by miR-21 knockdown (1.59 ± 0.14 vs 4.2 ± 0.39; P < 0.01), as determined by qRT-PCR (Fig.   4A). [score:5]
For miR-21 upregulation, pre-miR-21 (Ambion, Grand Island, NY, USA) was added directly to the complexes and used at a final concentration of 30 nM. [score:5]
We found that miR-21 expression was successfully inhibited by anti-miR-21 (0.31 ± 0.03 vs 1.0 ± 0.12; P < 0.01), in cultured intestinal epithelial cells (Fig.   2E). [score:5]
Taken together, these data indicated that IPostC inhibits apoptosis via the HIF-1α -mediated modulation of miR-21 and its downstream targets. [score:5]
Knockdown of miR-21 had no effect on HIF-1α expression. [score:4]
IPostC attenuated intestinal I/R injury and was associated with the upregulation of HIF-1α and miR-21. [score:4]
Upregulation of HIF-1α and miR-21 in hypoxic condition should be a protective mechanism against hypoxia, however it could not resist the damage caused by hypoxia. [score:4]
Figure 4Knockdown of miR-21 abolished the effects of IPostC on alleviating I/R injury and suppressing apoptosis. [score:4]
Cheng Y Ischaemic preconditioning-regulated miR-21 protects heart against ischaemia/reperfusion injury via anti-apoptosis through its target PDCD4Cardiovasc. [score:4]
For miR-21 knockdown, a miR-21 inhibitor (LNA-anti-miR-21; Exiqon, Woburn, MA, USA) was added to the culture medium at a final concentration of 30 nM. [score:4]
Assessment of apoptosis by TUNEL staining showed a similar pattern in which IPostC attenuated apoptosis (19.0 ± 2.1% vs 39.4 ± 3.5%; P < 0.01), whereas knockdown of miR-21 suppressed the protective effects of IPostC, restoring the apoptotic index to that of tissues exposed to I/R (41.0 ± 0.39% vs 19.0 ± 2.1%; P < 0.01) (Fig.   4D and E). [score:4]
In the present study, we showed that IPostC upregulated miR-21 concomitant with a reduction in I/R injury in a rat mo del of intestinal I/R. [score:4]
These results indicated that IPostC -upregulated HIF-1α/miR-21 had a protective effect against ischaemia -induced intestinal epithelial cell apoptosis in vitro. [score:4]
Liu, et al. [25] showed that HIF-1α regulate the expression of miR-21 in response to hypoxia, via the binding sites 1 on miR-21 promoter in cardiomyocytes. [score:4]
3.9 ± 0.43; P < 0.01) (Fig.   2C and D), suggesting that the upregulation of miR-21 by hypoxia is mediated by HIF-1α. [score:4]
miR-21 has also been shown to be upregulated by IPostC in the myocardium, alleviating I/R -induced cardiomyocyte apoptosis through modulation of the PTEN/Akt signaling pathway [6]. [score:4]
To further explore the biological involvement of miR-21 in IPostC -mediated intestinal protection, miR-21 expression was blocked through the delivery of antagomir-21 or scramble antagomir into the intestines of rats 24 hours before IPostC. [score:3]
The roles of HIF-1α and miR-21 in response to hypoxia were examined in the intestinal epithelial cell line IEC-6 by assessing HIF-1α and miR-21 expression under normoxic (20% O [2]) and hypoxic (10% or 2% O [2]) conditions and during hypoxia/reoxygenation (H/R). [score:3]
PDCD4 and Fas-L are potential target genes of miR-21 as described in previous studies 10, 16. [score:3]
As a transcription factor, HIF-1α could activate the expression of numerous miRNAs under hypoxia [32], via the modulation of their transcription factors [33], include miR-21. [score:3]
Taken together, these results indicated that the protective effects of IPostC on I/R -induced intestinal injury may be mediated by the modulation of apoptosis by miR-21 and its target PDCD4. [score:3]
Figure 1IPostC attenuated intestinal I/R injury and affected expression of HIF-1α and miR-21. [score:3]
As an internal control, U6 was used for template normalization for miR-21 expression. [score:3]
However, studies have also shown that overexpression of miR-21 for longtime leads to fibrosis in the kidney [23]. [score:3]
The effect of hypoxia on miR-21 expression in IEC-6 cells was analyzed with qRT-PCR. [score:3]
In vivo miRNA knockdown using LNA -modified anti-miR Locked nucleic acid (LNA) -modified anti-miR-21 oligonucleotides (Exiqon) were diluted in saline (5 mg/mL) and administered into the tail vein (10 mg/kg) less than 1 hour before ischemia surgery. [score:2]
Additionally, IPostC -mediated regulation of miR-1 and miR-21 have been found to attenuate apoptosis in patients undergoing valvular heart surgery [12]. [score:2]
The cardioprotective effects of the HIF-1α/miR-21 axis were reported by Liu et al. [25], who showed that hypoxia induced miR-21 and HIF-1α, and knockdown of HIF-1α or miR-21 induced cardiomyocyte apoptosis. [score:2]
A recent prospective clinical study of patients undergoing valve replacement with or without IPostC analyzed apoptosis-related miRNAs and identified miR-21 as a differentially regulated miRNA, suggesting its involvement in the mechanism of IPostC [12]. [score:2]
However, Gao et al. [12] failed to show the involvement of PDCD4 in IPostC -induced cardioprotection, indicating that IPostC attenuated apoptosis by regulating miR-21 and the downstream effectors BCL2 and BAX without affecting PDCD4 levels. [score:2]
This modulation of miR-21 by hypoxia -induced HIF-1α was shown previously in human pancreatic cancer cells, where the regulation of miR-21 by HIF-1α decreased apoptosis and promoted cell survival [24], similar to the findings of the present study. [score:2]
Intestinal epithelial cell line IEC-6 was transfected with si-HIF-1α, anti-miR-21 or scrambled control. [score:1]
Future studies should be aimed at exploring the involvement of survival pathways such as PI3K/Akt and ERK1/2 in the effects of IPostC mediated by miR-21 in the intestine, as suggested in previous studies of the heart. [score:1]
miR-21 and HIF-1α was found to be an anti-apoptotic miRNA and factor. [score:1]
The results suggest that PDCD4 and Fas-L are involved in miR-21 mediated anti-apoptotic effects on intestinal epithelial cells. [score:1]
To determine the role of HIF-1α and miR-21 in intestinal I/R injury, a cell H/R mo del was applied. [score:1]
Notably, cell apoptosis was exacerbated after treatment with si-HIF-1α or anti-miR-21 (27.4 ± 1.9 vs 8.6 ± 1.1, 29.8 ± 2.1 vs 8.6 ± 1.1, respectively, P < 0.05; Fig.   2F). [score:1]
Figure 2HIF-1α and miR-21 were induced by hypoxia and play an anti-apoptosis role in intestinal epithelial cells. [score:1]
PDCD4 and Fas-L was involved in miR-21 mediated anti-apoptotic effects on intestinal epithelial cells. [score:1]
In the present study, we examined the involvement of HIF-1α and miR-21 in the progression of intestinal I/R in a rat mo del and explored the molecular mechanisms underlying the protective effects of IPostC after intestinal I/R. [score:1]
Vehicle control, oligo controls for anti-miR-21 (Exiqon) and pre-miR-21 (Ambion), and adenovirus control (Ad-GFP) were applied. [score:1]
However, little is known as to how the role of HIF-1α and miR-21 in IPostC protects against intestinal ischemia/reperfusion injury. [score:1]
Here, we used a rat mo del of intestinal I/R to study the involvement of miR-21 in IPostC and explored the underlying mechanisms. [score:1]
Determination of the injury score in HE-stained sections showed that IPostC significantly attenuated I/R -induced intestinal injury at 3 hours of reperfusion (2.6 ± 0.20 vs 3.7 ± 0.31; P < 0.01), and anti-miR-21 abolished these protective effects (3.8 ± 0.35 vs 2.6 ± 0.20; P < 0.01) (Fig.   4B and C). [score:1]
Rats were randomly divided into the following groups: (1) sham operation group, n = 6; (2) I/R group, n = 12; (3) IPostC + I/R group, n = 18; (4) anti-miR-21 + I/R group, n = 6; (5) anti-miR-21 + IPostC + I/R group, n = 6; (6) 2-methoxyestradiol (2ME) + IPostC + I/R group, n = 6; and (7) 2ME + anti-miR-21 + IPostC + I/R group, n = 6. In the sham operation group, the SMA was separated, but without occlusion. [score:1]
The protein expression levels of HIF-1α were measured with western blotting, and the expression of miR-21 was measured with real-time PCR. [score:1]
Locked nucleic acid (LNA) -modified anti-miR-21 oligonucleotides (Exiqon) were diluted in saline (5 mg/mL) and administered into the tail vein (10 mg/kg) less than 1 hour before ischemia surgery. [score:1]
Figure 3PDCD4 and Fas-L was involved in miR-21 mediated anti-apoptotic effects on intestinal epithelial cells. [score:1]
Hypoxia induced HIF-1α and miR-21 protected against apoptosis in intestinal epithelial cells. [score:1]
[1 to 20 of 69 sentences]
6
[+] score: 282
UA treatment significantly inhibited HG -induced miRNA-21 up-regulation after 12 h and up-regulated PTEN mRNA expression after 24 h, resulting in up-regulated PTEN protein expression and the inhibition of the Akt/mTOR pathway after 48 h. Treatment with LY294002 also induced miRNA-21 up-regulation and the down-regulation of PTEN expression after 12 h, and these changes were not significantly different compared with the HG group. [score:25]
Compared with mesangial cells cultured under normal glucose conditions, the cells exposed to HG showed up-regulated miRNA-21 expression, down-regulated PTEN protein and mRNA expression, up-regulated p85PI3K, pAkt, pmTOR, p62/SQSTMI, and collagen I expression and down-regulated LC3II expression. [score:20]
Ursolic acid inhibits the glucose -induced up-regulation of mesangial cell miRNA-21 expression, up-regulates PTEN expression, inhibits the activation of PI3K/Akt/mTOR signaling pathway, and enhances autophagy to reduce the accumulation of the extracellular matrix and ameliorate cell hypertrophy and proliferation. [score:15]
Through the inhibition of miRNA-21 expression, UA treatment up-regulated PTEN expression, inhibited PI3K/Akt/mTOR signaling, attenuated mesangial autophagy inhibition under diabetic conditions, reduced abnormal hypertrophy and mesangial cell proliferation, reduced type I collagen accumulation, and exerted a renal protective function (Fig. 8). [score:14]
In addition, UA up-regulated PTEN mRNA and protein expression through the inhibition of miRNA-21 up-regulation, thus inhibiting the abnormal activation of the Akt/mTOR pathway and attenuating mesangial cell injury induced through HG. [score:13]
The aim of the present study was to investigate whether UA inhibits the up-regulation of miRNA-21 expression in mesangial cells under high-glucose (HG) conditions, thus up -regulating the expression of the target gene PTEN to inhibit the activation of the PI3K/Akt/mTOR signaling pathway and induce autophagy, thereby decreasing the accumulation of the extracellular matrix and exerting a renal protective effect. [score:13]
5. Inhibition of HG -induced up-regulated miRNA-21 expression, down-regulated PTEN expression, and PI3K/AKT/mTOR signaling pathway activation through UA. [score:13]
Ursolic acid inhibited the HG -induced up-regulation of miRNA-21 mRNA expression, down-regulation of PTEN mRNA expression. [score:13]
0117400.g008 Fig 8 HG stimulates the up-regulation of miR21 expression, resulting in the down-regulation of PTEN expression and the activation of PI3K/Akt/mTOR. [score:11]
HG stimulates the up-regulation of miR21 expression, resulting in the down-regulation of PTEN expression and the activation of PI3K/Akt/mTOR. [score:11]
In summary, the results of the present study demonstrated that the up-regulation miRNA-21 expression, down-regulation of PTEN expression, and abnormal activation of the PI3K/Akt/mTOR signaling pathway occur in mesangial cells cultured under HG conditions, thereby decreasing autophagy and increasing the accumulation of type I collagen in mesangial cells, resulting in abnormal hypertrophy and cell proliferation. [score:11]
Dey et al. [33, 34] showed that HG and transforming growth factor (TGF)-β increase miRNA-21 expression, while miRNA-21 targets the 3'-untranslated region (UTR) of PTEN mRNA to inhibit PTEN protein expression. [score:11]
Ursolic acid down-regulated miRNA-21 expression and up-regulated PTEN protein and mRNA expression. [score:11]
Compared with the HG group, miRNA-21 expression was significantly down-regulated in the UA intervention group after 12 h, whereas PTEN mRNA expression was significantly up-regulated after 24 h (P<0.01). [score:10]
1. Compared with the normal glucose control group, miRNA-21 expression was significantly up-regulated, and PTEN mRNA expression was significantly down-regulated in mesangial cells cultured under HG conditions for 12 h (P<0.01). [score:10]
In contrast, the inhibition of endogenous miRNA-21 expression blocks HG -induced PTEN down-regulation and Akt phosphorylation. [score:8]
The results of the present study showed simultaneous miRNA-21 up-regulation and PTEN down-regulation in mesangial cells after 12 h of culture under HG conditions, thus activating the Akt/mTOR pathway. [score:7]
A previous study demonstrated that UA inhibits cell proliferation and induces apoptosis through the inhibition of miRNA-21 expression in the U251 glioblastoma cell line [17]. [score:7]
These results indicate that HG up-regulated miRNA-21 and PTEN expression to activate the PI3K/Akt/mTOR pathway. [score:6]
Ursolic acid attenuates HG -induced mesangial cell injury through the up-regulation of autophagy, at least in part, through the suppression of the miR21/PTEN/Akt/mTOR pathway. [score:6]
Current studies on diabetic processes indicate that miRNA-216, miRNA-217, and miRNA-21 target PTEN [6], and the miRNA-200 family targets friend of GATA (FOG)2 [32] to activate the Akt/mTOR signaling pathway, thereby mediating DN occurrence and development. [score:6]
Currently, it remains unknown whether UA exerts renal protection effects through the inhibition of miRNA-21 expression in mesangial cells. [score:5]
However, whether UA inhibits miRNA-21 expression in mesangial cells has not been reported. [score:5]
The over -expression of miRNA-21 decreases PTEN expression and simultaneously activates the Akt/mTOR signaling pathway, thereby inducing mesangial cell hypertrophy and mesangial matrix expansion. [score:5]
Next, we will perform further in vivo experiments, transfecting miRNA-21 over -expression plasmids and knockout plasmids to verify the mechanisms underlying the renal protective functions of UA. [score:4]
To investigate the effect of ursolic acid on autophagy mediated through the miRNA-21 -targeted phosphoinositide 3 kinase (PI3K)/protein kinase B (Akt)/mammalian target of rapamycin (mTOR) pathway in rat mesangial cells cultured under high glucose (HG) conditions. [score:3]
However, LY294002 did not affect the expression of miRNA-21 and PTEN. [score:3]
These results suggest that miRNA-21 participates in the occurrence of key pathological injuries in DN through a reduction in the level of the target protein PTEN and the activation of the Akt/mTOR pathway. [score:3]
0117400.g006 Fig 6 RT-qPCR analysis for miRNA-21 and PTEN mRNA expression in each group of cells cultured for 12, 24 and 48 h. #, P<0.01 vs. [score:3]
The miRNA-21 expression was detected using RT-qPCR. [score:3]
RT-qPCR analysis for miRNA-21 and PTEN mRNA expression in each group of cells cultured for 12, 24 and 48 h. #, P<0.01 vs. [score:3]
The expression of miRNA-21 and PTEN mRNA in the hypertonic group at different time points was not significantly different compared with the normal glucose control group. [score:2]
The expression of miRNA-21 and PTEN mRNA in the LY294002 group at different time points was not significantly different compared with the HG group (Fig. 6). [score:2]
[1 to 20 of 33 sentences]
7
[+] score: 270
The miR-21 expression in the ovaries was upregulated, while the mRNA expression and protein expression of PTEN and PDCD4 were downregulated. [score:13]
To conclude, we found that: (1) MSCs overexpressing miR-21 showed a reduction in apoptosis in vitro and an increase in vitality; (2) MSCs overexpressing miR-21 caused a downregulation of PTEN and PDCD4 in vitro, which inhibited the PM -induced apoptosis of GCs; and (3) transplantation of MSCs overexpressing miR-21 into rat ovaries damaged by chemotherapy could more effectively inhibit the apoptosis of GCs as compared with the injection of MSCs or miR-21 alone. [score:13]
GCs cocultured with miR-21-MSCs showed a decreased apoptosis, an upregulation of miR-21, and a downregulation of PTEN and PDCD4. [score:7]
Promoting cell proliferation and inhibiting apoptosis, miR-21 is highly expressed in a variety of cells and tissues [21]; it also plays a decisive role in the regulation of GC apoptosis and follicular development. [score:7]
The mRNA expression and protein expression of PTEN and PDCD4 were downregulated in the miR-21 group as compared with the MSC group and the LV group (Fig.   1e and f). [score:7]
Overexpression of miR-21 in MSCs promoted efficacy against chemotherapy -induced POF and its improvement of the repair effect was related to the inhibition of GC apoptosis by targeting PTEN and PDCD4. [score:7]
In our study, miR-21 inhibited apoptosis of GCs probably by downregulating PTEN and PDCD4. [score:6]
miR-21 can inhibit the hydrogen oxide -induced MSC apoptosis, probably because the downstream target gene PTEN regulates the PI3K/Akt pathway [23]. [score:6]
Effects of miR-21 overexpression on apoptosis of MSCs and expression of PTEN and PDCD4. [score:5]
One ovary was used to determine the weight, structure, follicle counts, and apoptosis of GCs; the other ovary was used to determine the expression of miR-21 as well as mRNA and protein expression of PTEN and PDCD4. [score:5]
In this study, the apoptosis of GCs was inhibited by injection of LV-miR-21 to bilateral ovaries to induce miR-21 expression. [score:5]
Thus, miR-21 overexpression inhibited the chemotherapy -induced apoptosis of MSCs. [score:5]
Expression of miR-21 and target genes PTEN and PDCD4 in the ovarian tissues. [score:5]
b miR-21 expression of GCs, and comparison of mRNA expression of PTEN and PDCD4. [score:5]
miR-21 overexpression in MSCs inhibited apoptosis of GCs. [score:5]
The mRNA expression of miR-21, PTEN, and PDCD4 was determined using; the protein expression was determined usingting. [score:5]
Expression of miR-21 and its target genes in GCs. [score:5]
In the apoptosis of MSCs induced by hypoxia/serum-free culture, upregulating miR-21 can increase the mitochondrial membrane potential and protect the mitochondrial function. [score:4]
Furthermore, PTEN and PDCD4 were downregulated in MSCs, probably due to the fact that miR-21 enhanced the vitality of MSCs. [score:4]
MSCs were transfected with miR-21 lentiviral vector (LV-miR-21) to obtain MSCs stably expressing miR-21 (miR-21-MSCs). [score:3]
The effect of MSCs over expressing miR-21 on VSELs remains unclear. [score:3]
Study shows that miR-21 can inhibit the apoptosis of rat GCs and increase the ovulation rate. [score:3]
Effects of miR-21 overexpression on the apoptosis of MSCs in the local microenvironment of ovaries damaged by chemotherapy. [score:3]
Fig. 2Apoptosis of GCs and expression of miR-21, PTEN, and PDCD4. [score:3]
indicated that miR-21 expression of the MSC group, the LV group, and the miR-21 group was 1.0154 ± 0.0258, 1.0191 ± 0.0500, and 4.2410 ± 0.4367, respectively. [score:3]
Expression of miR-21 (a) and PTEN (b) and PDCD4 (c) mRNA was detected using. [score:3]
We transplanted MSCs overexpressing miR-21 to treat chemotherapy -induced POF. [score:3]
All these results suggested the strong repair effect of transplanting MSCs with miR-21 overexpression. [score:3]
The ovarian structure and function were repaired to a greater extent by transplantation of MSCs overexpressing miR-21. [score:3]
We discuss the effect of miR-21 overexpression on the apoptosis of MSCs in the chemotherapy -induced ovarian microenvironment. [score:3]
The repair effect of MSCs overexpressing miR-21 in chemotherapy -induced POF and the repair mechanism are discussed. [score:3]
It is reported that miR-21 has about 190 target genes [22]. [score:3]
Fig. 7Comparison of miR-21 and mRNA expression of PTEN and PDCD4 in ovarian tissues between the groups. [score:3]
Effects of MSCs overexpressing miR-21 on the apoptosis of GCs. [score:3]
Sequencing the positive clones indicated that the rno-miR-21-5p sequence inserted into the recombinant plasmid was identical to the target sequence. [score:3]
This repair effect may be mediated by PTEN and PDCD4, the target genes of miR-21. [score:3]
Comparisons showed that miR-21 expression was higher in the normal group than in the mo del group and the MSC group, but it was not significantly different between the mo del group and the MSC group (Fig.   7). [score:3]
The expression in the miR-21 group and the miR-21-MSC group was lower than that of the mo del group and the MSC group, but higher than the normal group. [score:3]
Fig. 1Apoptosis of MSCs and expression of miR-21, PTEN, and PDCD4. [score:3]
The results showed that the apoptosis of miR-21 -overexpressing MSCs decreased and the vitality of the transplanted cells increased. [score:3]
miR-21 is also regulatory for the apoptosis of GCs and follicular development [12]. [score:3]
c Expression of miR-21 in MSCs transfected with LV-miR-21. [score:3]
The expression levels of miR-21, PTEN, and PDCD4 were assessed by real-time using a Mir-X miRNA SYBR Kit (TaKaRa, Japan) and an ABI 7500 real-time PCR system. [score:3]
This study discusses the repair effect and mechanism of MSCs overexpressing miR-21 on chemotherapy -induced POF. [score:3]
Intergroup comparisons using the SNK method indicated no statistical difference between the MSC group and the LV group; the expression of the miR-21 group was higher than that of the MSC group and the LV group (Fig.   1c). [score:3]
miR-21 Bone marrow derived mesenchymal stem cells Chemotherapy -induced premature ovarian failure Apoptosis PTEN PDCD4 Premature ovarian failure (POF) is a gynecological endocrine disease with a decrease in estrogen levels and gonadotropin, which manifests as irregular menstruation, amenorrhoea, infertility, and perimenopause syndrome affecting women before the age of 40 years. [score:3]
The miR-21 and mRNA and protein expression of PTEN and PDCD4 were determined. [score:3]
Further studies are required to show whether MSCs over expressing miR-21 can stimulate and protect VSELs. [score:3]
In this study, we found a reduction in the chemotherapy -induced apoptosis of MSCs overexpressing miR-21. [score:3]
As compared with the transplantation of normal MSCs or miR-21 injection alone, the number of rats with a normal estrous cycle increased following the transplantation of MSCs overexpressing miR-21; the E [2] level increased while the FSH level decreased significantly. [score:2]
miR-21 is a microRNA that can regulate cell apoptosis. [score:2]
Study shows that miR-21 is related to apoptotic regulation in many cells [9– 11]. [score:2]
Comparison among the latter four groups indicated a higher level in the miR-21-MSC group than in the mo del group, the miR-21 group, and the MSC group; however, there was no significant difference between the mo del group, the miR-21 group, and the MSC group. [score:1]
There was also an increase in follicle counts, indicating the partial repair effect of miR-21 on chemotherapy -induced POF. [score:1]
At 45 and 60 days after injection there were more follicles in the miR-21 group, the MSC group, and the miR-21-MSC group than in the mo del group (Fig.   3a–e). [score:1]
Thus, the miR-21 lentiviral vector was successfully constructed. [score:1]
Five groups were set up: the normal group, the PM group, the miR-21 group, the MSC group, and the miR-21-MSC group. [score:1]
Wen S Zhang Y Li Y Liu Z Lv H Li Z Characterization and effects of miR-21 expression in esophageal cancerGenet Mol Res. [score:1]
There was no significant difference between the mo del group and the MSC group or between the miR-21 group and the miR-21-MSC group (Fig.   8). [score:1]
The miR-21 gene is first transcribed into pri-miR-21 in the nuclei in the presence of RNA polymerase II, which is then modified to form the mature miR-21. [score:1]
On the day of the last CTX injection 1 × 10 [6] LV-miR-21 were injected into the bilateral ovaries in the miR-21 group; for the MSC group, 1 × 10 [6] MSCs were injected into the bilateral ovaries; for the miR-21-MSC group, 1 × 10 [6] miR-21-MSCs were injected under chloral hydrate anesthesia. [score:1]
The apoptotic rate of the miR-21 group was lower than that of the MSC group and the LV group (F = 38.597, P = 0.000; Fig.   1d). [score:1]
The miR-21-MSCs were cocultured with the GCs whose apoptosis was induced by a chemotherapeutic agent. [score:1]
There was no difference between the miR-21 group and the miR-21-MSC group. [score:1]
There were 6 rats in the miR-21 group, 6 rats in the MSC group, and 10 rats in the miR-21-MSC group which had a restored normal estrous cycle at 16–30 days after the last injection. [score:1]
The E [2] levels in the mo del group, the miR-21 group, the MSC group, and the miR-21-MSC group declined, while the FSH levels increased. [score:1]
MSCs were transfected with miR-21 lentiviral vectors at a MOI of 20. [score:1]
The ovarian weight increased more considerably in the miR-21-MSC group and exceeded that of the miR-21 group and the MSC group (Fig.   3f). [score:1]
The miR-21 level was determined using quantitative reverse-transcription PCR (qRT-PCR) in each group. [score:1]
Transplantation of miR-21-MSCs and post-transplantation observation. [score:1]
miR-21 is among the earliest discovered miRNAs and is present extensively in the human body. [score:1]
The apoptotic rate of the MSC group, the LV group, and the miR-21 group was 41.35 ± 3.63%, 40.34 ± 3.59%, and 23.49 ± 3.61%, respectively; the three groups were significantly different. [score:1]
miR-21 is among the earliest discovered miRNAs in mammals. [score:1]
According to the results of flow cytometry, the apoptotic rate of the normal group, the PM group, the miR-21 group, the MSC group, and the miR-21-MSC group was 10.4 ± 1.82%, 33.4 ± 4.22%, 27 ± 2.45%, 28 ± 2%, and 19.6 ± 1.52%, respectively; the apoptotic rate of the five groups differed significantly (F = 59.35, P = 0.00), and the apoptotic rate of the miR-21-MSC group was lower than that of the miR-21 group and the MSC group, but higher than that of the normal group (Fig.   2a). [score:1]
The ovaries were enlarged in the miR-21 group, the MSC group, and the miR-21-MSC group at 30, 45, and 60 days after injection, with more raised spots on the surface. [score:1]
The apoptotic rate was 11% ± 2.34% in the normal group, which was lower than that in the mo del group (38.8 ± 4.66%), the miR-21 group (37.2 ± 4.60%), the MSC group (34 ± 4.90%), and the miR-21-MSC group (27.2 ± 5.89%). [score:1]
Three groups were set up: the MSC group (no transfection with the lentiviral vectors), the LV group (transfection with the empty vectors), and the miR-21 group (transfection of MSCs with the miR-21 lentiviral vector at MOI of 20). [score:1]
Transfection of MSCs with LV-miR-21. [score:1]
The five groups were: the normal group, the mo del group, the miR-21 group, the MSC group, and the miR-21-MSC group. [score:1]
b MSCs transfected with LV-miR-21 at a MOI of 20, emitting green fluorescence under the fluorescence microscope (×100). [score:1]
Three groups were set up: the MSC group, the LV group, and the miR-21 group. [score:1]
At 15 days after injection the follicle counts of the normal group were much higher than those of the mo del group, the miR-21 group, the MSC group, and the miR-21-MSC group; there was no significant difference among the last four groups. [score:1]
Cells in the normal group were not treated with PM; cells in the PM group had 30 μmol/L PM added to induce apoptosis; for the miR-21 group, the apoptosis was induced by adding PM and then the cells were transfected with LV-miR-21; for the MSC group and miR-21-MSC group, the cells were treated with PM and were then respectively transfected with MSCs and miR-21-MSCs at a 1:1 proportion. [score:1]
In this study, we constructed the miR-21 lentiviral vector to transfect the MSCs; the resulting MSCs were denoted as miR-21-MSCs. [score:1]
Construction of miR-21 lentiviral vector and transfection of MSCs. [score:1]
After further purification, the rno-miR-21-5p fragment was obtained. [score:1]
This means miR-21 enhanced the resistance of MSCs to chemotherapy and increased the vitality of cells. [score:1]
At 30, 45, and 60 days after injection the ovarian weight increased in the MSC group and the miR-21-MSC group, and it was higher than that in the mo del group. [score:1]
The apoptosis decreased in MSCs transfected with miR-21. [score:1]
However, the follicle counts of the miR-21-MSC group were still lower than those of the blank control group (Fig.   4). [score:1]
Apoptosis was induced by adding PM into the culture medium for GCs, which were cocultured with miR-21-MSCs. [score:1]
At 15 days after injection the ovarian size shrank in the miR-21 group, the MSC group, and the miR-21-MSC group; the ovaries were pale white with fewer raised spots on the surface. [score:1]
Follicle counts of the miR-21-MSC group were higher than those of the miR-21 group and the MSC group. [score:1]
The miR-21-MSCs were transplanted to the ovaries of a rat mo del in vitro. [score:1]
miR-21-MSCs were transplanted into the bilateral ovary. [score:1]
The estrous cycle was normal in the normal group, whereas there was estrous cycle disturbance in the mo del group, the miR-21 group, the MSC group, and the miR-21-MSC group after the last injection. [score:1]
The E [2] levels of the miR-21 group, the MSC group, and the miR-21-MSC group were higher than that of the mo del group, while the FSH levels of the former groups were lower than that of the mo del group; there was no significant difference among the former three groups. [score:1]
The changes in the miR-21 group and the MSC group were milder, and there was no significant difference between these two groups. [score:1]
At 45 and 60 days the follicle counts of the mo del group further decreased, and those of the miR-21 group, the MSC group, and the miR-21-MSC group were all higher than that of the mo del group. [score:1]
GCs were washed with PBS twice and suspended in culture medium for 24 h. The miR-21 lentiviral vector was constructed. [score:1]
Construction of the miR-21 lentiviral vector (LV-miR-21). [score:1]
Polymerase chain reaction (PCR) was performed using DNA containing the rno-miR-21-5p sequence as the template. [score:1]
The lentiviral vectors carrying the miR-21 gene were added into the MSCs at a multiplicity of infection (MOI) of 20. [score:1]
At 30, 45, and 60 days after injection the apoptotic rate of GCs in the miR-21-MSC group further decreased, and it was much lower than that of the mo del group, the miR-21 group, and the MSC group, but still higher than that of the normal group (Fig.   6). [score:1]
However, few reports have been concerned with whether miR-21 enhances the repair effect of MSCs in chemotherapy -induced POF. [score:1]
No treatment was given in the MSC group; MSCs in the LV group and miR-21 group were transfected with empty LV and LV-miR-21, respectively, followed by the addition of 30 μmol/L PM to mimic the local microenvironment of ovaries damaged by chemotherapy. [score:1]
Following the injection of miR-21-MSCs, the ovarian weight and follicle counts increased; E [2] levels increased while FSH levels decreased, with less severe apoptosis of GCs. [score:1]
[1 to 20 of 107 sentences]
8
[+] score: 226
These data indicated that TBI leads to upregulation of miR-21 in the traumatic foci and its expression can be manipulated (upregulated or downregulated) by intracerebroventricular infusion of miR-21 agomir or antagomir. [score:12]
miR-21 increased Bcl-2 expression and inhibited Bax and Caspase-3 expressions in brain (Figure 4d–4e), suggesting that miR-21 suppresses cellular apoptosis through inhibiting the mitochondrial apoptosis pathway 23. [score:11]
The in-situ staining using control probe is shown in Supplementary Figure 3. The results indicated that the expression levels of miR-21 in these cells were all increased at 3 d post-injury, and were significantly upregulated (or downregulated) after infusing miR-21 agomir (or antagomir). [score:9]
Taken together, these data suggested that upregulation of miR-21 level in brain can promote angiogenesis after TBI, which was associated with its regulation on the expression of angiogenesis-related molecules. [score:7]
To decipher the role of miR-21 in TBI, we employed the fluid percussion injury (FPI) rat mo del and manipulated (upregulated or downregulated) miR-21 level in brain by intracerebroventricular infusion of miR-21 agomir or antagomir. [score:7]
Since MVECs-expressed miR-21 was significantly upregulated in brain after TBI (Figure 1b), we inferred that the impact of miR-21 on angiogenesis was primarily regulated by the MVECs. [score:7]
miR-21 inhibited apoptosis and promoted angiogenesis through regulating the expression of apoptosis- and angiogenesis-related molecules. [score:6]
Our recent studies on the expression levels of miRNAs in brain after TBI have identified increased expression of miR-21 in the cerebral cortex 14, suggesting that miR-21 may be involved in pathological development after TBI, especially in secondary brain damage. [score:6]
Taken together, these findings suggested that miR-21 can inhibit apoptosis and promote angiogenesis in brain after TBI through regulating the expression of apoptosis- and angiogenesis-related molecules. [score:6]
To explore the molecular mechanisms underlying the functions of miR-21 in TBI, we examined the putative target of miR-21, the PTEN/PI3K-Akt signaling pathway, at 3 d (when miR-21 inhibited apoptosis in brain) and 7d post-injury (when miR-21 promoted angiogenesis in brain). [score:5]
Furthermore, we found that miR-21 inhibited the expression of PTEN at the post-transcriptional level and activated Akt signaling in brain after TBI (Figure 6). [score:5]
Based on these findings, we hypothesized that miR-21 can attenuate cellular apoptosis and promote angiogenesis in brain, and it could exert these effects while inhibiting its target gene – PTEN and activating Akt signaling. [score:5]
Taken together, these data demonstrated that miR-21 inhibited the expression of PTEN at the post-transcriptional level and activated Akt signaling in brain after TBI. [score:5]
miR-21 promoted angiogenesis and regulated the expression of angiogenesis-related molecules in brain after TBI. [score:4]
The PTEN/PI3K-Akt signaling pathway has been shown to play critical roles in impacting apoptosis 32 and angiogenesis 22 by affecting the expression of downstream molecules including Bcl-2, Bax, Caspase-3 and VEGF, which are regulated by miR-21. [score:4]
To determine whether and how miR-21 regulates PTEN expression in brain after TBI, the mRNA and protein levels of PTEN were quantified. [score:4]
Upregulation of miR-21 level in brain improved the neurological outcome after TBI. [score:4]
This result indicated that TBI leads to cellular apoptosis in the cerebral cortex and ipsilateral hippocampus, and that upregulation of miR-21 in brain can alleviate cellular apoptosis in vulnerable cell population. [score:4]
We also noted that both PTEN and Bcl-2 33 are target genes for miR-21, and the Bcl-2 level was regulated (Figure 4d, 4e) with the activation of Akt signaling (Figure 6) in brain after TBI. [score:4]
These data suggested that the anti-apoptotic function of miR-21 after TBI was associated with its regulation on the expression of apoptosis-related molecules. [score:4]
Taken together, these results indicated that upregulation of miR-21 level in brain can improve the long-term neurological function, alleviate brain edema and decrease lesion volume. [score:4]
miR-21 attenuated cellular apoptosis and regulated the expression of apoptosis-related molecules in brain after TBI. [score:4]
We found that the upregulation of miR-21 level in brain is beneficial for improving the neurological function of TBI rats, as demonstrated by an improvement in long-term neurological function, alleviation of brain edema and a decrease in lesion volume (Figure 3). [score:4]
Thus, miR-21 upregulation was beneficial for improving neurological function after TBI. [score:4]
Nevertheless, this study expands previous understanding on the functions of miR-21, suggesting that it could be a potential therapeutic target for interventions after TBI. [score:3]
We detected the temporal profile of miR-21 level and MVECs – expressed miR-21 level in the traumatic foci and found that they were significantly increased (or decreased) after infusing miR-21 agomir (or antagomir) (Figure 1a, 1b). [score:3]
We found that MVECs-expressed miR-21 in the injury ctl group was increased at 6 h post-injury, reached the peak level at 3 d post-injury and then gradually declined to baseline at 14 d post-injury. [score:3]
Since the miR-21 level in brain was increased from 6 h to 7 d post-injury in the injury ctl group (Figure 1a), we believe that the elevation of miR-21 level is a protective response following TBI, and miR-21 could be a potential therapeutic target for interventions to improve the prognosis of TBI. [score:3]
Therefore, the anti-apoptotic and pro-angiogenic effects of miR-21 in brain may relate to the inhibition of PTEN and the activation of Akt signaling. [score:3]
Here we observed that miR-21 alleviated brain edema (Figure 1d) and promoted the expression of VEGF and the Ang-1/Tie-2 axis simultaneously after TBI (Figure 5f–5h). [score:3]
Meanwhile, miR-21 promoted the expression of downstream VEGF (Figure 5d–5h), which is a fate-determining factor of the angioblastic cell lineage and an upstream inducer of the angiogenic cascade 24. [score:3]
This time-point was chosen because miR-21 expression was most obviously increased at this time-point after TBI without the intervention. [score:3]
s Dataset 1 s Dataset 1 The temporal profile (from 0 h to 14 d post-injury) of miR-21 level (a) and microvascular endothelial cells (MVECs) – expressed miR-21 level (b) in the traumatic foci determined by. [score:3]
Altered miR-21 expression in the traumatic foci after TBI and intracerebroventricular infusion of miR-21 oligomers. [score:3]
Representative images of the immunostaining of in-situ miR-21 expressed by neurons, astrocytes and microglias in different areas of brain. [score:3]
The expression of miR-21 in the injury ctl group was increased at 6 h post-injury, reached the peak level at 3 d post-injury and then gradually declined to baseline at 14 d post-injury. [score:3]
We then detected the expression levels of Bcl-2, Bax and cleaved Caspase-3 in brain to clarify the impact of miR-21 on apoptosis after TBI. [score:3]
In addition, we quantified the in-situ expression of miR-21 in various cell types in the CNS including neurons, astrocytes and microglias. [score:3]
We found that the expression levels of miR-21 in the above cells were all manipulated by the intervention of miR-21 agomir or antagomir (Figure 1b–1e, Figure 2, Supplementary Figure 2). [score:3]
We detected miR-21 expression levels in the traumatic foci, which were defined as the impacted area with a diameter of 7 mm including injured cerebral cortex and ipsilateral hippocampus, at different time-points from 0 h to 14 d post-injury using (Figure 1a). [score:3]
These data demonstrated that intracerebroventricularly infused miR-21 agomir or antagomir can be taken up by different types of brain cells, so that regulate miR-21 level in these cells. [score:2]
The mechanism underlying the role of miR-21 in regulating BBB leakage could also be further studied to determine the application prospects of miR-21 in TBI. [score:2]
The role of Akt signaling under miR-21 regulation in the traumatic foci after TBI. [score:2]
Compared with the injury ctl group, the miR-21 expression level was significantly increased (or decreased) in the agomir (or antagomir) group at 6 h, 1 d and 3 d post-injury. [score:2]
The impact of regulating brain miR-21 level on the long-term neurological function, brain edema and histopathological outcomes of TBI rats. [score:2]
However, we could not ascertain from this data whether the observed results are due to miR-21 targeting PTEN or Bcl-2. To clarify the mechanism, in vitro experiments including luciferase reporter assay should be performed in the future. [score:2]
Taken together, these results suggested that intracerebroventricular infusion of miR-21 agomir or antagomir can effectively regulate the miR-21 level in the traumatic foci after TBI. [score:2]
The temporal profile of miR-21 level in the contralateral cerebral cortex after TBI is shown in supplementary Figure 1. To investigate the in-situ expression of miR-21 in microvascular endothelial cells (MVECs), we isolated MVECs from the traumatic foci and quantified the temporal profile of miR-21 level using (Figure 1b). [score:1]
Therefore, the impact of miR-21 on the cellular apoptosis after TBI at this time-point could potentially be remarkable. [score:1]
Regarding the impact of miR-21 on angiogenesis in brain after TBI, we demonstrated that miR-21 can increase the MVD in the LB and the DG (Figure 5a–5c). [score:1]
The temporal profile of miR-21 level in the contralateral cerebral cortex after TBI is shown in supplementary Figure 1. To investigate the in-situ expression of miR-21 in microvascular endothelial cells (MVECs), we isolated MVECs from the traumatic foci and quantified the temporal profile of miR-21 level using (Figure 1b). [score:1]
To further demonstrate the role of miR-21 in TBI, we are improving the transfection efficiency of miR-21 oligomers by drawing the time course of their uptake and degradation in CSF. [score:1]
The impact of miR-21 on cellular apoptosis in brain after TBI. [score:1]
To verify the above hypothesis, we studied the impact of miR-21 on apoptosis in brain after TBI. [score:1]
The impact of miR-21 on angiogenesis in brain after TBI. [score:1]
We found that miR-21 alleviated cellular apoptosis in the LB and the DG (Figure 4a–4c). [score:1]
The sections were then incubated with locked nucleic acid -modified miR-21-5p probe (sequences: 5′- TCAACATCAGTCTGATAAGCTA-3′, the locked nucleic acids were eight consecutive bases indicated by the underline) and covered with RNase-free coversclips overnight at 40°C in a slide warmer. [score:1]
In this test, biomarkers of neurons (MAP-2) 39, astrocytes (GFAP) 40 and microglias (Iba-1) 41 were respectively counterstained with miR-21 using the miRNA ISH kit (Boster, Wuhan, China). [score:1]
In conclusion, we found that miR-21 can improve the neurological outcome after TBI in rats. [score:1]
The combined staining of miR-21/GFAP (g) and miR-21/Iba-1 (h) in the dentate gyrus (DG). [score:1]
The combined staining of miR-21/MAP-2 (d) and miR-21/GFAP (e) in the CA1 (a subdivision of Ammon's horn). [score:1]
U6 served as the internal control for miR-21, and GAPDH was used as the internal control for PTEN. [score:1]
Specifically, for the quantification of miR-21, VEGF, Ang-1 and Tie-2 levels in the MVECs, the microvessels were isolated from the traumatic foci by centrifugation and filtration as previously reported 38. [score:1]
We first studied the impact of miR-21 on the neurological outcome after TBI. [score:1]
The quantitative data of a and b were analyzed using the 2 [−ΔΔCt] method, in which the miR-21 levels of the sham group (presented as the dotted line) were used as controls. [score:1]
Rats were randomly divided into 6 groups: miR-21-UPTM agomir (agomir), agomir negative control (agomir ctl), miR-21-DownTM antagomir (antagomir), antagomir negative control (antagomir ctl), injury control (injury ctl) and sham group. [score:1]
We inferred that the therapeutic effect of miR-21 on alleviating brain edema may correlate with its anti-apoptotic effect that contributes to maintaining the integrity of BBB, in addition to its impacts on vascular maturation and BBB stabilization. [score:1]
The combined staining of miR-21/MAP-2 (a), miR-21/GFAP (b), miR-21/Iba-1 (c) lesioned boundary (LB, scope see Figure 3e) of cerebral cortex. [score:1]
Furthermore, the Spearman's rank correlation coefficient test showed significant correlations between (1) miR-21 level and protein level of PTEN (r = −0.947, P = 0.015) and (2) miR-21 level and protein level of p-AKT (r = 0.963 P = 0.009) in the traumatic foci after TBI. [score:1]
The combined staining of miR-21/GFAP (f) in the CA3 (a subdivision of Ammon's horn). [score:1]
We expected that miR-21 oligomers would be taken up by the CNS through the cerebrospinal fluid (CSF)-contacting neural system and by MVECs through the CSF-blood substance transport. [score:1]
In addition, we measured the in-situ expression of miR-21 in various cells of the central nervous system (CNS) including neurons, astrocytes and microglias at 72 h post-injury using combined miRNA in-situ hybridization (ISH) and immunofluorescence (IF) staining (Figure 1c–1e, Figure 2, Supplementary Figure 2). [score:1]
The quantitative data of miR-21 immunopositive neurons (c), astrocytes (d) and microglias (e) at 3 d post-injury detected by combined miRNA in-situ hybridization and immunofluorescence staining. [score:1]
Akt signaling was activated by miR-21 after TBI. [score:1]
Altered miR-21 level in the traumatic foci after TBI and intervention with miR-21 oligomers. [score:1]
Consequently, miR-21 behaves as an inducer of angiogenic factors that promote angiogenesis in brain after TBI. [score:1]
[1 to 20 of 76 sentences]
9
[+] score: 215
Other miRNAs from this paper: rno-mir-34a
Additionally, PDCD4 expression profiles displayed an opposite pattern to miR-21 expression levels, further confirming the relevance of this pro-apoptotic target during DCA -dependent modulation of miR-21 via NF-κB (Fig. 5B bottom). [score:7]
In vivo results have shown that miR-21 expression is down-regulated upon short exposures to DCA, as is the downstream pathway, with concomitant PIDD processing and activation of caspase-2, which contributes to DCA -induced liver damage 55. [score:6]
Oxidative stress by DCA, upstream of NF-κB inhibition, downregulates miR-21 and activates caspase-2 and apoptosis. [score:6]
As previously, no significant changes were observed in PTEN protein levels following miR-21 overexpression (unpublished observations), further substantiating PDCD4 as a prime target modulated by DCA via miR-21 in primary rat hepatocytes. [score:5]
We have recently shown that ursodeoxycholic acid (UDCA), a cytoprotective and anti-apoptotic bile acid, shifts the liver miRNA expression pattern in vivo towards a proliferative environment, inducing miR-21 expression both during liver regeneration and in cultured HepG2 cells. [score:5]
DCA inhibits miR-21 expression in primary rat hepatocytes in a dose -dependent manner. [score:5]
We recently showed that miR-34a is increased by DCA in a JNK -dependent manner, contributing to liver damage 11, while miR-21 expression is inhibited in primary rat hepatocytes 25. [score:5]
To further explore to the extent to which NF-κB modulation impacts on DCA -inhibition of the miR-21/PDCD4 pathway, we additionally used a specific chemical inhibitor of NF-κB (BAY 11-7085) 38. [score:5]
To ascertain miR-21 -dependent modulation of PDCD4 by DCA, a reporter plasmid driven by the SV40 basal promoter, harbouring either a wild-type (Luc-PDCD4 Wt 3′ untranslated region (UTR)) or a mutated (Luc-PDCD4 Mut 3′ UTR) miR-21 target sequence within the 3′ UTR of PDCD4, upstream of the Firefly luciferase gene, was used 32. [score:5]
Curiously, miR-21 has been described to counteract NF-κB in a negative regulatory loop; during liver regeneration, up-regulation of miR-21 results in decreased Pellino-1 levels, a well-known activator of NF-κB 46. [score:5]
In Pre-miR-Control -transfected cells, DCA inhibited miR-21 expression by 60% (p < 0.01). [score:5]
Altogether, DCA -induced apoptosis is inversely correlated with miR-21 expression and positively correlated with PDCD4 expression pattern, suggesting that DCA -induced apoptosis occurs, at least in part, via miR-21/PDCD4. [score:5]
Altogether, these results indicate that DCA -induced oxidative stress is at least partially responsible for inhibition of NF-κB in a PIDD -dependent manner, thus establishing a novel link between genotoxic stress, miR-21 inhibition and cellular toxicity. [score:5]
On the other hand, DCA significantly inhibits miR-21 expression in primary rat hepatocytes 25. [score:5]
Cells were incubated with 100 μM DCA or no addition (control) for 4, 16, 24, 40 and 48 h. DCA inhibited miR-21 expression throughout time, starting at 16h of incubation (p < 0.05). [score:5]
Further, miR-21 was recently described as a direct transcriptional target of NF-κB 26, in response to genotoxic stress 27. [score:4]
In addition, both CA-IKK and NF-κB overexpression induced miR-21 expression by 40 and 80%, respectively, when compared with controls (p < 0.05). [score:4]
DCA inhibits the miR-21/PDCD4 pathway in primary rat hepatocytes in a time- and dose -dependent manner. [score:3]
Our results show that inhibition of miR-21 by DCA results in hepatocyte cell death by apoptosis, in part, as a result of increased PDCD4 levels. [score:3]
Overall, our results suggest that PIDDosome activation and consequent inhibition of the NF-κB/miR-21/PDCD4 pathway by DCA occurs both in vitro and in vivo, providing new mechanistic insights into its role as a putative pathogenic factor for hepatic disorders. [score:3]
In the normal adult liver, quiescent hepatocytes express high levels of miR-21 45. [score:3]
Altogether, these results indicate that the miR-21/PDCD4 pro-apopotic pathway is induced by DCA via inhibition of NF-κB activity in primary rat hepatocytes. [score:3]
Curiously, rats administered with DCA for 5 days displayed slightly increased miR-21 expression levels, although positive modulation of PDCD4 was still observed (data not shown), suggesting that sustained DCA administration engages activation of additional pathways of cell death. [score:3]
miR-21 overexpression alone reduced PDCD4 levels by almost 40% (p < 0.01) (Fig. 2B). [score:3]
DCA inhibits the NF-κB/miR-21/PDCD4 axis in vivo. [score:3]
How to cite this article: Rodrigues, P. et al. Inhibition of NF-κB by deoxycholic acid induces miR-21/PDCD4 -dependent hepatocellular apoptosis. [score:3]
Because DCA hampers NF-κB transcriptional activity in a similar pattern to miR-21, these results suggest that DCA -mediated inhibition of miR-21 may constitute an NF-κB downstream event. [score:3]
In line with the miR-21 inhibitory pattern, concentrations of DCA > 50 μM significantly decreased cell viability between 30 to 50% (at least p < 0.05) (Fig. 1C top). [score:3]
Surprisingly, although miR-21 overexpression alone significantly increased cell viability by ~20% (p < 0.05) (Fig. 2C top), effects on cytotoxicity (Fig. 2C middle) and caspase-3 activity (Fig. 2C bottom) were almost absent. [score:3]
Nevertheless, miR-21 overexpression almost completely abrogated DCA -mediated reduction in cellular viability; increase in cytotoxicity; and caspase-3 activation. [score:3]
On the contrary, inhibition of NF-κB by DN-IκB or BAY 11-7085 potentiated the effects of DCA upon miR-21 and apoptosis. [score:3]
Primary rat hepatocytes were transfected with a miR-21 precursor (Pre-miR-21) or control (Pre-miR-C) and treated with 100 μM DCA or no addition for 24 h. (A) analysis of miR-21 expression (n = 7). [score:3]
Still, miR-21 and PDCD4 constitute two novel targets modulated by DCA during hepatocyte cell death. [score:3]
As a result, miR-21 expression is decreased, thus allowing PDCD4 levels to rise and facilitate apoptosis. [score:3]
Altogether, both miR-21 overexpression and PDCD4 silencing failed to completely abrogate DCA -induced cytotoxicity. [score:3]
Hepatic miR-21 expression was reduced by  >25% (p < 0.05) and ~10% in animals administered with DCA for 1 and 3 days, respectively (Fig. 8A). [score:3]
DCA -induced oxidative stress contributes for miR-21 inhibition and apoptosis. [score:3]
Hence, oxidative stress appears to be a major triggering factor leading to NF-κB and miR-21 inhibition by DCA. [score:3]
In fact, when either CA-IKK or NF-κB was overexpressed, DCA-modulation of the miR-21/PDCD4 pathway was significantly hampered, resulting in lower levels of apoptosis. [score:3]
mir-21 overexpression counteracts DCA -induced apoptosis. [score:3]
As such, DCA-induction of oxidative stress might interfere with the PIDD and caspase-2 networking, thus possibly inhibiting NF-κB and, consequently, miR-21. [score:3]
DCA also counteracted miR-21 overexpression in Pre-miR-21 -transfected cells, although to a lesser extent. [score:3]
was performed in an Applied Biosystems 7300 system (Life Technologies) to quantitate the expression of miR-21. [score:3]
Inhibition of the miR-21/PDCD4 apoptotic pathway by DCA is NF-κB dependent. [score:3]
Our results show that primary rat hepatocytes incubated with 50 to 200 μM DCA for 24h decreased miR-21 expression between 20 to ~50% (at least p < 0.05) (Fig. 1A), comparing with controls. [score:3]
In our mo del, NAC greatly reduced DCA -induced hepatocyte cell death, while DCA -dependent inhibition of miR-21 was abolished. [score:3]
Still, the relevance of DCA -mediated inhibition of miR-21 during hepatocellular injury, as well as the underlying mechanistic signalling events remains unknown. [score:3]
In this work, key concepts regarding the cytotoxic mechanisms induced by DCA were unravelled; in particular, we showed that DCA induces apoptosis in primary rat hepatocytes by targeting NF-κB/miR-21. [score:3]
The miR-21/PDCD4 pathway is inhibited in the rat liver in vivo by DCA. [score:3]
Importantly, DCA -inhibition of miR-21 was also completely abrogated by NAC (Fig. 6D), highlighting the role of oxidative stress during modulation of miR-21 by DCA. [score:3]
As expected, miR-21 was significantly overexpressed in cells transfected with Pre-miR-21 (p < 0.001), when compared to cells transfected with Pre-miR-Control (Fig. 2A). [score:2]
The miR-21 gene promoter harbours a NF-κB -binding site and several studies have reported that miR-21 is transcriptionally regulated by NF-κB 27 49. [score:2]
Modulation of the miR-21/PDCD4 axis by DCA was also found to be time -dependent, with PDCD4 levels peaking after 24–40 h of incubation, in agreement with the kinetics of miRNA -mediated regulation 44. [score:2]
To evaluate whether DCA modulates PDCD4 expression via miR-21, cells were co -transfected with a luciferase reporter construct containing the wild-type miR-21 binding site within the PDCD4 3′UTR (Luc-PDCD4 Wt 3′UTR) or a mutated miR-21 binding site (Luc-PDCD4 Mut 3′UTR) 32. [score:1]
Taken together, our results show that the NF-κB/miR-21 pathway plays a key role during DCA -induced cell death of primary rat hepatocytes and in the rat liver. [score:1]
Cells were co -transfected with a reporter vector consisting of a luciferase cDNA fused to the 3′ UTR of PDCD4, containing either a Wt or Mut miR-21 binding site. [score:1]
Consequently, we next investigated whether activation of the miR-21/PDCD4 pro-apoptotic pathway by DCA was dependent on NF-κB expression and/or activity. [score:1]
The time- and dose -dependent effects of DCA on the NF-κB/miR-21/PDCD4 axis are further consistent with our previous data showing that modulation of miR-34a by DCA is attenuated beyond 52 h of incubation, after which cell death becomes predominantly necrotic 11. [score:1]
In agreement with the previous results, PDCD4 luciferase activity increased up to 2-fold in cells incubated with >50 μM DCA (at least p < 0.05) (Fig. 1B bottom), suggesting that PDCD4 is modulated by DCA via miR-21. [score:1]
These results further confirm that the miR-21/PDCD4 pathway mediates DCA -induced apoptosis. [score:1]
In addition, modulation of the miR-21/PDCA pathway by DCA was also augmented in the presence of BAY 11-7085 (Fig. 5E). [score:1]
Altogether, our results unravelled NF-κB as a key upstream modulator of the miR-21/PDCD4 pathway. [score:1]
Altogether, the increased levels of DCA in NASH patients likely contribute to sequential oxidative stress, p53 transcription, PIDD processing and caspase-2 activation, culminating, at least in part, in NF-κB/miR-21/PDCD4-depdendent cell death and toxicity. [score:1]
The relative amount of miR-21 was determined by the threshold cycle (2−ΔΔ CT) method, where ΔΔC [T] = (C [TmiR-21] − C [TU6]) sample−(C [TmiR-21] − C [TU6]) calibrator. [score:1]
Of note, concentrations of DCA above 200 μM are less capable of modulating miR-21/PDCD4 and mostly induced necrosis (unpublished observations). [score:1]
We next evaluated whether inhibition of miR-21 by DCA correlated with an increase in PTEN and/or PDCD4 protein levels. [score:1]
In parallel, hepatic total NF-κB protein levels were reduced in DCA -treated animals, while IκB levels increased, leading to a progressive and significant decrease in the NF-κB/IκB ratio throughout time, further reinforcing the role of this transcription factor in modulating the miR-21/PDCD4 pathway. [score:1]
The miR-21/PDCD4 pathway is inhibited in the rat liver in vivo by DCATo validate our in vitro results and further investigate the physiological relevance of the modulation of the miR-21/PDCD4 pathway by DCA, rats were administered with DCA by oral gavage for 1 to 3 days. [score:1]
Hepatocytes were isolated and plated as described in Materials and and treated with 25 to 200 μM DCA or no addition (control) for 24 h. (A) analysis of miR-21 (n = 7). [score:1]
Modulation of the NF-κB pathway halts DCA-modulation of miR-21/PDCD4 and cell viability. [score:1]
In addition, modulation of miR-21/PDCD4 by DCA was dependent on this transcriptional repression. [score:1]
Modulation of the NF-κB/miR-21/PDCD4 pathway by DCA was dose -dependent, for concentrations of DCA above 50 μM. [score:1]
We first evaluated whether inhibition of miR-21 by DCA occurs in a dose -dependent manner. [score:1]
miR-21 and PDCD4 functional modulation. [score:1]
DCA induces apoptosis of primary rat hepatocytes by engaging the miR-21/PDCD4 pathway. [score:1]
For functional analyses, primary rat hepatocytes were transfected at the moment of plating with 100 pM of a specific miR-21 precursor (pre-miR-21; AM17100) (Ambion, Life Technologies) or with a pre-miR negative control (pre-miR-C; AM17110), using Lipofectamine 2000™. [score:1]
[1 to 20 of 76 sentences]
10
[+] score: 198
Other miRNAs from this paper: rno-mir-96, rno-mir-152, rno-mir-193a, rno-mir-210, rno-mir-193b
SMAD7 expression is suppressed when delivery of miR-21-5P inhibitor in hypoxia in vitro and in vivo. [score:7]
In HUVEC cultured at normoxia condition, miR-21 expression suppressed protein expression of SMAD7 (Figure 4C,D). [score:7]
This evidence might suggest that inhibition of miR-21-5p in hypoxia condition enhances angiogenesis via down-regulation of SMAD7. [score:6]
In other cell types, miR-21 expression contributes to the up-regulation of HIF1α and enhances angiogenesis in human umbilical cord blood-derived mesenchymal stem cells and kidney cells [39, 40]. [score:6]
Jiang F. S. Tian S. S. Lu J. J. Ding X. H. Qian C. D. Ding B. Ding Z. S. Jin B. Cardamonin regulates mir-21 expression and suppresses angiogenesis induced by vascular endothelial growth factorBiomed Res. [score:6]
Part C was not collected because of necrosis and shrink at day 7. In the miR-21-5p inhibitor treated rat skin, the expression of SMAD7 was suppressed in Part B which was a relatively ischemic region when compared to that in Part A (Figure 5F). [score:6]
Inhibition of miR-21-5p enhances angiogenesis and is correlated with down-regulation of SMAD7 in ischemic rat skin. [score:6]
The ΔΔ C [t] method was used for calculating the relative miR-21-5p expression and the relative expression of each control group was always set to 1. Before tube formation analysis, HUVEC cells were transfected with 100 nM of miR-21-5P mimic, miR-21-5P inhibitor, or control miR (Dharmacon, Lafayette, CO, USA) by DharmaFECT Transfection Reagent 4 (Dharmacon) in complete growth medium, and then were incubated for 24 h in normoxia (5% CO [2], 20% O [2], at 37 °C) and hypoxia (5% CO [2], 95% N [2], 1% O [2], at 37 °C). [score:5]
An emerging study indicates that treatment of metformin (an anti-diabetic drug) reduces miR-21 expression, increase SMAD7 expression, and then abolished cells proliferation, migration, tube formation in HUVEC [27]. [score:5]
In contrast, expression of miR-21 was reversely correlated with SMAD7 protein expression in hypoxia (Figure 4E,F). [score:5]
Ischemia preconditioning procedure with the miR-21-5p mimic and mimic control, or miR-21-5p inhibitor and inhibitor control, were administered half an hour before surgery with a dose of 33 ng/µL and total 1 mL divided into four parts, respectively, were injected subdermal within Part B (the image was shown in Figure 1E,F). [score:5]
To investigate the putative miR-21 targets, four online microRNA target databases including TargetScan (http://www. [score:5]
Additionally, our data revealed that the protein expression of SMAD7 is regulated by miR-21 in normoxia and hypoxia. [score:4]
According to the previous studies, the other direct targets of miR-21, such as PTEN, AKT, and ERK, have been reported, these molecules involve in pro-angiogenesis phenotypes [27, 41]. [score:4]
To explore the putative mechanism for the involvement of miR-21 in the hypoxia induction of HUVECs tube formation, we focus on the identification of target genes potentially regulated by miR-21. [score:4]
Luo M. Tan X. Mu L. Luo Y. Li R. Deng X. Chen N. Ren M. Li Y. Wang L. MiRNA-21 mediates the antiangiogenic activity of metformin through targeting PTEN and SMAD7 expression and PI3K/AKT pathwaySci. [score:4]
These results suggested that down-regulation of miR-21-5p could enhance the angiogenesis in skin flaps. [score:4]
Wang J. Y. Gao Y. B. Zhang N. Zou D. W. Wang P. Zhu Z. Y. Li J. Y. Zhou S. N. Wang S. C. Wang Y. Y. Mir-21 overexpression enhances TGF-β1 -induced epithelial-to-mesenchymal transition by target SMAD7 and aggravates renal damage in diabetic nephropathyMol. [score:4]
Our present results show that miR-21 directly targets the 3′-UTR of SMAD7. [score:4]
SMAD7 is reported as a target of miR-21 in other studies [26, 27, 28, 29]. [score:3]
This suggests that miR-21 suppresses angiogenesis in human endothelial cell and rat skin flap in the hypoxia. [score:3]
When HUVEC was transfected with hsa-miR-21-5p mimic, the tube formation capacity was enhanced in normoxia condition and was suppressed in hypoxia (Figure 3C,D). [score:3]
Interestingly, opposite effect of hsa-miR-21-5p inhibitor was observed in hypoxia (Figure 3B). [score:3]
In addition, our data implies that inhibition of miR-21 is a novel therapeutic strategy in flap surgeries although the detail mechanism is currently unclear. [score:3]
The angiogenesis -inhibitory effect of miR-21 is also unclear in other cell types. [score:3]
To further investigate the function of miR-21-5p in endothelial cells, the human umbilical vein endothelial cell, HUVEC, was cultured in normoxia (20% oxygen) or hypoxia (1% oxygen) condition for 24 h. Since the expression level of miR-21 was slightly suppressed at 2 h reperfusion after ischemia in the rat flap [9], we hypothesized that the miR-21 level was changed in a short period of time under hypoxia and sequential normoxic exposure. [score:3]
Furthermore, re-exposure to normoxia significantly decreased hypoxia -induced miR-21 expression in a time -dependent manner. [score:3]
org/) [25], the predicted results suggested that SMAD7 are potential targets of miR-21. [score:3]
Overexpression of miR-21 enhances vascular endothelial growth factor -induced tube formation capacity in HUVEC [21]. [score:3]
Guduric-Fuchs J. O’Connor A. Cullen A. Harwood L. Medina R. J. O’Neill C. L. Stitt A. W. Curtis T. M. Simpson D. A. Deep sequencing reveals predominant expression of mir-21 amongst the small non-coding RNAs in retinal microvascular endothelial cellsJ. [score:3]
These evidences suggest that miR-21 induction results in decreasing SMAD7 expression and enhancing angiogenesis. [score:3]
In Figure 2, the expression of miR-21 in hypoxia-cultured HUVEC was significantly higher than that in normoxia-cultured HUVEC. [score:3]
Since the expression of miR-21 is correlated with surgical flap [9], we examined whether miR-21 involved in angiogenesis in rat skin flap which is a hypoxic environment. [score:3]
The miR-21 mimic and miR-21 inhibitor were injected half an hour before surgery via in vivo-jetPEI reagent (Cat. [score:3]
Furthermore, inhibition of miR-21 increased blood flow in skin flap. [score:3]
The predicted miR-21 targeting site on SMAD7 was shown in Figure 4A. [score:3]
Previous studies showed that expression of four miRNAs, including miR-96, miR-193-3p, miR-210, and miR-21, were correlated with the skin flap mo del in rat [9]. [score:3]
In Figure 3A, transfection of hsa-miR-21-5p inhibitor significantly decreased tube formation capacity in normoxia condition. [score:3]
These results indicated that the expression of miR-21 was induced by hypoxia in HUVEC. [score:3]
However, miR-21-5p inhibitor significantly increased the skin blood flow of Part B and Part C at day 7 post-operation (Figure 5C,D). [score:3]
It might imply that the regulatory mechanism between HIF1α and miR-21-5p in endothelial cells is different from other cell types. [score:2]
The reporter assay demonstrated that overexpression of miR-21 could bind to the 3′-UTR of SAMD7 (Figure 4B). [score:2]
Jin C. Zhao Y. Yu L. Xu S. Fu G. MicroRNA-21 mediates the rapamycin -induced suppression of endothelial proliferation and migrationFEBS Lett. [score:2]
In several types of cancer, miR-21 involves in regulation of angiogenesis [17, 18, 19]. [score:2]
In addition, transforming growth factor-β is also an important factor to regulate miR-21/SMAD7 signaling pathways in other types of cells [26, 42]. [score:2]
Several studies have been demonstrated that miR-21 is involved with the regulation of ischemia or ischemia-reperfusion injury in various tissues and associated processes such as angiogenesis and cell survival [12, 13, 14]. [score:2]
It might imply that the miR-21/SMAD7 involves in different regulatory mechanism when cells were cultured at normoxia and hypoxia. [score:2]
McClelland A. D. Herman-E delstein M. Komers R. Jha J. C. Winbanks C. E. Hagiwara S. Gregorevic P. Kantharidis P. Cooper M. E. Mir-21 promotes renal fibrosis in diabetic nephropathy by targeting PTEN and SMAD7Clin. [score:2]
Our results showed that the miR-21 play different roles in angiogenesis under normoxia and hypoxia and SMAD7 might be an important regulator. [score:2]
Seven days after miRNAs injection, there was no effect of miR-21-5p mimic in both Part B and Part C in skin flap (Figure 5A,B). [score:1]
In the present study, the function of miR-21 is related to anti-angiogenesis in hypoxia. [score:1]
For luciferase assay, 50 nm of control miRNA or miR-21-5p mimics, 0.8 µg of pMirTarget vector containing SMAD7 3′ UTR, and 0.08 µg of pRL renilla luciferase control reporter vector (Promega, Madison, WI, USA) were co -transfected into HEK-293 cells in 96-well plates for 48 h. Cell were harvested and analyzed using the dual-luciferase reporter assay (Promega) according to the manufacturer’s instruction. [score:1]
Our study showed the miR-21-5p play an anti-angiogenesis role in hypoxia condition in vitro and in vivo. [score:1]
In addition, miR-21 involves in hypoxia -induced pulmonary vascular remo deling and angiogenesis in renal tissue [15, 16]. [score:1]
Zhao J. Zhang Y. Zhao G. Emerging role of microRNA-21 in colorectal cancerCancer Biomark. [score:1]
In Figure 1G, the results of laser Doppler velocimetry showed that relatively low blood flow in Part C. Positive correlation between ischemia-reperfusion injury in the skin flap of rat and four miRNAs (miR-21, miR-96, miR-193, and miR-210) has been demonstrated in previous studies [9]. [score:1]
In other pathophysiological condition related to ischemia injury/reperfusion injury, miR-21 is related to protective effect (such as increasing angiogenesis and reducing apoptosis), and damaging effect (such as induction of fibrosis and inflammation) [2]. [score:1]
This might suggest miR-21 is pro-angiogenic in endothelial cells. [score:1]
It suggested that the function of hsa-miR-21-5p on tube formation capacity was opposite in normoxia and hypoxia condition. [score:1]
Petrovic N. Mir-21 might be involved in breast cancer promotion and invasion rather than in initial events of breast cancer developmentMol. [score:1]
The plasmid containing the putative binding sequence of miR-21-5p “ATAAGCTA” is named as “SMAD7 3′UTR”. [score:1]
Although the effect of miR-21-5p on cell migration and proliferation was not evaluated in the present study, our data might imply that miR-21-5p inhibitory effect on angiogenesis in hypoxia condition. [score:1]
Our results are similar with these studies in normoxia, but the opposite effect of miR-21 is observed in hypoxia. [score:1]
Moreover, miR-21 was reported to play a pro-angiogenic role in retinal microvascular endothelial cells in previous studies [20]. [score:1]
Furthermore, miR-21 not only enhances tube formation capacity, but also cell proliferation and migration in endothelial cells [20, 30]. [score:1]
In the present study, miR-21 results in deceasing tube formation capacity in HUVEC in hypoxia and leads to anti-angiogenesis in the rat flap. [score:1]
The pro-angiogenic role of miR-21 was demonstrated in some reports [20, 21]. [score:1]
To investigate the effect of miR-21-5p inhibitor in vivo, the Part A and Part B of rat skin was collected at day 7 post flap surgery (Figure 5E). [score:1]
Yang S. Banerjee S. Freitas A. Cui H. Xie N. Abraham E. Liu G. Mir-21 regulates chronic hypoxia -induced pulmonary vascular remo delingAm. [score:1]
[1 to 20 of 69 sentences]
11
[+] score: 186
We have 1) Determined the miRNA profile of perinatal pancreas, which is undergoing large structural and metabolic changes in the period around birth and identified and validated 7 miRNAs regulated more than 1.5-fold from E20 to P2; 2) Localized regulated miRNAs by ISH; 3) Performed focused pathway analysis of pathways affected by regulated miRNAs using predicted mRNA target genes also regulated in perinatal pancreas; 4) Shown that biochemical pathways relating to sterol and lipid biosynthesis and metabolism are affected by the perinatally regulated miRNAs; 5) Validated Srebf1 as target gene of miR-21 and shown an effect of miR-21 and miR-29a on INS-1E beta-cell cholesterol levels. [score:10]
Specifically the up-regulated miR-21 mediated down-regulation of Srebf1. [score:7]
It is possible that up-regulation of miR-21 and/or miR-29a in perinatal rat pancreas act through down-regulation of Srebf1 and other genes in the cholesterol synthesis pathway to fine-tune cholesterol levels and promote functional maturation of beta-cells following birth. [score:7]
In order to validate the reporter assay a perfect miR-21 complementary target site sequence clone (A-construct) and a scrambled miR-21 target site sequence clone (B-construct) were transfected into INS-1E cells, which express mature miR-21 (Fig. 2). [score:6]
Although both mRNA and protein levels of SREBP1 decreased sharply following miR-21 up-regulation at P0 (Fig. 5C, D), protein levels rose again at P2, where miR-21 continues to be expressed. [score:6]
ISH was used to assess miR-21 expression in human pancreatic adenocarcinoma, where miR-21 expression was found in malignant tissue but not in normal acinar tissue. [score:5]
In summary, out of the three tested targets, Srebf1 was conclusively found to be a functional target of miR-21. [score:5]
Inhibiting miR-21 increased luciferase activity of the Srebf1 target vector (Fig. 6D ‘C+LNA-21’ vs. [score:5]
To identify whether Srebf1 could be a true target mRNA of miR-21 we introduced miR-21inhibitor (LNA-21) and control oligonucleotides (LNA-scr) into INS-1E cells, and extracted RNA and protein from these. [score:5]
E. Total cholesterol levels of INS-1E cells following knock-down of miR-21 and/or miR-29a in INS-1E cells (LNA-21: Knock-down of miR-21, LNA-29a: Knock-down of miR-29a, LNA-scr: Scrambled control LNA, Untransf: Untransfected). [score:4]
Pathways involving metabolic processes, terpenoid and sterol metabolism were selectively affected by concomitant regulation by miRNAs and mRNAs, and Srebf1 was validated as a target of miR-21. [score:4]
SREBF1, which is a key transcriptional regulator for genes involved in the early (isoprenoid biosynthesis) and late steps of cholesterol synthesis (Fig. 4) is a predicted target of miR-21. [score:4]
To test the direct responsiveness toward miR-21, miR-21 inhibitor (LNA-21) and negative control (LNA-scr) were co -transfected with the reporter vectors (Fig. 6D, Fig. S4A, B). [score:4]
Co-transfection of miR-21 inhibitor caused a 3-fold increase in the luciferase activity of the ‘Perfect’ binding site vector (‘A+LNA-scr’ vs ‘A+LNA-21’, p<0.0001), demonstrating effective inhibition of miR-21 by the LNA-oligonucleotide and confirming the Q-PCR assay of miR-21 shown in Fig. 5F. [score:4]
Mutation of the miR-21 target site of Srebf1 led to an increased luciferase activity (Fig. 6B, ‘C’ vs. [score:4]
Removing miR-21 had no effect on the mutant Srebf1 target site construct. [score:3]
To validate the predicted miR-21 target sites in the 3′UTR of Srebf1, Acat1 and Sqle luciferase reporter vectors were constructed (Fig. 6A). [score:3]
In our ISH study we localized miR-21 to be expressed in perinatal acinar cells and in pancreatic islets, correlating well with the rapid proliferation in exocrine and endocrine cells of postnatal pancreas. [score:3]
Northern blots (Fig. 2) showed that miR-21, -29a, -23a, -141 and -125b-5p all were expressed in INS-1E cells and therefore expected to be localized to endocrine tissue. [score:3]
‘C+LNA-scr’, p<0.05), demonstrating that the target site is functional, but the quantitative effect of removing cellular miR-21 is small. [score:3]
Reporter-gene analysis of predicted miR-21 target genes. [score:3]
These data were consistent with Srebf1 being a target gene of miR-21. [score:3]
Reporter-gene analysis of predicted target genes of miR-21 and their binding sites. [score:3]
Thus, inhibition of miR-21 and miR-29a simultaneously and miR-29a by itself increased total cholesterol levels, showing that the increase of miR-21 and miR-29a following birth is likely to functionally participate in the decrease of the cholesterol synthesis pathway. [score:3]
Figure S4 Reporter-gene analysis of predicted target sites in Acat1 and Sqle in response to exogenous miR-21. [score:3]
E. mRNA levels for Srebf1 following knock-down of miR-21 in INS-1E cells (LNA-21: Knock-down of miR-21, LNA-scr: Scrambled control LNA, endogenous control: TfIIB). [score:3]
Correlations between mRNAs and miRNA-21 expression. [score:3]
MiR-21 up-regulation coincides with the rise in beta-cell proliferation and could be a contributing factor to this. [score:3]
Reporter-gene analysis of the predicted target sites of Acat1 and Sqle were unable to confirm that these two predicted targets of miR-21 were functional (Fig. 6 and Fig. 4A and 4B), which is consistent with measurements of mRNA levels. [score:3]
In the clonal INS-1E beta-cells SREBP1 and miR-21 are co-expressed, however, co-localization was not determined in perinatal beta-cells. [score:3]
MiR-21 has been found to be up-regulated in several studies of pancreas cancer, is associated with a poor prognosis and generally increases cellular proliferation [31]– [33]. [score:3]
F. miR-21 levels in INS-1E cells nucleofected with either knock-down LNA-oligonucleotide directed against miR-21 (LNA-21) or with a scrambled negative control LNA-oligonucleotide (LNA-scr). [score:3]
To determine whether the presence of multiple targets of miR-21 and miR-29a (Fig. 4) along the cholesterol synthesis pathway resulted in a cumulative effect on cholesterol levels, we extracted and measured cholesterol in INS-1E cells nucleofected with oligonucleotide inhibitors of miR-21 and miR-29a (LNA-21 and LNA-29a) and negative control oligonucleotide (LNA-scr). [score:3]
There was an insignificant increase in cholesterol levels of cells treated with miR-21 inhibitor. [score:3]
The localization studies showed endocrine localization of six of these miRNAs (miR-21, -23a, -29a, -125b-5p, -376b-3p and -451), and all were expressed in exocrine cells at one time point at least. [score:3]
In addition, SQLE (squalene epoxidase), which catalyzes a rate-limiting step in sterol synthesis and mitochondrial ACAT1 (acetyl-coenzyme A acetyltransferase 1), which catalyzes the first step of isoprenoid biosynthesis, are also predicted targets of miR-21. [score:3]
Table S3 List of oligonucleotides used for Q-PCR and for cloning miR-21 target reporter vectors. [score:3]
However, we believe that our assays genuinely capture the effects of these miRNAs, because we have shown effective inhibition of miR-21 using LNA -modified oligonucleotides (Fig. 5F) and the effects of the functional reporter assays on the Srebf1 target site (Fig. 6B and D) mirror the effects of miR-21 on Srebf1 mRNA and protein levels (Fig. 5E and H). [score:3]
Endogenous miR-21 was inhibited with 25 pmol/well antisense LNA-21 (Exiqon) cotransfected with reporter vectors (scrambled LNA oligonucleotides served as negative control). [score:3]
SREBP1 mRNA and protein levels in the perinatal pancreas also showed a decrease between E20 and P0 and an increase in miR-21 of which Srebf1 mRNA is a predicted target (Fig. 5C, D). [score:3]
Localization of miR-21 changed from equally exocrine and endocrine at E20 to mostly exocrine expression at P2. [score:3]
It seems likely that these small effects are functional given that we can increase cholesterol levels by inhibiting miR-21 and miR-29a. [score:3]
G and H. Protein levels of SREBF1 following knock-down of miR-21 in INS-1E cells. [score:2]
Cluster I and II consisted of miR-29a and miR-21, and miR-125b-5p and miR-23a, respectively, and showed an increased expression at P0 and P2 compared to E20. [score:2]
Whether the perinatal regulation of miR-21 and miR-29a is present in other tissues remain to be investigated; however, cholesterol synthesis of rat liver, intestines and brain decrease sharply at the day of birth and synthesis rates then increase again on postnatal day 2 [47], which is consistent with the mRNA and miRNA expression pattern observed in pancreas. [score:2]
4·10 [6] cells were nucleofected with miR-21 and/or miR-29a LNA knock-down, or scrambled LNA oligonucleotide (Exiqon) using an Amaxa nucleofector (Lonza, Copenhagen, Denmark). [score:2]
Cells with inhibited miR-29a alone or with miR-21 had increased total cholesterol levels compared with LNA-scr (Fig. 6E, ‘LNA-scr’ vs. [score:2]
MessengerRNA levels of Srebf1 increased by about 30% after miR-21 knock-down (Fig. 5E). [score:2]
Removal of miR-21 from pGL4.13 did not have any effect indicating that this contains no endogenous miR-21 site. [score:1]
0025997.g006 Figure 6 A. Predicted binding sites in the Srebf1, Acat1 and Sqle 3′UTRs with suggested miR-21 binding. [score:1]
Localization of miR-21 and miR-29a in perintal rat pancreas at E20, P0 and P2 by in situ hybridization. [score:1]
Clearly, miR-21 cannot be the only factor controlling SREBP1 protein levels; also dietary lipids, which are known to affect SREBP1 levels and activity, change after birth. [score:1]
However, miR-21 and miR-29a were 2.5- and 4-fold increased. [score:1]
The miR-21 binding site of Srebf1 is rat specific; however the human SREBF1 gene contains a binding site for miR-29a, and this miRNA is also increased in islets at P0 and P2 and has an effect on cholesterol levels. [score:1]
Also SREBP1 protein levels increased approximately 50% after miR-21 knock-down compared with a LNA-scr (Fig. 5G, H). [score:1]
C. miR-21 and Srebf1 mRNA levels in perinatal rat pancreas (n = 3). [score:1]
A. Predicted binding sites in the Srebf1, Acat1 and Sqle 3′UTRs with suggested miR-21 binding. [score:1]
Constructs with perfect complementarity to miR-21 (‘Perfect’) and this sequence scrambled (‘Scr’) were made as controls. [score:1]
These were: miR-21, -23a, -29a, -125b-5p, -141, -376a, -376b-3p, -341 and -451 (Fig. 1A). [score:1]
SREBF1 mRNA and protein levels in response to miR-21 levels. [score:1]
Figure S3 Images from ISH sections stained for miR-21, -29a, -451, -141, -376a, -376b-3p, -23a, -125b-5p and corresponding scrambled control. [score:1]
[1 to 20 of 61 sentences]
12
[+] score: 180
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
miR-21 overexpression significantly inhibited BTG2 protein expression (p < 0.01, n = 3) whereas knock-down miR-21 expression obviously increased BTG2 protein expression (p < 0.01, n = 3) (Figure 5B). [score:12]
In contrast, DOX -induced apoptosis and the release of LDH were exacerbated after down-regulation of miR-21 expression via miR-21 inhibitor. [score:8]
Interestingly, up-regulation of miR-21 expression via miR-21 mimic inhibited DOX -induced apoptosis and the release of LDH. [score:8]
It is worth noting that our recent study with a transgenic mo del of myocardial overexpression of nucleolin revealed that miR-21 was one of eleven miRNAs whose expression was up-regulated by nucleolin (Jiang et al., 2015, unpublished data). [score:8]
Zhang S. Han L. Wei J. Shi Z. Pu P. Zhang J. Yuan X. Kang C. Combination treatment with doxorubicin and microRNA-21 inhibitor synergistically augments anticancer activity through upregulation of tumor suppressing genes Int. [score:8]
Thus, targeting miR-21 and inhibiting its activity may be emerging as a promising therapeutic option and offers a potential new mode of cancer therapy. [score:5]
The results showed that BCL-2, BTG2, FGF18, PDCD4, FASLG may be the biological targets of miR-21 by the gain- and loss- of-function approaches with a miR-21 mimic and an inhibitor (Figure 4). [score:5]
To further define the potential role of miR-21 in mediating DOX -induced cardiotoxicity, miR-21 expression was modulated by using both miR-21 mimic and inhibitor, respectively. [score:5]
We used bioinformatics software (TargetScan or PicTar) to predict 9 biological targets of miR-21. [score:5]
Compared with that in the cells treated with scramble, the expression level of miR-21 was increased to 2.17-fold in H9C2 cells transfected with rno-miR-21 mimics (p < 0.01, n = 3); Compared with that in the cells treated with scramble, the expression levels of miR-21 was decreased to 0.55 folds in H9C2 cells transfected with a rno-miR-21 inhibitor (p < 0.05, n = 3) (Figure 3A). [score:5]
These results suggest that miR-21 attenuates DOX -induced injury on cardiac myocytes, whereas inhibition of its expression may aggravate DOX -induced apoptosis of cardiac myocyte. [score:5]
Figure 4The expression of target mRNAs of miR-21 were tested by qRT-PCR. [score:5]
In this study, we found that miR-21 regulated the expression of BTG2. [score:4]
Prior to this study, it was not clear whether BTG2 was the true target of miR-21 in cardiac myocytes and whether miR-21 protected cardiac myocytes from DOX -induced injury through regulating BTG2, so we have chosen BTG2 for further study. [score:4]
MicroRNA-21 target genes in mouse were screened by merging the results of computational prediction algorithms provided at the TargetScan (http://www. [score:4]
In summary, in this study, we have documented that miR-21 is a potent protector for cardiomyocytes against DOX -induced cardiotoxicity probably via regulating the expression of BTG2, a member of an anti-proliferative gene family. [score:4]
Roy S. Khanna S. Hussain S. R. Biswas S. Azad A. Rink C. Gnyawali S. Shilo S. Nuovo G. J. Sen C. K. MicroRNA expression in response to murine myocardial infarction: miR-21 regulates fibroblast metalloprotease-2 via phosphatase and tensin homologue Cardiovasc. [score:4]
Our next plan is to further elucidate how miR-21 regulates BTG2 expression and what precise role it plays in mediating DOX -induced apoptosis of cardiomyocytes. [score:4]
These results suggest that BTG2 is target gene of miR-21 in cardiac myocytes and that miR-21 may protect cardiacmyocytes from DOX -induced injury through post-transcriptional regulation of BTG2. [score:4]
Figure 3Overexpression and knockdown of miR-21 influenced the DOX -induced cytotoxicity in H9C2 cells. [score:4]
Regarding how miR-21 protected cardiac myocytes from DOX -induced injury, a bioinformatic analysis suggests that BTG2 may be a potential target of miR-21. [score:3]
However, the study by Tong’s group reported that miR-21 promoted cardiac fibrosis and development of heart failure with preserved left ventricular ejection fraction by up -regulating BCL-2 [25]. [score:3]
As shown in Figure 2B, exposure of cardiac myocytes to DOX at doses ranging from 0–4 µM for 24 h resulted in a significantly dose -dependent increase in miR-21 expression level in H9C2 cells (p < 0.01, n = 3). [score:3]
Importantly, we found that the mechanism underlying the cardioprotective effects of miR-21 against DOX toxicity is probably mediated through targeting BTG2. [score:3]
Recent studies have demonstrated that BTG2 is a new target gene of miR-21 in prostate cancer cells, laryngeal cancer cells and melanoma cells. [score:3]
The Effects of miR-21 Mimics and Inhibitors on the Injury Mediated by DOX in H9C2 Cells. [score:3]
Moreover, recent studies have indicated that miR-21 had a protective effect on ischemia -induced cell apoptosis that was associated with its target gene programmed cell death 4 and activator protein 1 pathway [13]. [score:3]
Figure 2The effects of DOX on the expression of miR-21 in myocardium and H9C2 cells. [score:3]
H9C2 cells at 80% confluence were transfected with rno-miR-21 mimics (5′-UAGCUUAUCAGACUGAUGUUGA-3′) or rno-miR-21 inhibitors (5′-UAGCUUAUCAGACUGAUGUUGA-3′), or scrambled controls (Qiagen, Cambridge, MA, USA), respectively, at a final concentration of 20 μM with the use of hiperfect transfect reagent (Qiagen). [score:3]
The Effect of DOX Treatment on the Expression of miR-21 in Mice Myocardium and H9C2 Cells. [score:3]
Dong S. Cheng Y. Yang J. Li J. Liu X. Wang X. Wang D. Krall T. J. Delphin E. S. Zhang C. MicroRNA expression signature and the role of microRNA-21 in the early phase of acute myocardial infarction J. Biol. [score:3]
Recent studies have indicated that miR-21 has a protective effect on ischemia -induced cell apoptosis associated with its target genes, such as PDCD4 and PTEN (phosphatase and tensin homolog) [13, 14]. [score:3]
Jazbutyte V. Thum T. MicroRNA-21: From cancer to cardiovascular disease Curr. [score:2]
Dong S. Ma W. Hao B. Hu F. Yan L. Yan X. Wang Y. Chen Z. Wang Z. MicroRNA-21 promotes cardiac fibrosis and development of heart failure with preserved left ventricular ejection fraction by up -regulating BCL-2 Int. [score:2]
However, it was not clear whether miR-21 protected cardiac myocytes from DOX -induced injury through regulating BTG2. [score:2]
Liu M. Wu H. Liu T. Li Y. Wang F. Wan H. Li X. Tang H. Regulation of the cell cycle gene, BTG2, by MIR-21 in human laryngeal carcinoma Cell Res. [score:2]
Knocking down miR-21 obviously decreased the cell viability (p < 0.05, n = 6) and obviously increased the release of LDH (p < 0.05, n = 6) (Figure 3C,D). [score:2]
Compared with that in the cells treated with the scramble + DOX, apoptotic rate was decreased from 37% ± 2.1% to 18% ± 2.8% in cells treated with miR-21 mimics(p < 0.05, n = 3), but the percentage of the apoptotic cardiac myocytes was increased to 57% ± 4.3% in the cells treated with miR-21 inhibitor (p < 0.05, n = 3) (Figure 3B). [score:2]
Moreover, the regulation of BTG2 by miR-21 has been reported in human laryngeal carcinoma [29]. [score:2]
As shown in Figure 2A, the expression level of miR-21 in C-DOX group was significantly increased to 1.8-fold as compared with that in C-NS group (1.800 ± 0.4078 vs. [score:2]
The expression level of miR-21 in A-DOX group was no significant difference compared with that in A-NS group (1.520 ± 0.2307 vs. [score:2]
During carcinogenesis, miR-21 plays an important role in regulating BTG2 genes [15]. [score:2]
MicroRNA-21 (miR-21) is one of the first identified mammalian miRNAs. [score:1]
The present study aimed to determine the role of miR-21 in protection of cardiomyocytes against DOX-triggered cardiotoxicity and the underlying mechanisms. [score:1]
In renal I/R injury, miR-21 is more likely a double-edged sword, which has both protective and pathological roles [24]. [score:1]
We speculated that this could be due to the face that miR-21 exerted its biological functions through different signaling pathways under different circumstances. [score:1]
These results clearly suggest that miR-21 has anti-apoptotic and anti-cell death effects against DOX -induced cardiotoxicity (Figure 3). [score:1]
However, the potential benefits of miR-21 action on DOX -induced injury and its underlying mechanism(s) are largely unknown. [score:1]
Taking together, these studies have identified important connections of nucleolin-miR21-BTG2. [score:1]
The results in Figure 5A showed the predicted consequential pairing of BTG2 (top) and miR-21 (bottom) (http://www. [score:1]
*, p < 0.05, compared to that of cells treated with scramble, n = 3; **, p < 0.01, compared to that of cells transfected with scramble, n = 3; (B) Apoptosis induced by DOX (1 µM for 24 h) in H9C2 cells transfected with miR-21 mimics/inhibitors. [score:1]
Our results demonstrate that miR-21 can alleviate DOX -induced cardiomyocyte apopotosis and further increase cell viability in rat H9C2 cardiomyocytes. [score:1]
However, the effect of miR-21 on DOX induced cardiotoxicity is not clear. [score:1]
Therefore, on the basis of these findings, we postulated that miR-21 would protect against DOX-triggered cardiotoxicity. [score:1]
Furthermore, miR-21 exerted an anti-apoptotic function in ischemia/reperfusion- and hypoxia/reoxygenation -induced cardiocyte apoptosis via the phosphatase and tensin homolog/akt -dependent mechanism [14]. [score:1]
[1 to 20 of 55 sentences]
13
[+] score: 180
Other miRNAs from this paper: rno-mir-200c, rno-mir-205
The combination of the results of the computational prediction of target genes of miR-21 and the downregulation of genes in the whole genome expression array at 4 indicated times revealed no target gene on the basis of the prediction algorithms PicTar, TargetScanS, and MirTarget2; in contrast, when the prediction algorithms miRanda and RNAhybrid were applied, the same 4 target genes (Nqo1, Pdpn, CXCL3, and Rad23b) (Table 1) demonstrated a persistent downregulated status at 1, 3, 7, and 14 d (Figure 3). [score:19]
In monitoring the target genes of miR-21 in the expression array at 1, 3, 7, 14 d after reperfusion, with persistent expression throughout the experiment, we detected the same 4 persistently downregulated target genes (Nqo1, Pdpn, CXCL3, and Rad23b) with the prediction algorithms miRanda and RNAhybrid, but no target gene was revealed with PicTar, TargetScanS, and MirTarget2. [score:18]
This study revealed 3 upregulated miRNAs in the gracilis muscle following ischemic injury and identified 4 potential target genes of miR-21 by examining miRNAs and mRNAs expression patterns in a time-course fashion using a combined approach with prediction algorithms and a whole genome expression array experiment. [score:10]
Because bioinformatic analysis has indicated that miRNAs frequently interact with transcription factors in feedback and feedforward loops to regulate their target genes [43, 44]; therefore, further experiments are required to elucidate the function and role of these potential target genes and the upregulated miR-21, as well as miR-200c and miR-205, in ischemic injury. [score:9]
In the experiment that we performed to identify the minimal ischemic time that would induce the expression of these 3 miRNAs, upregulation of miR-21 and miR-200c was noted after 4 h of reperfusion following 1 h and 2 h, but not 30 min of ischemia; in addition, upregulation of miR-205 was noted after 4 h of reperfusion following 2 h, but not 30 min or 1 h of ischemia (Figure 2). [score:9]
Figure 3The expression of down-regulated Nqo1, Pdpn, CXCL3, and Rad23b, which were the potential target genes of rno-miR-21 detected from the combined approach of the prediction algorithms miRanda and RNAhybrid, in the Whole Rat Genome 4 × 44 k oligo microarray experiments of the gracilis muscle after reperfusion for 1, 3, 7, and 14 d following 4 h of ischemia. [score:8]
This study has profiled an increased expression of miR-21, miR-200c, and miR-205 in the gracilis muscle following ischemic injury and identified four potential target genes (Nqo1, Pdpn, CXCL3, and Rad23b) of the miR-21 by using different prediction algorithms and monitoring the expression of miRNA and mRNA at different time point on a genome-wide basis. [score:7]
In addition, the in silico prediction using the algorithms miRanda, PicTar, TargetScanS, MirTarget2, and RNAhybrid resulted in 957, 60, 159, 110, and 939 target genes of miR-21, respectively. [score:7]
The database of experimentally validated miRNA target genes, MiRecords [32], lists 26 validated target genes of miR-21 in humans (TPM1, CDK6, TIMP3, PDCD4, SERPINB5, NFIB, CDKN1A, FAS, FAM3C, HIPK3, PRRG4, ACTA2, BTG2, BMPR2, SESN1, IL6R, SOCS5, GLCCI1, APAF1, SLC16A10, SGK3, RP2, CFL2, RECK, MTAP, SOX5) and only 2 validated target genes in the rat (ITGB1, Tagln). [score:7]
In an investigation of rat hearts at 6 h after acute myocardial injury, miRNA signatures in the early phase revealed that, among multiple aberrantly expressed miRNAs, miR-21 was significantly downregulated in infarcted areas, but was upregulated in border areas [31]. [score:7]
Remarkably, the downregulation of miR-21 in infarcted areas was inhibited by ischemic preconditioning, a known cardio-protective method. [score:6]
However, as shown in the Figure 2, in the investigation of minimal ischemic time that would induce the expression of these 3 miRNAs, we had demonstrated that 1 h of ischemia was able to increase the expression of miR-21 and miR-200c and 2 h of ischemia would increase the expression of these three miRNAs, implying the epigenetic regulation could be induced by a shorter time of ischemia before a remarked pathophysiologic change could be observed by a longer time of ischemia. [score:6]
Therefore, we decided to only focus on the genes that were downregulated by miR-21, which showed a persistent expression throughout the experiment period at all 4 indicated times. [score:6]
Ischemia for only 1 h was sufficient to induce the expression of miR-21 and miR-200c during the reperfusion stage; and 2 h of ischemia were required to induce the expression of miR-205. [score:5]
Real-time RT-PCR demonstrated that, with 2-fold increase after 4 h of ischemia, a maximum 24-fold increase at 7 d, and a 7.5-fold increase at 14 d after reperfusion, only the miR-21, but not the miR-200c or miR-205 was upregulated throughout the experimental time. [score:4]
Those upregulated miRNAs (miR-21, miR-200c, and miR-205) that were identified from the miRNA array were quantified by real-time RT-PCR with the Applied Biosystems 7500 (Applied Biosystems, USA). [score:4]
As shown in Figure 1, the 2-fold upregulation of miR-21 was detected after 4 h of ischemia and increased to a maximum of ~24 fold at 7 d after reperfusion. [score:4]
In this study, we demonstrated that 3 miRNAs (miR-21, miR-200c, and miR-205) were significantly upregulated in a different pattern in the gracilis muscles following ischemic injury. [score:4]
The overexpression of miR-21 has been shown to be in a number of medium-scale and high-scale profiling experiments that were designed for the detection of miRNAs that are dysregulated in cancer [27]. [score:4]
Figure 1 Expression of miR-21, miR-200c, and miR-205 detected with real-time RT-PCR in the gracilis muscles following 4 h of ischemia and reperfusion for indicated times. [score:3]
At 14 d, there was still a 7.5-fold increased expression of miR-21. [score:3]
Figure 2 Expression of miR-21, miR-200c, and miR-205 detected with real-time RT-PCR in the gracilis muscles following indicated ischemic times (30 min, 1 h, and 2 h) and reperfusion for 4 h. Bars represent means ± standard deviation of 5 independent experiments; *, P < 0.05 vs. [score:3]
In contrast, the expression of miR-21 gradually increased to its maximum level at 7 d and persisted throughout the experiment for at least 14 d after the ischemic injury. [score:3]
In the investigation of the differentially expressed miRNAs from the miRNA array experiments, there were only 3 miRNAs (miR-21, miR-200c, and miR-205) that showed an increased expression in the gracilis muscles after 4 h of ischemia and 4 h of reperfusion. [score:3]
Three miRNAs (miR-21, miR-200c, and miR-205) of 350 tested rat miRNAs were found to have an increased expression in the miRNA array. [score:3]
In addition, adenoviral overexpression of miR-21 had a protective effect on myocardial infarction by decreasing the infarct size by 29% at 24 h [31]. [score:3]
It has been reported that miR-21 protects against the hydrogen peroxide -induced injury of cardiac myocytes via its target gene, the repressor gene programmed cell death 4 (PDCD4), and the AP-1 pathway [30]. [score:3]
The injection of chemically synthesized exogenous miR-21 significantly reduced infarct size in the heart which was blocked with a miR-21 inhibitor [19]. [score:3]
In this study, we found 4 potential target genes (Nqo1, Pdpn, CXCL3, and Rad23b) of miR-21 during skeletal muscle ischemic injury. [score:3]
The hydrogen peroxide -induced cardiac cell death and apoptosis were increased by a miR-21 inhibitor and was decreased by pre-miR-21 transfection [30]. [score:3]
This finding might imply an important role of miR-21 during ischemic injury in the muscle. [score:1]
In addition, miR-21 has been reported to have anti-apoptotic properties in cancer cells [28, 29]. [score:1]
In addition, a significant induction of miR-21 was noted in the heart following whole body heat-shock [19]. [score:1]
[1 to 20 of 33 sentences]
14
[+] score: 176
The above work has shown that miR-21 may enhance angiogenesis by targeting TIMP3 through the up-regulation of MMP2 and MMP9 expression. [score:8]
In our study, mimics of miR-21 could inhibit TIMP3 expression and promote MMP2 and MMP9 expression and secretion in an OGD mo del of HUVECs. [score:7]
To investigate the biologic function of miR-21 in HUVECs of OGD, the expression of miR-21 was artificially up-regulated via mimics or down-regulated via antagomir. [score:7]
Previously, we found that TIMP3 may be a direct downstream target gene of miR-21 by bioinformatics prediction (Targetscan). [score:6]
In the present study, the over -expression of miR-21 by mimics or the down-regulation of miR-21 by antagomir was implemented successfully in HUVECs. [score:6]
First, to clarify the role of miR-21 on injured endothelial cells exclusively and the specific mechanisms, the OGD mo del of HUVECs was constructed, and the up-regulation of miR-21 was discovered in this mo del, which was consistent with the altered miR-21 expression observed in an SCI mo del of rats[16]. [score:6]
In the miR-21 mimic group, TIMP3 expression was decreased at both the mRNA (Fig 5A, 054±0.12-fold, n = 3/group, p<0.05) and protein levels (Fig 5D and 5E, 053±0.09-fold, n = 3/group, p<0.05) relative to the miR-21 mimic negative control group, whereas the expression of both MMP2 and MMP9 was increased at both the mRNA (Fig 5B and 5C, 1.35±0.02-fold and 1.79±0.11-fold, respectively, n = 3/group, p<0.05) and protein levels (Fig 5D, 5F and 5G, 1.45±0.08-fold and 1.83±0.09-fold, respectively, n = 3/group, p<0.05) relative to the miR-21 mimic negative control group. [score:5]
Previously, we have detected that miR-21 was one of the most significantly upregulated miRNAs after SCI in a rat mo del using miRNA microarray; knockdown of miR-21 by antagomir correlated with apoptotic cells and a functional deficit[16]. [score:5]
Previous reports have shown that miR-21 targeted TIMP3 and decreased its expression in some cancer cells[34, 35]. [score:5]
The results revealed that miR-21 expression was significantly higher (3.27±0.40-fold) in the miR-21 mimic group than it was in miR-21 mimic negative control group and that miR-21 expression was significantly lower (0.28±0.01-fold) in the antagomir-21 group than it was in the antagomir-21 negative control group (Fig 1B, n = 3/group, p<0.01). [score:5]
To further confirm that TIMP3 is a direct target gene of miR-21, we cloned a construct with a fragment of the 3’-UTR of TIMP3 mRNA with the putative miR-21 binding sequence into a firefly dual-luciferase reporter vector for co-transfection with vehicle control into 293T cells. [score:4]
These results revealed that the down-regulation of miR-21 was adverse to remo deling of the vasculature 3,7 or 14 days after SCI in rats (Bar = 500 μm, Values represent means±S. [score:4]
Regulation of miR-21 expression in HUVECs. [score:4]
TIMP3 is a direct target of miR-21. [score:4]
A recent study has indicated that miR-21 is highly expressed in endothelial cells[19], which suggests that miR-21 may contribute significantly to the functional regulation of endothelial cells. [score:4]
In fact, miR-21 is up-regulated in diverse tumors and plays a potential role in the angiogenesis of cancers[15, 39]. [score:4]
Similar to the effects on protein expression, In the miR-21 mimic group, the secretion of both MMP2 (Fig 6A, 1.20±0.04-fold, n = 3/group, p<0.05) and MMP9 (Fig 6B, 1.39±0.06-fold n = 3/group, p<0.05) was increased relative to the miR-21 mimic negative control group. [score:3]
Among these miRNAs, miR-21 was overexpressed and found to protect neurons after SCI in rats as described previously[16]. [score:3]
miR-21 mimics inhibited cell death and activated cell proliferation, migration and tube formation. [score:3]
However, the direct role of miR-21 in the regulation of angiogenesis in response to SCI remains to be revealed. [score:3]
In addition, another study demonstrated that knock-down of miR-21 had a distinct negative effect on neointimal lesion formation, thus suggesting a pro-angiogenic effect of miR-21 by possibly regulating PTEN and Bcl-2[40]. [score:3]
After exposure to 4 h OGD and recovery for 24 h, miR-21 mimics increased the expression of miR-21 compared with miR-21 mimic negative control; antagomir-21 decreased the expression of miR-21 compared with antagomir-21 negative control. [score:3]
Moreover, the hypertrophic response to SCI in astrocytes was attenuated by the overexpression of miR-21[37]. [score:3]
Second, we found that inhibition of miR-21 by antagomir is not conducive to angiogenesis three, seven or fourteen days after SCI using absorption-contrast imaging of SRμCT i n vivo. [score:3]
The 3’-UTR of TIMP3 is a target for miR-21. [score:3]
In the present study, we detected miR-21 expression in human umbilical vein endothelial cell lines (HUVEC), which were deprived of oxygen and glucose (OGD) simulating ischemia-reperfusion injury in vitro. [score:3]
Identifying the roles of miR-21 in angiogenic protection might offer a novel therapeutic target for secondary SCI, in which angiogenesis is indispensable. [score:3]
Effect of miR-21 on TIMP3, MMP2 and MMP9 expression. [score:3]
These results imply that miR-21 may be involved in endothelial cell survival, migration and capillary formation by inhibiting TIMP3 through the promotion of MMP2 and MMP9 activity, thus furthering angiogenesis in vitro. [score:3]
Our results indicated that miR-21 seems to be able to promote the survival, migration and tube formation of HUVEC of ODG by targeting TIMP3 through MMP2 and MMP9, thus leading to a pro-angiogenic phenotype. [score:3]
qRT-PCR was applied to detect the expression of miR-21 in cells subjected to transfection and OGD. [score:3]
In spite of it, this study indicated that miR-21 could play a protective role in angiogenesis through targeting TIMP3. [score:3]
These data therefore indicate that miR-21 could directly bind to TIMP3. [score:2]
These results suggest that TIMP3 is essential for miR-21-enhanced angiogenesis by potentially regulating MMP2 and MMP9. [score:2]
0149537.g001 Fig 1. (A) miR-21 expression of HUVECs exposed to 4 h OGD and recovered for 24 h increased significantly compared with cells without OGD. [score:2]
TIMP3 has proven to be a target gene of miR-21 in adual-luciferase reporter assay. [score:2]
Firefly luciferase activity was normalized to Renilla luciferase expression (n = 3, *P<0.05 compared with miR-21-NC group). [score:2]
miRNA-21 (miR-21) is one of the most wi dely studied miRNAs because it is overexpressed in almost all human tumors and is considered a oncogene that is involved in apoptosis[11], necrosis[12], invasion[13], proliferation[14] and pro-angiogenesis[15]. [score:2]
A fragment of the 3’-UTR TIMP3 mRNA with the putative miR-21 binding sequence was cloned into a firefly luciferase reporter constructed into 293 T cells with miR-21 and miR21-NC. [score:1]
293T cells were transfected with TIMP3-3'UTR wild (3'UTR WT), TIMP3-3'UTR mutant (3'UTR MU), TIMP3-3'UTR negative control (3'UTR NC) miR-21 and miR-21 negative control (miR21-NC) in 24-well plates via Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:1]
Transfection of the miR-21 mimics (50 nM), the miR-21 mimic negative control (50 nM), antagomir-21 (200 nM), antagomir-21 negative control (200 nM), anti-TIMP3 small interfering RNA (siRNA) or anti-TIMP3 siRNA negative control (50 nM) (Ribo, Guangzhou, China) was performed using riboFECT™ CP Transfection Kit (Ribo, Guangzhou, China) according to the manufacturer’s protocol. [score:1]
Effect of miR-21 on the capillary network formation of HUVECs. [score:1]
miR-U6 was used as an internal control to normalize the relative miR-21 levels. [score:1]
However, the relation between miR-21 and TIMP3 in HUVECs after OGD is currently unclear. [score:1]
Anti-apoptotic effect of microRNA-21 after contusion spinal cord injury in rats. [score:1]
0149537.g004 Fig 4 (A) After transfection with miR-21 mimics, miR-21 mimic negative control, antagomir-21 or antagomir-21 negative control, HUVECs were exposed to OGD and then trypsinized and seeded onto Matrigel. [score:1]
In summary, in an SCI mo del in rats and an ischemia/reperfusion injury mo del in HUVECs, miR-21 has a protective effect on angiogenesis. [score:1]
These results indicate that miR-21 plays a vital role in modulating angiogenesis in vitro. [score:1]
Effect of miR-21 on MMP2 and MMP9 secretion. [score:1]
0149537.g002 Fig 2. (A) Detection of HUVEC death transfected with miR-21 mimics, miR-21 mimic negative control, antagomir-21 or antagomir-21 negative control and then exposed to OGD by. [score:1]
In our results, the number of dead cells was far less in the miR-21 mimic group than it was in the miR-21 mimic negative control group after the aforementioned OGD and recovery. [score:1]
0149537.g005 Fig 5. HUVECs were transfected with miR-21 mimics, miR-21 mimic negative control, antagomir-21 or antagomir-21 negative control and exposed to OGD for 4 h and then recovered for 24h. [score:1]
In the present study, the level of miR-21 increased in HUVECs after treatment for 4 h with OGD and recovery for 24 h (Fig 1A, n = 3/group, p<0.01). [score:1]
SRμCT, which can detect vessels with diameters as small as approximately 7.4 μm[54], provides new insight into the effect of miR-21 on the vascular reaction to spinal cord trauma in three dimensions. [score:1]
The exact role of MMP2 and 9 in miR-21 mediated angiogenesis is not verified. [score:1]
However, the effect of miR-21 on angiogenesis after SCI remains poorly understood and requires further study. [score:1]
Furthermore, we explored the potential mechanisms by examining the effect of miR-21 on TIMP3, MMP2 and MMP9. [score:1]
Our present study confirmed that miR-21 was able to promote angiogenesis after SCI both in vitro and in vivo. [score:1]
Our results indicated that the cell viability was expedited in miR-21 mimic -transfected HUVECs compared with miR-21 mimic negative control -transfected HUVECs after OGD and recovery for 24 h and 48 h; conversely, antagomir-21 could significantly inhibit the viability of HUVECs compared with antagomir-21 negative control -transfected HUVECs after OGD and recovery for 48 h (Fig 2C, n = 3/group, p<0.05). [score:1]
On the contrary, the number of branch nodes of HUVECs transfected with miR-21 mimics and exposed to OGD was clearly higher than those transfected with the miR-21 mimic negative control (1.73±0.14-fold, n = 3/group, p<0.05). [score:1]
Effect of miR-21 on HUVEC death and viability. [score:1]
0149537.g007 Fig 7 (A) Predicted miR-21 binding sites within the 3’-UTR of TIMP3 mRNA. [score:1]
This result suggests that miR-21 in the OGD mo del of HUVECs has a potential protective effect. [score:1]
Using this technique, the effect of miR-21 on the repair process of the microvascular network can be visualized in three dimensions (3D) after SCI in rats. [score:1]
miR-21 had been manifested to promote migration and tube formation of uninjured HUVEC in vitro[41]. [score:1]
Effect of miR-21 on capillary network formation of HUVECs. [score:1]
After transfection with miR-21 mimics, miR-21 mimic negative control, antagomir-21 or antagomir-21 negative control, confluent HUVECs monolayers were exposed to OGD and then scratched to induce horizontal migration of HUVECs (magnification, x100). [score:1]
As mentioned above, in our previous study, the level of miR-21 increased after SCI in rats[16]. [score:1]
Effect of miR-21 on HUVEC migration. [score:1]
HUVECs were transfected with miR-21 mimics, miR-21 mimic negative control, antagomir-21 or antagomir-21 negative control and exposed to OGD for 4 h and then recovered for 24h. [score:1]
[1 to 20 of 70 sentences]
15
[+] score: 167
We further showed that miR-21 expression in the media was significantly reduced after clodronate treatment, suggesting that macrophage depletion could down-regulate miR-21 expression in SMCs. [score:8]
To identify the factor(s) that was responsible for this paracrine regulatory effect, we screened the effects of several potential macrophage-derived cytokines on miR-21 expression in NIH3T3 cells, including TGF-β, TNF-α, VEGF, PDGF and IL-6. We found that TNF-α drastically increased miR-21 expression (Figure 4B). [score:6]
We demonstrated that the conditioned medium from unstimulated macrophages and LPS-activated macrophages significantly upregulated miR-21 expression in both cells (Figure 4A). [score:6]
We also confirmed that TNF-α treatment upregulated miR-21 expressions in primary fibroblasts and VSMCs (Supplementary Figure III). [score:6]
Moreover, we isolated primary fibroblasts from sham and allograft adventitial tissues, and showed that miR-21 expression was significantly upregulated in graft-derived fibroblasts (Figure 2B). [score:6]
Hence our data suggest that macrophage depletion can down-regulate miR-21 expression in medial SMCs. [score:6]
Although we could not clearly distinguish miR-21 expression in adventitial fibroblasts and macrophages, the data in Figure 2B support that fibroblasts contribute to, at least partially, the increased adventitial miR-21 expression in transplanted vessels. [score:5]
Macrophage depletion suppresses miR-21 expression in transplanted vessels. [score:5]
To further corroborate the paracrine effect of macrophage on mural cell miR-21 expression, we treated the conditioned medium with a neutralizing antibody to TNF-α; we demonstrated that the stimulating effects of conditioned medium on miR-21 expression were blocked by the neutralizing antibody in both fibroblasts and VSMCs (Figure 4D). [score:5]
We showed that miR-21 mimic significantly enhanced the expressions of MCP-1 and VCAM-1, although the increase in ICAM-1 expression was not statistically significant (Figure 5A). [score:5]
Nonetheless, since TNF-α may affect the expression of multiple miRNAs [46], a limitation of the present study is that we only selected miR-21 (a well documented pathogenic factor in vascular smooth muscle cells) as a target to prove the principle, whereas comparisons with other miRNAs were not carried out. [score:5]
Inhibiting miR-21 suppresses TNF -induced proliferation and migration in fibroblasts and VSMCs. [score:5]
Macrophage depletion suppressed miR-21 expression in transplanted vessels. [score:5]
Given the pivotal role of proliferation and migration of medial SMCs in the development of transplant vasculopathy [3– 5, 7], and the well documented detrimental effects of miR-21 in pathological vascular remo deling [19, 27, 29, 30, 37, 38], we suggest that the observed beneficial effects of macrophage depletion in aortic allografts are, at least in part, due to reduced miR-21 expression in vascular mural cells. [score:4]
Consistent with our present results, Wei et al. have demonstrated that nuclear factor-kB, the direct downstream effector of TNF-α, can promote miR-21 expression in cardiomyocytes under oxidative stress [44]. [score:4]
In particular, we selected miR-21 as a target to prove this concept, because miR-21 has been shown to have crucial effects in the pathogenesis of neointima formation in angioplastic and vein graft mo dels [19, 27– 30]. [score:3]
There is evidence that macrophages also express miR-21 [35, 36], and macrophage depletion reduces the abundance of macrophages in the aortic wall. [score:3]
Macrophage stimulates miR-21 expression in vascular mural cells via a paracrine mechanism. [score:3]
Next we stimulated VSMCs with TNF-α, which significantly increased the expressions of MCP-1, VCAM-1 and ICAM-1; we demonstrated that pretreatment with miR-21 antagomir significantly attenuated TNF -induced inflammatory responses (Figure 5B). [score:3]
Then we demonstrated that macrophage depletion with clodronate significantly reduced the expression levels of miR-21 in the medial and adventitial layers of transplanted vessels (Figure 2C). [score:3]
Macrophage stimulates miR-21 expression in cultured vascular mural cells via a paracrine mechanism. [score:3]
To clarify whether the expression of miR-21 was associated with transplantation -induced arterial remo deling, and whether the level of miR-21 was affected by macrophage depletion, we measured miR-21 expression using qPCR. [score:3]
Figure 4(A) Conditioned medium (CM) from both unstimulated and LPS-pretreated macrophages (LPS-CM) stimulated miR-21 expression in vascular smooth muscle cells (VSMCs) and primary adventitial fibroblasts. [score:3]
In addition, we have provided in vivo evidence showing that macrophage depletion reduces the expression level of miR-21, while blocking miR-21 functions mimics the effects of macrophage depletion on neointima formation and vascular inflammation, further supporting the above argument. [score:3]
We found that miR-21 mimic significantly increased the expression of MCP-1, but not VCAM-1 or ICAM-1 (Figure 5C). [score:3]
We showed that there were time -dependent increases in miR-21 expression in both media and adventitia from day 3 (Figure 2A). [score:3]
Therefore, the vascular protective effects following miR-21 targeting reported in previous studies as well as in the present study are likely to be mediated mainly through its effects in vascular mural cells but not macrophages [19, 27, 29, 30, 38]. [score:3]
However, expressions of these inflammatory molecules stimulated by TNF-α were all attenuated by miR-21 antagomir (Figure 5D). [score:3]
Since miR-21 was reported to be expressed by many types of cells including fibroblasts, SMCs and macrophages, we thus tested the tunica media and adventitia independently. [score:3]
These data support that adventitial macrophages may enhance mural cell miR-21 expression via a paracrine mechanism. [score:3]
In either VSMCs or fibroblasts, miR-21 antagomir showed no effects on the expression level of C-C motif ligand 5 (CCL5) (Figure 5B and 5D). [score:3]
Moreover, we observed that miR-21 inhibition also reduced the abundance of proliferating (PCNA [+]) cells in both of the tunica media and adventitia (Figure 3C). [score:3]
For in vivo treatment with miR-21 antagomir, 50 μL of 20% (w/v) chilled F-127 pluronic gel (from Sigma-Aldrich, Shanghai, China) containing 20 μM of the antagomir (synthesized by GenePharma, Shanghai, China) or equivalent non -targeting control sequence was applied over the allograft aorta, and allowed to solidify at the body temperature. [score:3]
Specifically, using miR-21 as an example of vascular enriched miRNA [19, 27, 29, 30], we have identified that macrophages may promote miR-21 expression in VSMCs and adventitial fibroblasts via the liberation of TNF-α. [score:3]
As compared to vessels treated with a non -targeting control sequence, vessels treated with miR-21 antagomir exhibited a significant reduction in the thickness of neointima (Figure 3B). [score:2]
Because miR-21 was shown to be wi dely expressed in different cells, we performed PCR assays in medial and adventitial samples separately. [score:2]
To test how macrophage depletion affected miR-21 expression, we performed qPCR analysis using miRCURY LNA Universal cDNA Synthesis Kit and miR-21-specific primers (all from Exiqon, Vedbaek, Denmark) as described previously [50]. [score:2]
We demonstrated that TNF-α enhanced proliferation and migration of both VSMCs and adventitial fibroblasts, which were attenuated by miR-21 antagomir (Figure 6A to 6B). [score:1]
We have shown that miR-21 antagomir partially blocks the stimulating effects of TNF-a on these responses, supporting that miR-21 is a functional downstream effector of TNF-α in stimulating VSMC proliferation and migration. [score:1]
Moreover, our data confirm that miR-21 produces similar stimulating effects in adventitial fibroblasts, which may contribute to neointima formation in parallel with SMCs [39, 40]. [score:1]
Constructs of miR-21 mimic and miR-21 antagomir, and corresponding scrambled controls, were purchased from Genepharma (Shanghai, China). [score:1]
Figure 3Effects of a miR-21 antagomir (miR-21i) on neointima formation in vivo(A) Silencing efficiency of the miR-21 antagomir validated in cultured fibroblasts using qPCR. [score:1]
MiR-21 antagomir ameliorates neointimal hyperplasia in vivo. [score:1]
Another novel finding in the present study is that miR-21, in addition to its actions on mural cell proliferation and migration, also exerts pro-inflammatory effects in vascular cells, especially in the presence of TNF-α. [score:1]
We also performed fluorescent staining of endothelial cells using DyLight 594-labeled Lycopersicon lectin (from Vector Laboratories, Burlingame, CA, USA) in aortic cross-sections, and found that clodronate liposome or miR-21 antagomir had no obvious effect on the integrity of the endothelial layer (Supplementary Figure II). [score:1]
Figure 6(A) Effects of miR-21 antagomir (miR-21i) on serum -driven cell proliferation in the absence and presence of TNF-a (T). [score:1]
The silencing efficiency of the miR-21 antagomir was validated with qPCR in cultured fibroblasts (Figure 3A). [score:1]
Immuno-staining for MCP-1, VCAM-1, and ICAM-1 demonstrated that miR-21 antagomir significantly reduced the inflammatory response in tunica media and adventitia of the allograft (Figure 3D). [score:1]
Representative images showing the role of miR-21 in mediating TNF-stimulated migration in VSMCs and fibroblasts were shown in Figure 6E. [score:1]
Effects of a miR-21 antagomir (miR-21i) on neointima formation in vivo. [score:1]
In this respect, previous studies in non-vascular cells have yielded varying results, suggesting that miR-21 has both pro-inflammatory and anti-inflammatory actions depending on the type of cells [41]. [score:1]
These data together indicate that miR-21 overall has a pro-inflammatory role in vascular cells, particularly in the presence of TNF-α. [score:1]
The effects of miR-21 antagomir alone were minor. [score:1]
Figure 5Role of miR-21 in mediating inflammatory responses in smooth muscle (A and B) and adventitial fibroblasts (C and D). [score:1]
To exclude the possibility that the reduction in miR-21 expression in the aorta after clodronate treatment was primarily a consequence of macrophage removal from the aortic wall, we independently measured miR-21 levels in the media and adventitia. [score:1]
Conversely, we transfected VSMCs and fibroblasts with miR-21 mimic, and showed that miR-21 mimic significantly increased the proliferation and migration of both cells (Figure 6C to 6D). [score:1]
Role of miR-21 in inflammatory responses in VSMCs and fibroblasts. [score:1]
To address this question, we treated VSMCs with a miR-21 mimic, and measured the expressions of various inflammatory molecules. [score:1]
Although TGF-β and VEGF also significantly elevated the level of miR-21, their effects were much smaller than that of TNF-α. [score:1]
In contrast to its pro-inflammatory effects in vascular cells, most evidence indicates that miR-21 has an anti-inflammatory role in macrophages [35, 36]. [score:1]
[1 to 20 of 60 sentences]
16
[+] score: 164
We observed that approximately 1/10 of the recently identified 578 miRNAs are highly expressed in the mouse heart; SRF overexpression in the mouse heart resulted in altered expression of a number of miRNAs, including the down-regulation of mir-1 and mir-133a, and up-regulation of mir-21, which are usually dysregulated in cardiac hypertrophy and congestive heart failure [3, 13- 16]. [score:14]
In conclusion, our current study demonstrates that cardiac-specific overexpression of SRF leads to altered expression of cardiac miRNAs, especially the down-regulation of miR-1 and miR-133a, and up-regulation of miR-21, the dysregulation of which is known to contribute to cardiac hypertrophy. [score:12]
Real-time RT-PCR analysis revealed that mildly reduced SRF resulted in the down-regulation of miR-21 expression, but up-regulation of both miR-1 and miR-133a (Figure 5A). [score:9]
As shown in Figures 8B and Figure 9, miR-21 expression upregulated ANF promoter activity, while it repressed cardiac actin expression. [score:8]
Similarly, when pri-mir-21, pri-mir-199a, and pri-mir-381 primary transcripts were up-regulated, their mature miRNA forms were up-regulated as well (Figure 6). [score:7]
The up-regulation of miR-21, and the down-regulation of miR-1 and miR-133a were observed in SRF-Tg compared to wild-type (WT) mouse heart (P < 0.01**, n = 3). [score:6]
Interestingly, the down-regulation of miR-21, but up-regulation of miR-1 and mir-133a were observed in Anti-SRF-Tg compared to wild-type mouse heart (p < 0.01**, n = 3). [score:6]
Reducing cardiac SRF level using the antisense-SRF transgenic approach led to the expression of miR-1, miR-133a and miR-21 in the opposite direction to that of SRF overexpression. [score:6]
The mir-21 microRNA up-regulates ANF expression. [score:6]
Our findings demonstrate for the first time that it is possible to regulate at the same time the expression of three miRNAs, miR-1, miR-133a and miR-21, through targeting the components of SRF -mediated signaling pathway. [score:6]
In vivo, the silencing of miR-21 by a specific "antagomir" in a mouse pressure-overload -induced disease mo del was reported to reduce cardiac ERK-MAP kinase activity, inhibit interstitial fibrosis and attenuate cardiac dysfunction [16]. [score:5]
Figure 9 The mir-21 microRNA represses cardiac actin expression, but SRF and its cofactors activate cardiac actin expression. [score:5]
When the mouse cardiac SRF level was reduced using the antisense-SRF transgenic approach, we observed an increase in expression of miR-1 and miR-133a miRNA, and a decrease in expression of miR-21. [score:5]
To examine the effect of increased miR-21 microRNA level on cardiac gene expression, a mir-21 expression vector containing mir-21 DNA sequence was generated using pSilencer4.1 vector. [score:5]
The down-regulation of miR-1 correlates closely with that of miR-133a in SRF-Tg at various time points from 7 days to 6 months of age (p < 0.05, n = 3 for all time points, except n = 6 for miR-21 at 6 months). [score:4]
These data indicate that the regulation of mir-21 gene expression is complex, and involves SRF in coordination with multiple SRF cofactors, including myocardin, p49/Strap and Zipzap. [score:4]
The expression levels of miR-1, miR-133a and miR-21 were observed to be in the opposite direction with reduced cardiac SRF level in the Anti-SRF-Tg mouse. [score:4]
4. SRF regulates mir-21 expression. [score:4]
P49/Strap (p49), SRF isoform Δ3, SRF, Zipzap (zip) and Nkx2.5 all down-regulated the ANF gene promoter activity that was induced by mir-21 microRNA (p < 0.05, n = 3). [score:4]
The microRNA mir-21 up-regulated ANF gene promoter (p < 0.05*, n = 3). [score:4]
In the failing heart, miR-21 levels are increased in fibroblasts where it inhibits sprouty homologue 1 (Spry1) and promotes fibrosis [16]. [score:3]
However, miR-21 was decreased in Anti-SRF-Tg heart compared to that of the wild-type mouse heart (Figure 5A), indicating that miR-21 expression is regulated by the SRF protein. [score:3]
Mir-21 is known to be up-regulated in many forms of cancer as well as in the heart during cardiac hypertrophic growth and heart failure [37- 40]. [score:3]
It has been reported that TGF-β and BMP signaling promote a rapid increase in the expression of mature miR-21 at the post-transcriptional level through accelerating the process of pri-miR-21 into precursor miR-21 (pre-miR-21) by the DROSHA complex [41]. [score:3]
The pSilencer4.1-mir-21 expression vector was cotransfected with ANF promoter and cardiac actin promoter plasmid vectors, respectively. [score:3]
Transfection of several other genes up-regulated the cardiac actin gene compared with mir-21 alone: p49/Strap (p49), Zipzap (Zip), SRF-Δ3 isoform (Δ3), SRF, Nkx2.5, GATA-4, respectively (P < 0.05*, n = 3). [score:3]
The fact that a "knock-down" of SRF level could decrease the mir-21 level provides an opportunity for future studies manipulating mir-21 level through the SRF -mediated signaling pathway. [score:2]
The mir-21 microRNA repressed cardiac actin gene expression compared with control (P < 0.05*, n = 3). [score:2]
To test whether the mir-21 promoter would respond to the regulation of SRF and SRF cofactors in vitro, a mir-21 promoter-luciferase construct was generated, which contains a 0.58 kb DNA fragment of mir-21 promoter (Figure 7B). [score:2]
The length of three representative primary transcripts: pri-mir-21 is over 3 kb, "pri-mir-1-1 and pri-mir-133a2" is 10 kb, and "pri-mir-1-2 and pri-mir-133a1" is 6 kb. [score:1]
The human, rat and mouse mir-21 promoter region is relatively conserved, as is the classic SRF binding site (Figure 7A). [score:1]
Mir-21 is one of the miRNAs that was significantly increased in the SRF-Tg heart, but was decreased in the anti-SRF-Tg heart. [score:1]
pri-mir-21 forward: 5'-ccagagatgtttgctttgctt-3', pri-mir-21 reverse: 5'-tgccatgagattcaacagtca-3'. [score:1]
The mir-21 promoter was strongly activated by myocardin, but the activation induced by myocardin was repressed by p49/Strap at various concentrations (Figure 8A). [score:1]
Myocardin (MYOCD) strongly activated the mir-21 promoter activity (p < 0.05). [score:1]
Mir-21 promoter is regulated by SRF and its cofactors, myocardin and p49/Strap. [score:1]
A CArG motif is 197 bp upstream of mir-21 primary transcript. [score:1]
The mouse mir-21 gene sequence corresponding to pri-mir-21 and its promoter region. [score:1]
The mir-21 pri-miRNA sequence was obtained from GenBank sequence AY699265 and also from the sequence reported by Fujita et al. [28]. [score:1]
Generally, the pri-miRNA transcript contains one miRNA (e. g pri-mir-21), but it can also contain more than one miRNAs (e. g. mir-1 and mir-133a). [score:1]
Analysis of the mir-21 promoter region revealed that the mir-21 gene has a classic SRF binding site or CArG element that is composed of "CCTAATAAGG", which is found to be 197 bp upstream of the pri-mir-21 transcript start point (Figure 7A and 7B). [score:1]
The DNA sequence of mir-21 promoter region was conserved among mouse, rat and human, and a consensus CArG motif was found in the promoter of all three species. [score:1]
As shown in Figure 8A, the mir-21 gene promoter was repressed by SRF and p49/Strap alone. [score:1]
p49 also repressed mir-21-luciferase reporter activity induced by myocardin in a dose -dependent manner (p < 0.01 **, n = 3). [score:1]
Figure 7 The promoter region of the mir-21 gene. [score:1]
[1 to 20 of 45 sentences]
17
[+] score: 161
When treated with CGA in miR-21 up-regulated or down-regulated LX2 cells, the TGF-β1/Smad7 signaling pathway in LX2 cells was significantly inhibited. [score:9]
After treatment with CGA, the mRNA levels of miR-21, CTGF, α-SMA, TIMP-1, and TGF-β1 and the protein expression of p-Smad2, p-Smad3, p-Smad2/3, CTGF, α-SMA, TIMP-1 and TGF-β1 were inhibited, and the mRNA expression of Smad7 and MMP-9 and the protein expression of Smad7 and MMP-9 were elevated. [score:9]
Phosphorylated Smad2 and Smad3 then form a complex that translocates to the nucleus and regulates the expression of miR-21, which then prevents Smad7 from regulating Smad2/3 activation through negative feedback by interfering with the target gene of miR-21 and Smad7 (Inagaki and Okazaki, 2007). [score:7]
Meanwhile, TGF-β1 could activate TGF-β1/Smad7 signaling pathway no matter miR-21 was up-regulated or down-regulated in LX2 cells. [score:7]
To knockdown miR-21 expression, the specific sequence of hsa-miR-21-3p -inhibition (16129-1) was 5′-TCGAGAAAAAACAGCCCATCGACTGGTGTTGTTTTTC-3′, and the reference sequence was 5′-TTCTCCGAACGTGTCACGT-3′. [score:6]
However, compared with the normal group, after miR-21 overexpression, the mRNA expression of miR-21 and CTGF increased, and the mRNA expression of Smad7 decreased (P < 0.01, Figure 4B). [score:6]
There was a dose -dependent increase and time -dependent change in the protein expression of CTGF and in the mRNA expression of miR-21 and CTGF in LX2 cells treated with TGF-β1 (Figure 2). [score:5]
Chlorogenic acid exerts the ability to suppress liver fibrosis through regulation of the miR-21-regulated TGF-β1/Smad7 signaling pathway in vivo and in vitro (Figure 11), which suggests that CGA may be an attractive anti-liver fibrosis agent. [score:5]
We have determined that CGA has an anti-liver fibrosis effect on schistosome-infected mice by suppressing the IL-13/miR-21/Smad7 signaling interactions (Wang et al., 2017) and has an anti-inflammatory effect through the suppression of the TLR2/TLR9-Myd88 signaling pathways (Guo et al., 2015a). [score:5]
However, compared with the normal group, after miR-21 knockdown, the mRNA expression of miR-21 and CTGF decreased, and the mRNA expression of Smad7 increased (P < 0.01, Figure 6B). [score:5]
The development of many diseases, including liver fibrosis, is caused by dysregulation of miR-21 (Png et al., 2011). [score:5]
Effect of CGA on the miR-21-Regulated TGF-β1/Smad7 Signaling Pathway in LX2 Cells after miR-21 Overexpression. [score:4]
Based on the above studies, we guessed that miR-21 could regulate the development of hepatic fibrosis in LX2 cells, and we up- or down-regulated miR-21 by lentiviral transfection to investigate the effect and specific mechanism of CGA. [score:4]
Lentivirus-Mediated miR-21 Overexpression or Knockdown. [score:4]
However, whether CGA can inhibit liver fibrosis through the miR-21-regulated TGF-β1/Smad7 signaling pathway has not been studied. [score:4]
The medium was replaced 12 h later, and then the cells continued to be incubated for 72 h. overexpression and knockdown of miR-21 was confirmed by Real-time PCR analysis. [score:4]
The same result was shown for the mRNA expression of miR-21 and CTGF. [score:3]
FIGURE 11The illustration of CGA protecting against liver fibrosis in vitro and in vivo by regulating miR-21-regulated TGF-β1/Smad7 signaling pathway. [score:3]
FIGURE 5Effects of CGA on the TGF-β1/miR-21/Smad7 signaling pathway in LX2 cells after TGF-β1 overexpression. [score:3]
Therefore, interfering with the miR-21-regulated TGF-β1/Smad7 signaling pathway may be another effective method to block the development of liver fibrosis. [score:3]
As shown in Figures 2E,F, TGF-β1 treatment at 10 ng/ml for 6 h significantly increased the mRNA expression of miR-21 and CTGF (P < 0.01), so we chose TGF-β1 treatment at 10 ng/ml for 6 h for subsequent experiments. [score:3]
The miR-21 in LX2 cells was overexpressed with the lentiviral vector for 72 h, and then, the cells were treated with a series of concentrations of CGA (20 μg/ml, 40 μg/ml, and 80 μg/ml) for 24 h. TGF-β1 was added to the LX2 cells for the last 6 h before harvest. [score:3]
Verification of Downstream Signaling Molecules in LX2 Cells after miR-21 Overexpression. [score:3]
Meanwhile, to confirm the transduction efficiency, the mRNA expression of miR-21, Smad7 and CTGF, and the protein levels of p-Smad2, p-Smad3, p-Smad2/3, CTGF, Smad7, α-SMA, TIMP-1 and MMP-9 were detected at 72h after transfection (Figures 4B,C). [score:3]
In this signaling pathway, microRNA-21 (miR-21) positively regulates the production of collagen via Smad2/3 phosphorylation and is negatively regulated by Smad7 (Wells, 2000; Ikushima and Miyazono, 2012). [score:3]
Effect of CGA on the miR-21-Regulated TGF-β1/Smad7 Signaling Pathway in LX2 Cells after TGF-β1 Knockdown. [score:3]
To over-express the miR-21 gene, GV273-miR-21/NC-EGFP was transfected into the 293 T cell line. [score:3]
FIGURE 2TGF-β1 increases miR-21 and CTGF expression in a dose -dependent manner and decreases it in a time -dependent manner. [score:3]
FIGURE 4Verification of downstream signaling molecules in LX2 cells after miR-21 overexpression. [score:3]
TGF-β1 Induces miR-21 and CTGF Expression in LX2 Cells. [score:3]
In this study, we found that the mRNA levels of miR-21, CTGF, α-SMA, TIMP-1 and TGF-β1 and the protein expression of p-Smad2, p-Smad3, p-Smad2/3, CTGF, TIMP-1, α-SMA, and TGF-β1 in the experimental group were significantly increased compared with that in the normal group, and the mRNA levels of Smad7 and MMP-9 and the protein expression of Smad7 and MMP-9 in the experimental group were significantly decreased compared with those in the normal group. [score:3]
A high expression of miR-21 has been found in many fibrotic tissues, including the rat liver and human liver (Marquez et al., 2010; Wei et al., 2013). [score:3]
Meanwhile, to confirm the transduction efficiency, the mRNA expression of miR-21, Smad7 and CTGF, and the protein levels of p-Smad2, p-Smad3, p-Smad2/3, CTGF, Smad7, α-SMA, TIMP-1 and MMP-9 were detected at 72h after transfection (Figure 6B,C). [score:3]
The miR-21 in LX2 cells was knocked-down with a lentiviral vector for 72 h, and then, the cells were treated with a series of concentrations of CGA (20 μg/ml, 40 μg/ml, and 80 μg/ml) for 24 h. TGF-β1 was added to the LX2 cells for the last 6 h before harvest. [score:2]
FIGURE 7Effects of CGA on the TGF-β1/miR-21/Smad7 signaling pathway in LX2 cells after TGF-β1 knockdown. [score:2]
Verification of Downstream Signaling Molecules in LX2 Cells after miR-21 Knockdown. [score:2]
FIGURE 6Verification of downstream signaling molecules in LX2 cells after miR-21 knockdown. [score:2]
Effect of CGA on the miR-21-Regulated TGF-β1/Smad7 Signaling Pathway in LX2 Cells after TGF-β1 Stimulation. [score:2]
FIGURE 3Effects of CGA on the TGF-β1/miR-21/Smad7 signaling pathway in LX2 cells after TGF-β1 stimulation. [score:1]
FIGURE 10Effect of CGA on the TGF-β1/miR-21/Smad7 signaling pathway in CCl4 -induced rats. [score:1]
We investigated the expression of downstream signaling molecules after transfecting LX2 cells in vitro with the miR-21 lentiviral vector GV369. [score:1]
The miR-21 and negative control lentiviral vectors were synthesized by Gene Chem Co. [score:1]
We investigated the expression of downstream signaling molecules after transfecting LX2 cells in vitro with the miR-21 lentiviral vector GV273. [score:1]
Effect of Corilagin on miR-21/smad7/ERK signal pathway in schistosomiasis -induced hepatic fibrosis in mouse mo del. [score:1]
Anti-Schistosomiasis liver fibrosis effects of chlorogenic acid through IL-13/miR-21/Smad7 signaling interactions in vivo and in vitro. [score:1]
Previous studies have shown that liver fibrosis is involved in the regulation of the deposition of ECM by a complex network of signaling pathways, and we have investigated CGA could regulate liver firbosis through IL-13/miR-21/Smad7 signaling way. [score:1]
We observed that there was no difference between the normal and lentivirus-NC group (lentivirus negative control group) in the mRNA levels of miR-21, Smad7 and CTGF (Figure 6B, P > 0.05) and the protein levels of p-Smad2, p-Smad3, p-Smad2/3, CTGF, Smad7, α-SMA, TIMP-1 and MMP-9 (Figure 6C). [score:1]
GV369-miR-21/NC-EGFP was transfected into the 293T cell line, and the viral supernatant was collected after 48 h (5 × 10 [8] TU/ml). [score:1]
We observed that there was no difference in the mRNA levels of miR-21, Smad7 and CTGF (P > 0.05, Figure 4B) and the protein levels of p-Smad2, p-Smad3, p-Smad2/3, CTGF, Smad7, α-SMA, TIMP-1 and MMP-9 between the normal and lentivirus-NC group (lentivirus negative control group) (P > 0.05, Figure 4C). [score:1]
[1 to 20 of 49 sentences]
18
[+] score: 159
Moreover, the pLVX-miR-21-BMSC group showed enhanced expression of Bcl-2, VEGF and Cx43 and reduced expression of Bax, BNP and troponin T. These findings suggest miR-21 overexpression enhanced the proliferation, invasiveness and differentiation of BMSCs as well as expression of key factors (Bcl-2, VEGF and Bax) essential for repairing the cardiac damage induced by anthracyclines and restoring heart function. [score:9]
MiR-21 is an oncogenic miRNA that is over-expressed in many solid tumors and shown to down-regulate tumor suppressors, such as phosphatase and tensin homolog (PTEN), B-cell lymphoma-2 (bcl-2) and tropomyosin l (TPM1) [14– 16]. [score:8]
Our study similarly demonstrated that miR-21 -overexpressing BMSCs showed enhanced expression of Bcl-2, VEGF and Cx43 and reduced expression of Bax, BNP and troponinT. [score:7]
However, the intrinsic role of miR-21 on cardiac damage is unclear and further studies are necessary to better understand its functional role during cardiac damage in response to anthracycline In conclusion, our study demonstrates that miR-21 overexpression enhances the proliferation, invasiveness and differentiation of the BMSCs apart from efficiently regulating key factors that are essential in inhibiting apoptosis of cardiomyocytes and repairing the cardiac damage induced by anthracyclines. [score:6]
Figure 7 (A) MiR-21 expression detected by qRT-PCR; (B) Expression of Bcl-2, Bax and VEGF detected by qRT-PCR; (C) Expression of Bcl-2, Bax and VEGF detected by; (D) Relative expression of Bcl-2, Bax and VEGF detected by; Note: * denotes P < 0.05, compared with the negative control group; [#] denotes P < 0.05, compared with the adriamycin treatment group; [&] denotes P < 0.05, compared with the BMSCs and the pLVX-BMSC group; qRT-PCR, quantitative real-time polymerase chain reaction. [score:5]
These results showed that miR-21 overexpression promoted most efficient expression of relevant factors that was necessary for recovery from myocardial damage. [score:5]
Therefore, our study showed that the miR21 overexpressing BMSCs efficiently regulated key factors that were essential in repairing the myocardial injury. [score:4]
The pLVX-miR-21-BMSC group demonstrated highest Bcl-2 and VEGF expression and least Bax expression compared to the other groups (P < 0.05; Figure 7). [score:4]
MiR-21 expression, mRNA expressions of B cell lymphoma 2 (Bcl2), BAX (BCL-2 -associated X protein) and vascular endothelial growth factor (VEGF) were tested by qRT-PCR. [score:4]
Expressions of Cx43, troponin T and BNP among five groups of rats (negative control, adriamycin treatment only, BMSC, pLVX-BMSC and pLVX-miR-21-BMSC). [score:3]
Our study demonstrates that miR-21 overexpression contributes to enhanced invasion and proliferation of BMSCs, thereby significantly enhancing their ability to repair myocardial injury by anthracyclines. [score:3]
Expression of miR-21, VEGF, Bcl-2 and Bax among five groups of rats (negative control, adriamycin treatment only, BMSC, pLVX-BMSC and pLVX-miR-21-BMSC). [score:3]
To further analyze if the miR-21 overexpressing BMSCs were efficient in repairing myocardial injury, we analyzed the H&E stained myocardial tissue sections from the different treatment groups. [score:3]
Therefore, the results demonstrated that miR-21 over -expression promoted proliferation of BMSCs. [score:3]
The miR-21 expression was least in the adriamycin group and highest in the pLVX-miR-21-BMSC group (P < 0.05). [score:3]
We tested the expression of miR-21 in the transfected BMSCs by qRT-PCR. [score:3]
However, in comparison to the adriamycin treatment only group, we observed elevated Cx43 expressions and reduced troponin T and BNP levels in the BMSCs, pLVX-BMSC and pLVX-miR-21-BMSC groups (P < 0.05; Figure 8). [score:3]
Our data also demonstrated that the miR-21 over -expressing BMSCs enhanced cardiac function, reduced scar area and promoted significant angiogenesis. [score:3]
Lentivirus infection and over -expression of miR-21 in rat BMSCs. [score:3]
To understand the molecular details regarding repair from myocardial injury, we analyzed the the expression of miR21, VEGF, Bcl-2 and Bax by qRT-PCR. [score:3]
Trohatou and colleagues showed that miR-21 modulated Sox2 expression in the MSCs contributed to their proliferation and differentiation [32]. [score:3]
At this point, the BMSCs were divided into three groups (in triplicate), namely, BMSC only (no transfection), BMSC plus empty pLVX (transfected with empty plasmid) and BMSC plus pLVX-miR-21 (transfected with miR-21 over -expression plasmid). [score:3]
Our data showed that whereas miR-21 expression significantly decreased in the adriamycin treatment only, the BMSCs and the pLVX-BMSC groups, it was significantly higher in the pLVX-miR-21-BMSC group (P < 0.05). [score:3]
This indicated that miR-21 overexpression enhanced the migration of BMSCs. [score:3]
Further, since miR21 overexpressing BMSCs effectively eliminated scars, which involve change of appearance and histopathology of normal skin, miR-21 may be beneficial in future clinical treatment of skin scars [34]. [score:3]
The miR-21 expression in BMSC, pLVX-BMSC and pLVX-miR-21-BMSC groups. [score:3]
Using CCK- 8 and transwell assays, we found that pLVX-miR-21-BMSCs, which overexpressed miR-21, exhibited greater proliferation and migration than untransfected BMSCs or pLVX-BMSCs. [score:2]
We observed that miR-21 expression was highest in the pLVX-miR-21-BMSCs compared to BMSCs alone and pLVX-BMSCs (P < 0.05; Figure 2). [score:2]
Further, the Cx43 channels are essential for electrical coupling and direct cardiac cell to cell communication that ensures heart function and are involved in adaptation of the heart to irradiation -induced injury in co-ordination with miR-21 [43]. [score:2]
Mir-21 overexpressing BMSCs improve heart function in myocardial injury mo del rats. [score:2]
Mir-21 overexpressing BMSC group demonstrates enhanced Bcl-2 and VEGF and decreased Bax levels. [score:2]
Previous studies showed that miR-21 had a key role in the development and progression of human cancers [23– 25]. [score:2]
MiR-21 overexpression promotes BMSC proliferation of BMSCs. [score:2]
Mir-21 overexpressing BMSCs induce significant angiogenesis during myocardial recovery from injury. [score:2]
MiR-21 overexpressing BMSCs are most efficient in restoring myocardial function following adriamycin injury. [score:2]
MiR-21 overexpressing BMSCs show elevated Cx43 and reduced troponin T and BNP levels. [score:2]
MiR-21 overexpression enhances migration of rat BMSCs as determined by. [score:2]
A lentivirus harboring pLVX-miR-21 was generated and transfected into rat BMSCs. [score:1]
The positive clones were then verified by extracting the plasmid DNA from positive clones followed by PCR amplification of miR21 and sequencing (Invitrogen, Shanghai, China). [score:1]
These data therefore indicated that adriamycin induced significant myocardial tissue injury that was repaired by the BMSCs, of which the pLVX-miR-21-BMSC group showed the most significant recovery showing the beneficial effects of miR-21. [score:1]
In the pLVX-miR-21-BMSC group that demonstrated most angiogenesis, regular patterned arrangement between the survived myocardial cells and the transplanted cells was observed (Figure 6). [score:1]
Further, the pLVX-miR-21-BMSC group demonstrated maximal recovery among the three groups (Figure 5). [score:1]
Comparing BMSC proliferation by between BMSC, pLVX-BMSC and pLVX-miR-21-BMSC groups. [score:1]
These results showed that myocardial tissue in miR-21 -modified BMSC group with high Cx43 and low troponin T and BNP levels recovered most efficiently than the other groups. [score:1]
Further, Wang and colleagues showed that exosomal miR-21 enhanced the cardio-protection properties of human MSCs [41]. [score:1]
H&E stained myocardial tissue of rats post recovery among the five groups (Negative control, adriamycin treatment only, BMSC, pLVX-BMSC and pLVX-miR-21-BMSC; x 200). [score:1]
Therefore, in this study, we investigated the role of miR-21 -overexpressing BMSCs in repairing anthracycline -induced cardiac damage. [score:1]
The blue spots point to the BMSCs that migrated to the lower chamber in transwell; ruler 200μm; (B) Total number of cells counted per field in BMSC, pLVX-BMSC and pLVX-miR-21-BMSC groups. [score:1]
Immunohostochemical analysis of Factor VIII demonstrating angiogenesis density in the five groups of rats (negative control, adriamycin treatment only, BMSC, pLVX-BMSC and pLVX-miR-21-BMSC groups). [score:1]
We investigated the ability of bone marrow derived mesenchymal stem cells (BMSCs) overexpressing microRNA-21 (miR-21) to repair cardiac damage induced by anthracyclines in rats. [score:1]
In the BMSC, pLVX-BMSC and pLVX-miR-21-BMSC groups, significantly higher angiogenesis was observed in the damaged area of myocardial tissue (Figure 6). [score:1]
Next, we assessed the effect of miR-21 on BMSC proliferation by the. [score:1]
We observed that the EF, FS, LVEDD and LVESD values for heart function in the negative control group were higher than the other four groups (adriamycin treatment only, BMSC, pLVX-BMSC and pLVX-miR-21-BMSC) before transfection (P < 0.05; Table 1). [score:1]
Further, the pLVX-miR-21-BMSC group had highest Cx43 and least troponin T and BNP among the groups levels among adriamycin treatment only, the BMSCs, pLVX-BMSC and pLVX-miR-21-BMSC groups (P < 0.05; Figure 8). [score:1]
Ultrasonic cardiograms and immunohistochemical analysis demonstrated that among the five groups, the pLVX-miR-21-BMSC group exhibited the most improved heart function and enhanced angiogenesis. [score:1]
Then, miR-21 with flanking sequences was PCR amplified as follows: The amplified miR-21 PCR fragment was then recombined into empty vector pLVX-shRNA2 (Laboratory of Molecular Biology, Shandong University, China). [score:1]
García and co-workers confirmed that miR-21 participated in pressure overload -associated myocardial remo deling [40]. [score:1]
Figure 3 (A) was used to compare the migration of BMSC, pLVX-BMSC and pLVX-miR-21-BMSC groups. [score:1]
* denotes P < 0.05 comparing BMSC, pLVX-BMSC and pLVX-miR-21-BMSC groups. [score:1]
Previously, miR-21 was instrumental in angiogenic mediation of ischemic milieu and orchestration of the therapeutic potential of human multipotent cardiovascular progenitors [36]. [score:1]
Nevertheless, the role of miR-21 in anthracycline -induced cardiac injury is unknown. [score:1]
The rats were assigned into an untreated negative control group, and groups injected with adriamycin alone or with adriamycin followed by BMSCs, pLVX-BMSCs or pLVX-miR-21-BMSCs (n = 10 each). [score:1]
Finally, the miR-21 (pLVX- miR-21) lentivirus was re-suspended in cold phosphate buffer saline (PBS). [score:1]
To generate the lentivirus, recombinant plasmid DNA containing miR21 was packaged into 293T cells (Laboratory of Molecular Biology of Shandong University, Shandon, China) using the calcium phosphate method. [score:1]
The rats in the adriamycin, BMSC, pLVX-BMSC and pLVX-miR-21-BMSC groups were intraperitoneally injected seven times with 2mg/kg adriamycin once in two days whereas the control group rats were injected with the same amount of normal saline. [score:1]
This analysis demonstrated that pLVX-miR-21 had successfully infected the BMSCs and was ready for further experiments (Figure 2). [score:1]
Further, the DH5α competent cells (Solarbio, Shanghai, China) were transformed with the recombinant vector containing miR-21 followed by selection of recombinant clones. [score:1]
In addition, miR-21 was associated with cellular proliferation, migration and apoptosis [17]. [score:1]
Recently, miR-21 was implicated in protecting the ischemic myocardium from apoptosis, which was important in the early stages of acute myocardial infarction [33]. [score:1]
The BMSC, pLVX-BMSC and pLVX-miR-21-BMSC group rats were administrated with BMSCs, pLVX-BMSC and pLVX-miR-21-BMSC by intraperitoneal injection, respectively, whereas the control and adriamycin group rats were injected with same amount of normal saline and continually fed for 4 weeks. [score:1]
A total of 50 SPF grade 4 week old male SD rats (Laboratory of Molecular Biology of Shandong University, Shandong, China) that weighed 100-110g were divided into five groups: negative control group, the adriamycin group, the BMSC group, pLVX-BMSC group and the pLVX-miR-21-BMSC group. [score:1]
[1 to 20 of 71 sentences]
19
[+] score: 157
Recently, miR-21, which is upregulated in a variety of diseases, was reported to be upregulated in blood and T cells of RA patients [10, 11]. [score:9]
Moreover, Li et al. found that inhibition of miR-21 could significantly decrease NF- κB activity and that overexpression of miR-21 could reverse NF- κB activity inhibition and apoptosis induced by resveratrol in glioma cells [14]. [score:7]
miR-21, the most commonly upregulated miRNA in various cancers, is upregulated in blood and T cells of patients with RA [10, 11]. [score:7]
Furthermore, after treatment with the NF- κB nuclear translocation inhibitor BAY 11-7082, the pro-miR-21 -induced NF- κB nuclear translocation was significantly inhibited; FLS proliferation was also inhibited. [score:7]
Moreover, we explored the effects of downregulation or overexpression of miR-21 on nucleoprotein NF- κB levels and FLS viability. [score:6]
miR-21 expression was quantified using the Q-PCR System (Foster City, California, United States) to verify regulation of the miR-21 targets. [score:6]
In addition, the proliferation of RA-FLS was significantly inhibited when the cells were infected with lentivirus encoding anti-miR-21 to inhibit the miR-21 levels. [score:5]
In addition, the overexpression of miR-21 induced an increase in the nucleoprotein NF- κB levels and FLS proliferation rate, while miR-21 inhibition resulted in decreased nucleoprotein NF- κB levels and reduced cell viability of FLS. [score:5]
Similarly, inhibition of miR-21 expression levels significantly decreased NF- κB nuclear translocation, suggesting that miR-21 may have a stimulating effect on NF- κB nuclear translocation. [score:5]
The target miR-21 expression was normalized to U6. [score:5]
miR-21 has been reported to play a large role in the development of some human diseases and cancers, such as lupus [23] and lung fibrosis [24]. [score:4]
In this study, we found that miR-21 and the nucleoprotein NF- κB were upregulated in FLS of RA mo del rats. [score:4]
The highlights of this study are as follows:miR-21 and nucleoprotein NF- κB levels were upregulated in FLS in a rat mo del of RA. [score:4]
Effect of miR-21 Inhibition on Nucleoprotein NF- κB Level and FLS Proliferation Rate. [score:3]
The effects of miR-21 overexpression were reversed by BAY 11-7082. [score:3]
Thus, it would be interesting to explore whether miR-21 expression could affect NF- κB activity in FLS and to elucidate the underlying mechanisms involved in RA pathogenesis. [score:3]
They reported that miR-21 might be directly regulated by the transcription factor NF- κB. [score:3]
Moreover, the FLS proliferation rate was obviously facilitated when normal FLS were treated with pro-miR-21 to cause miR-21 overexpression. [score:3]
miR-21 overexpression in normal FLS led to increased nucleoprotein NF- κB levels and cell viability. [score:3]
In this study, we found that the expression levels of miR-21 in FLS from RA mo del rats were higher than normal FLS using Q-PCR detection. [score:3]
Hence, our data suggested that altered expression of miR-21 may play a crucial role in FLS proliferation in RA progression. [score:3]
In this regard, overexpression of miR-21 may promote NF- κB nuclear translocation. [score:3]
Interestingly, our results showed that overexpression of miR-21 resulted in higher nucleoprotein NF- κB levels. [score:3]
Because NF- κB and miR-21 levels were significantly upregulated in RA-FLS, we considered the possibility that NF- κB and miR-21 were connected in some way, which was supported by the study of Shin et al. [30]. [score:3]
Quantitative real-time PCR (Q-PCR) analysis was performed to determine the miR-21 expression level in the transduced cells. [score:3]
In accordance with this idea, we carried out the miR-21 overexpression and inhibition experiments and investigated the effect on nucleoprotein NF- κB levels and FLS proliferation rate. [score:3]
Compared with the anti-NC group, the inhibition of miR-21 expression led to a reduction in miR-21 and nucleoprotein NF- κB levels as determined by western blotting analysis and Q-PCR assay, respectively (Figures 2(a) and 2(b)). [score:3]
The cells were then transduced with anti-miR-21 or pro-miR-21 at a multiplicity of infection (MOI) of 20 and then were allowed to recover in complete fresh medium for an additional 24 h. Because the lentiviral vectors express green fluorescent protein (GFP), the infection efficiency was assessed by GFP fluorescence microscopy at 72 h after infection. [score:3]
Inhibition of miR-21 levels in RA-FLS reduced the nucleoprotein NF- κB level and FLS proliferation rate. [score:3]
Quantification of miR-21 Expression. [score:3]
The cells were treated with pro-miR-21, anti-miR-21, anti-NC, and/or inhibitor of NF- κB (BAY 11-7082, purchased from Calbiochem, USA) and were lysed to extract the nucleoproteins. [score:3]
Effect of miR-21 Overexpression on Nucleoprotein NF- κB Levels and FLS Proliferation Rate. [score:3]
To elucidate the involvement of NF- κB mediated by miR-21, we pretreated the FLS with BAY 11-7082, a compound known to inhibit NF- κB nuclear translocation. [score:3]
As shown in Figure 3(a), the miR-21 level as determined by Q-PCR was upregulated in cells transfected with pro-miR-21 (4.02 ± 0.25) compared to cells transfected with pro-NC (1.00 ± 0.14) (P < 0.05). [score:3]
Effect of miR-21 Inhibition on Nucleoprotein NF- κB Level and FLS Proliferation RateTo explore the effects of the lower miR-21 level, the RA-FLS were infected with anti-miR-21 or anti-NC packaged lentiviruses. [score:3]
Furthermore, in the presence of BAY 11-7082, the levels of nucleoprotein NF- κB in the pro-miR-21+BAY 11-7082 group (0.30 ± 0.12) were significantly inhibited compared to the group treated only with pro-miR-21 (0.94 ± 0.23) (P < 0.05) (Figure 3(d)). [score:2]
Dong et al. demonstrated that miR-21 might contribute to the imbalance of Th17 and Treg cells [9]. [score:1]
However, there are few studies of the linkage between NF- κB and miR-21 in RA FLS. [score:1]
With regard to tissue remo deling, Thum et al. reported that miR-21 could stimulate MAP kinase signaling in fibroblasts and cause cardiac fibroblast survival and cardiac remo deling [25]. [score:1]
The packaged lentiviruses were named pro-miR-21 and anti-miR-21. [score:1]
Effect of miR-21 Overexpression on Nucleoprotein NF- κB Levels and FLS Proliferation RateTo measure the effect of the increased miR-21 level, the normal FLS were infected with pro-miR-21 or pro-NC packaged lentiviruses. [score:1]
To compare the nucleoprotein NF- κB and miR-21 levels between FLS in the RA and normal control groups, we examined the levels of nucleoprotein NF- κB and miR-21 in primary cells using western blotting and Q-PCR methods, respectively. [score:1]
Similarly, the results of Q-PCR showed that the levels of miR-21 in the RA group (5.09 ± 1.04) were significantly higher than in the normal group (1.00 ± 0.32) (P < 0.05) (Figure 1(b)). [score:1]
A significant difference was observed between the cells with anti-miR-21 treatment at 12 h (0.38 ± 0.04), 24 h (0.23 ± 0.01), or 48 h (0.18 ± 0.02) and cells treated with anti-NC at 12 h (0.55 ± 0.03), 24 h (0.63 ± 0.05), or 48 h (0.67 ± 0.06) (P < 0.05). [score:1]
Taken together, we suggested that miR-21 might promote FLS proliferation via facilitating NF- κB nuclear translocation. [score:1]
To explore the effects of the lower miR-21 level, the RA-FLS were infected with anti-miR-21 or anti-NC packaged lentiviruses. [score:1]
Previous studies have suggested that miR-21 could play an essential role in modulating cell proliferation [26, 27]. [score:1]
Determination of Nucleoprotein NF- κB and miR-21 Levels in FLS of RA and Normal Control Groups. [score:1]
Determination of Nucleoprotein NF- κB and miR-21 Levels in FLS of RA and Normal Control GroupsTo compare the nucleoprotein NF- κB and miR-21 levels between FLS in the RA and normal control groups, we examined the levels of nucleoprotein NF- κB and miR-21 in primary cells using western blotting and Q-PCR methods, respectively. [score:1]
The cell viability in the group with pro-miR-21 treatment at 12 h (0.54 ± 0.03), 24 h (0.57 ± 0.01), or 48 h (0.63 ± 0.03) was different from the pro-NC group at 12 h (0.52 ± 0.03), 24 h (0.54 ± 0.05), or 48 h (0.56 ± 0.01). [score:1]
In conclusion, our study demonstrated that miR-21 might promote NF- κB nuclear translocation and NF- κB signaling pathway activation, thus accelerating FLS proliferation, which plays a central role in RA progression. [score:1]
[1 to 20 of 51 sentences]
20
[+] score: 150
The persistent upregulation of miR-21 expression may serve to maintain the intrinsic growth capacity of the injured neuron for the long period of time required for axons to regenerate the considerable distance to reinnervate peripheral targets. [score:8]
Taken together the and luciferase reporter assay data indicate that miR-21 binds directly in the 3′ UTR of both mouse and rat SPRY2 mRNA transcripts, and consequently downregulates SPRY2 protein expression in DRG neurons. [score:6]
Furthermore, co-localisation experiments demonstrated that miR-21 was detected in large diameter neurons expressing neurofilament 200kD (NF200) as well as small and medium diameter neurons expressing Calcitonin gene-related peptide (CGRP, Fig. 2E). [score:5]
It is also unlikely that SPRY2 is the sole target of miR-21 in DRG neurons and further identification of functional miR-21 targets in DRG neurons will allow us to elucidate other yet unidentified pathways by which miR-21 can promote axonal regeneration. [score:5]
miR-21 targets SPRY2 expression. [score:5]
The timing of IL6/pSTAT3 expression in the DRG correlates well with increased miR-21 levels and future experiments will determine that this is indeed the mechanism by which miR-21 expression is activated by nerve injury. [score:5]
Analysis of miR-21 neuronal profiles indicated that increased miR-21 expression occurred in neurons of all sizes, with 29.0 ± 4.1%, 40.5 ± 4.2% and 29.6 ± 2.6% of all miR-21 expressing neurons found to be in small (<30 µm), medium (30–40 µm) and large (>40 µm) diameter neurons respectively (Fig. 2D). [score:5]
To show that miR-21 directly targeted SPRY2 we cloned the 3′ UTR of mouse and rat Spry2 downstream of a luciferase reporter. [score:4]
Studies have shown that miR-21 regulates PTEN tumour suppressor in hepatocellular cancer cells [40] and SPRY2 in cardiomyocytes [41]. [score:4]
Indeed miR-21 was observed to be upregulated in the DRG at 6 months after injury in a sciatic nerve denervation mo del [34]. [score:4]
In situ hybridisation studies confirmed that the upregulation of miR-21 occurred in rat DRG neurons at 7 days post-injury (Fig. 2C). [score:4]
miR-21 is a commonly dysregulated miRNA in many forms of cancer and cardiovascular disease (reviewed in [24], [33]) however its function in the nervous system has not been examined. [score:4]
We sought to determine if miR-21 knocked down Sprouty 2 (SPRY2) or phosphatase and tensin homolog (PTEN) tumour suppressor protein levels in mature DRG neurons. [score:4]
miR-21 upregulation in the DRG following sciatic nerve injury. [score:4]
Here we show that an axotomy-regulated miRNA, miR-21, promotes neurite growth from injured adult DRG neurons by targeting the Sprouty2 protein. [score:4]
Activation of miR-21 expression is possibly mediated through IL-6/STAT3 response elements present in the miR-21 gene [35]. [score:3]
In order to determine the effects of miR-21 on neuronal growth, we overexpressed miR-21 in dissociated adult rat DRG neurons that were plated on a reduced laminin substrate (0.1 µg/ml). [score:3]
Construction and preparation of lentiviral vector overexpressing miR-21 and Spry2. [score:3]
0023423.g002 Figure 2(a) Relative miR-21 expression in mouse and rat DRG at 7 days following axotomy. [score:3]
These data demonstrate that overexpression of miR-21 promoted outgrowth in adult rat DRG neurons by increasing neurite extension. [score:3]
In the presence of miR-21-insensitive SPRY2, the growth promoting effects of miR-21 in DRG neurons were abolished, indicating that SPRY2 is an important player in the axonal outgrowth response following miR-21 overexpression. [score:3]
Increased miR-21 levels enhanced neurite outgrowth from DRG neurons by targeting the SPRY2 protein, suggesting that axotomy -induced miR-21 plays a role in promoting axonal regeneration following peripheral nerve injury. [score:3]
org) indicated that miR-21 has a high energy binding site in both the mouse and rat Spry2 3′ untranslated region (UTR), at 1520–1536 bp and 1430–1449 bp respectively. [score:3]
miR-21 expression was normalised to that of the U6B small nuclear RNA gene (RNU6B). [score:3]
Unfortunately we were unable to detect a statistically significant change in pERK1/2 levels in miR-21 overexpressing DRG neurons and further work will be required to determine if pERK signalling is indeed involved in mediating the neurite outgrowth response caused by miR-21. [score:3]
Expression of miR-21 was normalised to that of the U6B small nuclear RNA gene (RNU6B). [score:3]
Cultured DRG neurons transduced with lentiviral vectors expressing GFP, miR-21 or a control miRNA miR-376b. [score:3]
Increased miR-21 levels in these neurons were achieved by transduction with GFP-tagged lentiviral vectors that were verified for mature miR-21 overexpression using real-time PCR analysis (Fig. S1). [score:3]
In contrast miR-21 overexpressing neurons showed a significant increase in neurite outgrowth (Fig. 3A). [score:3]
Figure S1 Lentiviral vector overexpressing miR-21. [score:3]
miR-21 targets SPRY2 protein. [score:3]
As described previously miR-21 overexpressing neurons demonstrated a significant increase in the mean length of the longest neurite and mean total neurite length (per neuron) compared to GFP controls (236 ± 16.5 µm vs 161 ± 12.8 µm and 476 ± 36.7 µm vs 301 ± 24.0 µm respectively; p<0.001, Fig. 4D). [score:2]
In DRG neurons, we observed miR-21 -induced knockdown of SPRY2 but not PTEN. [score:2]
Our study demonstrates that miR-21 transcripts are physiologically regulated by peripheral nerve injury. [score:2]
Interestingly in the same paper, miR-21 also exhibited significant increased expression in rat synaptosomes compared to whole forebrain extract [19]. [score:2]
The transcript for miR-21 was PCR purified from mouse genomic DNA and inserted under the control of the CMV promoter in lentiviral vector transfer plasmid (illustrated in Fig. S1). [score:1]
Transduction of miR-21 together with SPRY2 abrogated the growth promoting effects of miR-21 in DRG neurons, with the mean length of the longest neurite and mean total neurite length reduced to 168 ± 12.3 µm and 325 ± 24.2 µm respectively; Fig. 4D). [score:1]
We further show that miR-21 enhanced neurite outgrowth in adult rat DRG neurons. [score:1]
miR-21 increases neurite outgrowth from DRG neurons. [score:1]
This, to our knowledge, is the first time a regenerative role for miR-21 in neurons has been demonstrated. [score:1]
In the presence of SPRY2, miR-21 -mediated increase in neurite outgrowth was abolished. [score:1]
For size profiling, 350 miR-21 expressing neurons were measured using ImageJ analysis (http://rsbweb. [score:1]
The sections were then hybridised with a DIG -labelled probe complementary to rat miR-21 (0.5 pmol, LNA miRCURY probe; Exiqon UK) overnight at 50°C. [score:1]
Based on these observations, we postulate that the functional significance of axotomy induced miR-21 levels is to subtly modulate SPRY2 protein levels in order to promote neurite outgrowth from the injured DRG neurons. [score:1]
qRT-PCR analysis also indicated that miR-21 increased significantly as early as 2 days post-injury, which was sustained 28 days post-injury (Fig. 2B). [score:1]
Furthermore, this miR-21 binding site appears to be highly conserved across several species, including the human Spry2 (Fig. 4B). [score:1]
miR-21 increased neurite outgrowth in DRG neurons. [score:1]
miR-21, miR-223, miR-455-5p, miR-431 and miR-18 were significantly increased, while miR-138, miR-483 and miR-383 were significantly decreased following nerve transection. [score:1]
These observed changes were further validated by quantitative real-time reverse transcription PCR (qRT-PCR) and from these candidates we chose to further examine miR-21 (Fig. 1C). [score:1]
The sequences of both precursor and mature forms of miR-21 are extremely well conserved across species, suggesting a fundamental function for miR-21 in physiological processes. [score:1]
Probe sequences are as follows: miR-21 TCAACATCAGTCTGATAAGCTA; scrambled GTGTAACACGTCTATACGCCCA. [score:1]
miR-21 increased the mean length of the longest neurite as well as the mean total neurite length (per neuron). [score:1]
0023423.g003 Figure 3(a) Neurite outgrowth (detected by βIII tubulin in red) observed in GFP or miR-21 transduced DRG neurons (green). [score:1]
0023423.g004 Figure 4(a) to detect SPRY2 and PTEN protein in DRG neurons transduced with GFP, miR-21 or miR-376b (control) lentiviral vectors. [score:1]
We further confirmed that miR-21 directly bound to the SPRY2 3′ UTR region using luciferase reporter assays. [score:1]
The GFP reporter was tagged at the 3′ end of the miR-21 gene. [score:1]
These data demonstrated that SPRY2 is a key player in the neurite outgrowth response mediated by miR-21 in DRG neurons. [score:1]
We showed that miR-21 was significantly increased in the DRG 2 days after axotomy, and that this increase was sustained up to 28 days post-injury. [score:1]
[1 to 20 of 58 sentences]
21
[+] score: 142
These results demonstrated that both miR-21-3p and miR-433 can regulate FSHb expression by directly binding to the FSHb 3′UTR and inhibiting the FSHb expression levels through the degradation of mRNA and inhibition of translation. [score:13]
In our study, we found that the up-regulation of miR-21-3p inhibits FSHb expression and leads to decrease of FSH levels, whereas the down-regulation of miR-21-3p results in stimulating FSH secretion. [score:11]
To determine the transfection efficiency achieved with a 100 nM concentration of the negative controls, mimics, inhibitor negative controls and inhibitors of miR-21-3p and miR-433, we measured the expression levels of the two miRNAs, and the results showed that transfection of the miR-21-3p mimic significantly increased the expression level of miR-21-3p, whereas transfection of the miR-21-3p inhibitor significantly decreased the expression level of miR-21-3p (Figure 4E). [score:11]
To examine whether the silencing of FSHb is mediated by the specific, direct interaction of miR-21-3p and miR-433 with the FSHb target site, we predicted the respective target positions of the two miRNAs in the FSHb 3′UTR using the TargetScan program (Figures 3A and 3B), and we then mutated the complementary sites of the two miRNA seed regions to generate pmiR-FSHb-3′UTR-MUT and pmiR-FSHb-3′UTR-MUT1 (Supplementary File 3). [score:8]
Validation of the interaction between the miRNAs and FSHb in vitroTo examine whether the silencing of FSHb is mediated by the specific, direct interaction of miR-21-3p and miR-433 with the FSHb target site, we predicted the respective target positions of the two miRNAs in the FSHb 3′UTR using the TargetScan program (Figures 3A and 3B), and we then mutated the complementary sites of the two miRNA seed regions to generate pmiR-FSHb-3′UTR-MUT and pmiR-FSHb-3′UTR-MUT1 (Supplementary File 3). [score:8]
Transfection with the miR-21-3p mimic resulted in a 0.70-fold decrease (P<0.05) in the expression level of FSHb, whereas transfection with the inhibitor resulted in a 1.40-fold increase (P<0.05) in the expression level of FSHb (Figure 5A). [score:7]
Taken together, our results show that both miR-21-3p and miR-433 down-regulate FSHb expression and cause FSH secretion decreased. [score:6]
We then randomly selected two miRNAs from the set of 13 down-regulated miRNAs (miR-21-3p and miR-433) for subsequent analysis, and the results suggested that miR-21-3p and miR-433 down-regulated FSHb in the sexual maturity stage compared with the non-sexual maturity stage (Figures 2C and 2D). [score:6]
Our results show that miR-21 can regulate the expression levels of FSHb in rat pituitary cells and reveal that miR-21 might participate in the regulation of animal reproduction in addition to the regulation of pituitary adenomas. [score:6]
In 2013, Tushar et al. found that miR-21 targets the SMAD family member 7 (SMAD7) 3′UTR to reduce its expression in hematopoietic cells and plays a role in regulating transforming growth factor-β (TGF-β) signaling [35]. [score:6]
Figure 5 (A-B) Rat anterior pituitary cells were transfected with mimic negative controls (NC), mimics, inhibitor negative controls (I-NC) and inhibitors of miR-21-3p and miR-433. [score:5]
We transfected rat primary anterior pituitary cells with the miR-21-3p negative control, mimic, inhibitor negative control or inhibitor at a concentration of 100 nM and subsequently incubated the cells for 24 h. We then measured the expression levels of FSHb in these four groups. [score:5]
We then used a screening system based on the luciferase reporter plasmid carrying the full-length 3′UTR of the FSHb mRNA and found that 18 miRNAs, specifically miR-433-3p, miR-323-3p, miR-328a-3p, miR-3573-3p, miR-204-5p, miR-206-5p, miR-31a-5p, miR-7a-5p, miR-880-3p, miR-186-5p, miR-503-5p, miR-383-5p, miR-324-5p, miR-505-5p, miR-27b-3p, miR-221-5p, miR-320-3p and miR-21-3p, could suppress the expression of the reporter by more than 30% (Figure 1). [score:5]
Amitava et al. showed that miR-21 functions in the resolution of wound inflammation [36], and the induction of miR-21 is associated with the silencing of phosphatase and tensin homolog on chromosome ten (PTEN) and programmed cell death 4 (PDCD4), which are tumor-suppressor genes targeted by miR-21 [36– 39]. [score:5]
Rat anterior pituitary cells were transfected with the mimic negative controls (NC), mimics, inhibitor negative controls (I-NC) and inhibitors of miR-21-3p and miR-433. [score:5]
Therefore, the results suggested that miR-21-3p and miR-433 can regulate the expression of FSHb. [score:4]
To verify that both miR-21-3p and miR-433 target the FSHb gene and to gain further insights into their regulation of reproduction, we measured the expression levels of FSHb in rat primary anterior pituitary cells by quantitative RT-PCR and the secretion of FSH by these cells through ELISA. [score:4]
miR-21-3p- and miR-433 -mediated regulation of the FSHb expression levels in and FSH secretion by rat primary pituitary cells. [score:4]
In previous studies, the expression of miR-21 was associated with human colorectal, breast, and lung cancers as well as human glioblastoma cell lines [31– 34]. [score:3]
miR-21 belongs to a microRNA family that is highly expressed in many types of mammalian cells [30]. [score:3]
An analysis of pituitary cells revealed that miR-21 is underexpressed (2.4-fold) in ACTH-secreting pituitary adenomas compared with normal pituitary tissues [40]. [score:2]
We introduced site-specific mutations into the pmiR-FSHb-3′UTR-WT plasmid to interrupt the binding sites of miR-21-3p and miR-433, producing the pmiR-FSHb-3′UTR-MUT and pmiR-FSHb-3′UTR-MUT1 plasmids (Supplementary File 3). [score:2]
In addition, miR-433 and miR-21-3p exert the same regulatory effects on FSH secretion. [score:2]
We then cotransfected miR-21-3p mimics and pmiR-FSHb-3′UTR-WT into 293T cells, which led to a ~60% reduction in luciferase activity; interestingly, cotransfection of the miR-21-3p mimics and pmiR-FSHb-3′UTR-MUT into 293T cells yielded no significant changes in luciferase activity (Figure 3C). [score:1]
Effect of miR-21-3p and miR-433 transfection on rat primary pituitary cells. [score:1]
Similar to miR-21, the role of miR-433 in pituitary hormone secretion remains largely unknown due to a lack of relevant studies. [score:1]
For the analysis of miR-21-3p and miR-433, 293T cells were cotransfected with the mimics, negative controls, pmiR-FSHb-3′UTR-WT, pmiR-FSHb-3′UTR-MUT, pmiR-FSHb-3′UTR-MUT1 and pmiR-RB-REPORT [TM]. [score:1]
Figure 4After a 24-h transfection period, the rat primary pituitary cells in the blank group (A), the negative control group (B), the miR-21-3p mimic group (C), and the miR-433 mimic group (D) are shown. [score:1]
To detect the growth of cultured primary pituitary cells after transfection with miR-21-3p and miR-433, we observed the growth of the pituitary cells and noted that they appeared to be in good condition (Figures 4A-4D). [score:1]
Figure 3 In vitro validation of the interaction between the miRNAs and FSHb (A) Sequence alignment of miR-21-3p with the 3′UTR of FSHb from the rat. [score:1]
miR-21-3p and miR-433 were selected for the subsequent experiment. [score:1]
Effect of transfecting rat primary pituitary cells with miR-21-3p and miR-433. [score:1]
Moreover, miR-21 is associated with not only pituitary adenomas but also hormone secretion from normal pituitary cells. [score:1]
After a 24-h transfection period, the rat primary pituitary cells in the blank group (A), the negative control group (B), the miR-21-3p mimic group (C), and the miR-433 mimic group (D) are shown. [score:1]
[1 to 20 of 34 sentences]
22
[+] score: 129
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-34a, rno-mir-34a, mmu-mir-21b, mmu-mir-21c
Furthermore, our study revealed that the global upregulation of miR-21 and downregulation of miR-34a in breast carcinogenesis could be reversed by 3,6-DHF, which significantly upregulated miR-34a expression and decreased miR-21 expression - inducing apoptosis of breast cancer cells in vitro and in vivo. [score:14]
In this study, we revealed the global upregulation of miR-21 expression and downregulation of miR-34a expression at all the three time points after MNU injection, which could be reversed by 3,6-DHF oral administration. [score:11]
The results revealed the global upregulation of miR-21 expression and downregulation of miR-34a expression at all time points in breast carcinogenesis. [score:11]
3,6-DHF significantly upregulated miR-34a expression and decreased miR-21 expression, inducing apoptosis of breast cancer cells in vitro and in vivo. [score:8]
As shown in Figure 3, 3,6-DHF administration could significantly inhibit the upregulation of miR-21 and effectively increase the expression of miR-34a. [score:8]
Detections using quantitative RT-PCR indicated 3,6-DHF treatment significantly upregulated the miR-34a level and decreased miR-21 expression of breast cancer cells in vitro and in vivo (Figure 5B, C). [score:6]
Overexpression of miR-34a induced by plasmid transfection or inhibition of miR-21 by oligonucleotides markedly promoted the pro-apoptotic effect of 3,6-DHF. [score:5]
Furthermore, overexpression of miR-34a induced by plasmid transfection or inhibition of miR-21 by oligonucleotides markedly promoted the pro-apoptotic effect of 3,6-DHF, while inactivation of miR-34a or overproduction of miR-21 compromised the anticancer effects of 3,6-DHF. [score:5]
As an anti-apoptosis factor, aberrantly expressed miR-21 compromises tumor suppressor -mediated apoptosis of cancer cells [6, 7]. [score:5]
Detection of miR-34a and miR-21 expression in breast tumors. [score:3]
In contrary, inhibition of miR-21 by 2'- O-methyl-anti-miR-21 led to a significant increase in 3,6-DHF -induced apoptosis. [score:3]
Figure 3 Expressions of miR-21 and miR-34a in breast carcinogenesis and the influence of 3,6-dihydroxyflavone. [score:3]
To explore the effects of miR-34a and miR-21 in the anticancer activities of 3,6-DHF, we constructed plasmids expressing miR-34a or miR-21, respectively. [score:3]
miR-21, a putative oncogene, is most frequently overexpressed in a variety of malignancies, especially in breast cancer, and it has been shown to be implicated in multiple malignancy-related processes including cell proliferation, apoptosis, invasion, and metastasis [26- 28]. [score:3]
The expression of miR-34a and miR-21 was detected by quantitative RT-PCR as mentioned below. [score:3]
For detection of miR-34a and miR-21 expression, stem-loop RT-PCR was performed as previously described [20, 21]. [score:3]
Quantitative RT-PCR analysis of miR-34a and miR-21 expression. [score:3]
Expression of microRNA-21 (miR-21) and microRNA-34a (miR-34a) in rat breast tissue was detected by quantitative RT-PCR at 0, 4, 8, 18 weeks after 1-methyl-1-nitrosourea injection, respectively. [score:3]
Expression of miR-34a and miR-21 in breast carcinogenesis and the influence of 3,6-dihydroxyflavone. [score:3]
The flavonoid suppressed carcinogenesis and induced apoptosis of breast cancer cells partially through miR-21 and miR-34a association. [score:3]
3,6-DHF: 3,6-dihydroxyflavone; DMEM: Dulbecco's modified Eagle's medium; FITC: fluorescein isothiocyanate; HPLC: high-performance liquid chromatography; JC-1: 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethyl-imidacarbocyanine iodide; miRNA: microRNA; miR-21: microRNA-21; miR-34a: microRNA-34a; MNU: 1-methyl-1-nitrosourea; MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; PBS: phosphate-buffered saline; PCR: polymerase chain reaction; RT: reverse transcriptase; T/ C: median tumor volume of treated animals/median tumor volume of controlled animals; TUNEL: terminal deoxynucleotidyl transferase -mediated dUTP nick end-labeling; UTR: untranslated region; V [t]: tumor volume. [score:3]
To construct plasmids expressing miR-34a and miR-21, the genomic fragment containing miR-34a and miR-21 precursor was amplified from MDA-MB-453 cells and cloned into the pcDNA6.2-GW/EmGFP vector. [score:3]
We detected the expressions of miR-21 and miR-34a in rat breast tissue at 0, 4, 8 and 18 weeks after MNU injection, respectively. [score:3]
Figure 5 Increasing intracellular miR-34a or silencing miR-21 expression promoted 3,6-dihydroxyflavone -induced breast cancer cell cytotoxicity and apoptosis. [score:3]
miR-34a and miR-21 play roles in 3,6-dihydroxyflavone -induced apoptosis in breast cancer cells. [score:1]
Inactivation of miR-34a or overproduction of miR-21 compromised the anticancer effects of 3,6-DHF. [score:1]
TX, tumor xenograft of MDA-MB-231 breast cancer cells; MC, MDA-MB-453 cells transfected with blank plasmids (mock cells); TC [34a], MDA-MB-453 cells transfected with pcDNA6.2-GW/miR-34a; TC [21], MDA-MB-453 cells transfected with pcDNA6.2-GW/miR-21. [score:1]
Transient transfection of these plasmids led to substantial production of mature miR-34a or miR-21 in breast cancer cells (Figure 5B, C). [score:1]
Meanwhile, miR-21 overproduction exerted converse affects, compromising the anticancer effects of the flavonoid (Figure 5D, E). [score:1]
The expression of microRNA-34a (miR-34a) and microRNA-21 (miR-21) was evaluated by real-time quantitative RT-PCR. [score:1]
Furthermore, our study also reveals that miR-34a and miR-21 play roles in MNU -induced breast carcinogenesis and the anticancer mechanism of the flavonoid. [score:1]
However, more studies are needed to define the functional role of miR-21 in breast tumorigenesis. [score:1]
One of these, microRNA-21 (miR-21), is a key player. [score:1]
2'- O-methyl-anti-miR-21 (5'-UCAUACAGCUAGAUAACCAAAGA-3') was chemically synthesized by Genechem (Shanghai, China). [score:1]
These findings indicate that 3,6-DHF is a potent natural chemopreventive agent, and that miR-34a and miR-21 play roles in MNU -induced breast carcinogenesis and the anticancer mechanism of flavonoids. [score:1]
[1 to 20 of 35 sentences]
23
[+] score: 124
Considering that the expression change of miRNAs could reflect these kinds of disorders and the phenotype differentiation could be altered by some specific miRNAs expressed at high level in MSCs target tissue-specific regulators, maybe overexpression of mir-21 in MSCs could be the potential targets for clinical intervention. [score:12]
Furthermore, we retrieved the target gene of mir-21 with prediction software on website (Diana Lab, TargetScan, FindTar) and found that SOX-2 may be the target gene of mir-21, which is a negative regulator in Wnt signal pathway. [score:8]
In addition, recent researches have confirmed our prediction that mir-21 can downregulate SOX-2 protein expression by binding to the 3′-UTR of it [41, 42], which may partly explain how mir-21 exerts its biological function in vitro and in vivo. [score:6]
Mineralization was also found to be suppressed as a result of the upregulation of mir-21 [25]. [score:6]
In this study, we found that overexpression of mir-21 significantly increased the expression levels of OPN and ALP at two different time points, which strongly suggested that mir-21 enhanced osteogenic differentiation of rBMSCs in vitro. [score:5]
Therefore, we detected the expression level of mir-21 and SOX-2 three days after osteogenic induction by q-PCR; the result proved our prediction that SOX-2 could be an effective target of mir-21. [score:5]
Besides, the expression level of mir-21 and its potential target SOX-2 were also detected 3 days after osteogenic induction; the results showed that SOX-2 decreased as the increase of mir-21 abundance, indicating that there was a negative correlation between mir-21 and SOX-2 (Figure 1(e)). [score:5]
Besides, upregulation of mir-21 by using mir-21 precursor was demonstrated to be beneficial to osteogenic differentiation of MSCs in vitro and also promoted ectopic bone formation in vivo [21]. [score:4]
The q-PCR result showed that OPN and ALP were both significantly upregulated by mir-21 at day 3 and day 7 in presence of osteogenic induction medium (Figures 1(c) and 1(d)). [score:4]
Previous study has demonstrated that mir-21 is upregulated during the process of osteogenesis differentiation in MSCs [23]. [score:4]
The result showed that mir-21-5p was upregulated about 3 times (Figure 1(d)). [score:4]
To our knowledge, it is the first time to study whether overexpression of mir-21 could enhance bone formation in fracture healing animal mo del, which is the necessary preparation for clinical application. [score:3]
Overexpression of mir-21 in rBMSCs. [score:3]
The rBMSCs stably overexpressed mir-21 and scramble control were harvested with 2.5% trypsin and resuspended into the PBS. [score:3]
In order to confirm the effect of mir-21 on osteogenic differentiation of rBMSCs, we also detected the expression level of some osteogenesis-related gene markers, such as OPN, Runx2, Osterix, and ALP. [score:3]
In conclusion, we have demonstrated that overexpression of mir-21 could improve osteogenesis in rBMSCs and accelerate rats fracture healing in a closed femur fracture mo del. [score:3]
The results from the current study showed that overexpression of mir-21 could accelerate the formation of calcium nodule during osteogenesis differentiation, which is a functional marker of mineralization [35]. [score:3]
mir-21 was found highly expressed during osteogenic differentiation, which indicated that mir-21 may possibly repress stemness maintenance in osteoblasts [19]. [score:3]
Most importantly, this study expands our previous understanding on the osteogenic functions of mir-21, suggesting that it could be a potential therapeutic target for fracture healing. [score:3]
However, opposite research results pointed that overexpression of mir-21 was related to the osteoclastogenesis [22], adipogenesis [23], and osteolysis [24]. [score:3]
The quantitative result of Alizarin Red showed that overexpression of mir-21 could remarkably increase calcium nodule formation compared with the control group (Figure 1(b)). [score:2]
Considering that the microenvironment of fracture site is more sophisticated than that of in vitro, the osteogenic regulation of mir-21 needs to be confirmed before it could be applied in clinical setting. [score:2]
As far as we know, most of the researches related to mir-21 in osteogenesis were carried out in vitro, while very little information was given about its regulation function in vivo, especially in fracture healing process. [score:2]
The conflict results illustrated that the regulation of mir-21 was complicated. [score:2]
Numerous studies characterize mir-21 function in relation to its target(s) during skeletal disorders, such as osteoporosis [32], osteoarthritis [33], and osteosarcoma [34]. [score:1]
Representative sections from 2 groups stained with HE and Safranin O were shown in Figure 3. Much more chondrocytes could be detected in the control group than mir-21 group, which means that the newly formed chondrocytes have not been mineralized completely in control. [score:1]
Bone remo deling, which is recognized as the last stage of fracture healing, was found to take place vigorously in mir-21-MSCs treatment group. [score:1]
Quantitative RT-PCR for mir-21. [score:1]
Taken together, these results suggested that mir-21-MSCs intervention could significantly accelerate bone fracture healing in the mo del of SD rats in vivo. [score:1]
In order to determine whether mir-21 transfected rBMSCs could accelerate bone fracture healing, closed femur fractures were created in 8-week-old SD rats. [score:1]
To generate pLL3.7-pre-mir-21, the oligonucleotides encoding pre-mir-21 were amplified and cloned into the XhoI site of pLL3.7 under the control of U6 promoter. [score:1]
One of the most studied microRNAs, mir-21, is recognized as a versatile miRNA which is involved in lots of biological processes, including osteogenesis [20]. [score:1]
All the animals were randomly and equally assigned into 2 groups after the surgery: mir-21 treatment groups and control groups. [score:1]
Moreover, most of our knowledge about the function of mir-21 in osteogenesis still stays at the level of in vitro study. [score:1]
The results showed a significant improvement in ultimate load and the energy to failure in mir-21-MSCs group after being normalized with the contra-lateral intact femur (Figure 4). [score:1]
The data before the normalization were shown in Table 1. The result indicated that fracture healing was better in toughness after mir-21-MSCs intervention, with the same stiffness recovery. [score:1]
It is encouraging that our results which indicated elevation of mir-21 in rBMSCs showed a positive effect on fracture healing in vivo. [score:1]
mir-21-MSCs or Con-MSCs were injected locally at 4 days after fracture. [score:1]
To testify the effect of mir-21 on osteogenesis of rBMSCs in vitro, Alizarin Red S staining was performed at day 14 after mir-21 transfection (Figure 1(a)). [score:1]
As the level of mir-21-5p was more abundant than mir-21-3p, so we detected the level of mir-21-5p by q-PCR after lentivirus infection. [score:1]
3.1. mir-21 Promoted Mineralization of rBMSCs. [score:1]
In addition, we quantified the healing quality of cicatrized bone by mechanical test and found that elevation of mir-21 in rBMSCs demonstrated a better result in mechanical properties, including ultimate load and energy to failure. [score:1]
Amplification conditions were as follows: first at 95°C for 5 min and then 40 cycles of 95°C for 15 s and 60°C for 60 s. To analyze the expression level of mir-21, a total reaction volume of 20  μL contained 10  μL SYBR Mix, 5.6  μL RNase-free water, 1  μL mir-21 primer, 1  μL universal adaptor PCR primer, 2  μL cDNA template, and 0.4  μL ROX. [score:1]
At 5 weeks after fracture, the X-ray showed that the gap in the fracture site disappeared in mir-21-MSCs treated group (Figure 2(a)). [score:1]
Besides, the callus width of fractured femurs was much smaller in the mir-21 treatment group than that of control group, meaning that bone remo deling was partially accomplished in mir-21 treatment group. [score:1]
The understanding about mir-21 functions in fracture healing in vivo remains to be unknown. [score:1]
According to the result of micro-CT, we found that mir-21 intervention could increase the new bone formation and mineralization. [score:1]
Therefore, the osteogenic function of mir-21 in regeneration should be researched intensively and comprehensively. [score:1]
In this study we demonstrated the positive role of mir-21 in osteogenesis in fracture healing mo del, which was a paramount promise for clinical application of miRNAs therapy. [score:1]
For mir-21 quantification, U6 was as internal control. [score:1]
[1 to 20 of 50 sentences]
24
[+] score: 115
Overexpression of let-7i or miR-21was capable of inhibiting the expression of TGFBR1 or SMAD7 mRNAs and protein, and inhibition of let-7i or miR-21 promoted the expression of TGFBR1 or SMAD7 mRNA and protein, and inhibited SMAD2 mRNA (p < 0.05) (Figure  5 and Additional file 1: Figure S4 supporting information). [score:13]
Using transient transfection, we up-regulated let-7i and miR-21 by miRNA mimic, or down-regulated let-7i and miR-21 by miRNA inhibitor in the rat lung type II pneumocyte cells. [score:9]
In order to examine whether let-7i, miR-21 may directly regulate TGFBR1 and SMAD7 expression, we overexpressed or inhibited miR-21and let-7i miRNA in the rat lung type II pneumocyte cells, and measured the expression of TGFBR1, SMAD7, SMAD2, SP1 (Specificity Protein 1) mRNA and protein. [score:9]
We performed network analyses using top 10 identified miRNAs (up-regulated: let-7i, let-7c, let-7a, miR-124, miR -145, miR-143, miR-34a, miR-466; down-regulated: miR-21, miR-146b) to predict their potential target transcripts. [score:9]
The cells were co -transfected with a negative control, let-7i and miR-21 mimics or inhibitors, respectively; (A/B) The relative mRNA expression level of the target genes (TGFBR1/TGF-β pathway) of let-7i mimics and inhibitors in cultured rat lung type II pneumocyte cells 48 h after transfection. [score:9]
SMAD7, which is an inhibitory Smad that negatively regulates Smad2 and Smad3 activation, is a negative regulator of TGF-β signaling, and is a predicted target gene of miR-21. [score:7]
Our results showed a negative correlation between the expression of let-7i, miR-21 and TGFBR1, SMAD7, respectively during RILI, which was evident let-7i expressed higher in the early and middle stages over the control, and then expressed lower in late stage. [score:7]
To determine if miR-21 and let-7i were indeed expressed in pulmonary alveolar cells in irradiated lungs, immunohistochemistry was performed along with ISH and demonstrated that miR-21 and let-7i expression were primarily colocalized with that for TTF1 (Thyroid transcription factor1), suggesting that alveolar cells were the main source of the increased miR-21 and let-7i levels present in irradiated lungs. [score:5]
A likely scenario, in the early stage, is that let-7 expressed higher and miR-21 level is lower, which inhibits TGF-β signaling that is necessary for lung regeneration. [score:5]
Taken together, the changes in let-7 and miR-21 expression level create an unopposed profibrotic balance in RILI development. [score:4]
MiR-21 was expressed in the cytoplasm of most alveolar cells and to a lesser extent expressed in the cytoplasm of fibroblast/myofibroblast cells in lung tissue (Additional file 1: Figure S3B supporting information). [score:4]
Based on the miRNA-mRNA profiling integration analysis, miR-21, let-7i expression were negatively associated with TGF-β signaling genes such as SMAD7, TGFBR1, suggesting that these miRNAs could regulate the TGF-β signaling in RILI. [score:4]
C: microRNAs miR-466b and miR-21 were up regulated; miR-146b was down regulated 26 weeks post-irradiation vs. [score:3]
Regulation of TGFBR1 by let-7 and SMAD7 by miR-21, which was suggested by our results, may further fine-tune the TGF-β signaling activity to the necessary level at each RILI developmental stage. [score:3]
To confirm the microarray results, qRT-PCR was performed on two randomly selected differentially expressed miRNAs (let-7i and miR-21). [score:3]
Reciprocal expression of TTF1 and let-7i, miR-21. [score:3]
In this study, the expressions of let-7i and miR-21 were altered in RILI lungs. [score:3]
However, miR-21 expressed higher at each time point (Figure  4C/D). [score:3]
Whereas in the late stage, let-7 expressed at a relatively low level and miR-21 level is higher, which may allow an enhanced TGF-β signaling activity that is necessary for lung fibrosis. [score:3]
A: microRNA let-7i was up regulated; miR-146b and miR-21 were down regulated 3 weeks post-irradiation vs. [score:3]
B: microRNAs let-7i, let-7a, let-7c, miR-34a, miR-124, miR-145, and miR-143 were up regulated; miR-21 was down regulated 12 weeks post-irradiation vs. [score:3]
To determine the cell type-specific localization of miR-21 and let-7i, fluorescence -based in situ hybridization (ISH) was conducted on formalin-fixed, paraffin-embedded (FFPE) tissues sections of rat lungs using LNA (Locked Nucleic Acid) anti-miR-21, anti-let-7i and scrambled control probes. [score:1]
For miRNA RT-qPCR (let-7i and mir-21), experiments were carried out with the miScript Reverse Transcription and SYBR Green PCR Kit (Qiagen) according to manufacturer’s instruction. [score:1]
To further test whether the functional pathways associated to the identified miRNAs could be reproduced experimentally in vitro, we performed validation experiments testing miRNAs involved in the TGF-β signaling pathway (miR-21/SMAD7, let-7i/TGFBR1). [score:1]
[1 to 20 of 24 sentences]
25
[+] score: 109
miR-21 targets several factors responsible for cell growth and invasion suppression, cell cycle arrest, MMP and other protease inhibition, control of angiogenesis, cellular branching and migration, with a variety of regulatory feedback loops [62]. [score:8]
Interestingly, our revealed a net overexpression of miR-21 in BO lesions: it was primarily expressed in fibroblasts and in activated epithelial cells in all human BOS cases and in rat grafts, while it was completely absent in normal human and rat lungs, thus clearly demonstrating upregulation in BO. [score:8]
Human CTR(1) ACUTE REJECTION(1) BOS(5) miR-34a Bronchial and // BO fibroblasts (+++), alveolar epithelia (++) // Reactive pneumocytes (++), // Bronchial and alveolar epithelia (++) miR-21 Absent // BO fibroblasts (+++), // Reactive pneumocytes (++) Rat CTR(2) ACUTE REJECTION(1) CHRONIC REJECTION(1) miR-34a Bronchial and Bronchial and Reactive pneumocytes (++), alveolar epithelia (++) alveolar epithelia (++), Fibroblasts (++), Inflammatory infiltrates (++) Bronchial and alveolar epithelia (++), Endothelia (++) miR-21 Absent Reactive pneumocytes (+), Reactive pneumocytes (++), Fibroblasts (++), Fibroblasts (+++) Inflammatory infiltrates (+) BO: bronchiolitis obliterans; (+): scarce expression; (++): moderate expression; (+++): strong expression. [score:7]
Their down-regulation has been reported in several cancers in which miR-21 is overexpressed [62]. [score:6]
Specifically, miR-21 was not expressed in normal fibroblasts, while it was modestly expressed in BOS MCs. [score:5]
In rat lungs with chronic rejection, miR-21 expression was similarly observed in BO myofibroblasts (G), while in acute cellular rejection, miR-21 expression was localized in epithelia and in interstitial fibroblasts associated with inflammatory infiltrates (H). [score:5]
As far as miR-21 was concerned, human and rat lungs with chronic bronchiolar rejection showed strong expression in the fibroblasts of bronchiolar lesions (Fig 9E and 9G) and in epithelial cells in remo deled areas, while miR-21 expression was not detectable in either human or animal normal lungs. [score:5]
Finally, miR-21 dysregulation has been demonstrated in bio-fluids [65][66] and anti- miR-21 has been used as targeted therapy in cancer, obtaining promising results both in vitro and in vivo [67, 68]. [score:4]
On the basis of our novel finding and of previous evidence of the role of miR-21 in homeostasis and disease, its contribution to BOS pathogenesis can be inferred to be at the level of myofibroblast migration and proliferation in the airway lumen, while a possible additional regulatory activity in the mechanism of epithelial-mesenchymal transition cannot be excluded. [score:4]
Our preliminary results documented the dysregulated expression of miR-34a and miR-21 in human and rat transplanted lungs with BOS (Table 1). [score:4]
In addition, miR-21 upregulation has been demonstrated in fibroblast foci as well as in the serum of patients with idiopathic pulmonary fibrosis, with a significant correlation between serum levels and the degree of lung function impairment [56]. [score:4]
miR-34a and miR-21 expression in human and rat transplanted lungs. [score:3]
All observations of miR-34a and miR-21 expression were validated with alpha 1-actin and Movat (Fig 9F) connective tissue stains on consecutive sections. [score:3]
0161771.g009 Fig 9 miR-34a and miR-21 expression in human and rat transplanted lungs. [score:3]
Profile and expression analysis of miR-34a and miR-21 in human and rat lung samples: normal lung, human chronic rejection (BOS), acute and chronic rat graft rejection. [score:3]
Targeting miR-21 induces autophagy and chemosensitivity of leukemia cells. [score:3]
In the acute rejection animal mo del, miR-21 was modestly expressed in epithelia and in interstitial fibroblasts associated with inflammatory infiltrates (Fig 9H). [score:3]
Lower panel: miR-21 ISH (E) and Movat pentachrome stains (F) highlighting miR-21 expression in BO myofibroblasts in lung explants from BOS patients. [score:3]
For these reasons, while we did demonstrate miR-34a and miR-21 dysregulation in fibroblasts obliterating the bronchiolar lumen, we cannot provide mechanistic insights into their role in BOS pathogenesis, and these should be addressed in specifically designed studies. [score:2]
P-values obtained from the miRNA targets enrichment analysis for miR-34a and miR-21 paired with all considered pathways. [score:2]
The following miRNAs, also present in the VTMs list of Fig 5, were found by RT-PCR to be dysregulated in mouse lung tissue: miR-21, miR-146, miR-20, miR-302, miR-19, miR-98, let-7a, miR-15a. [score:2]
0161771.g010 Fig 10P-values obtained from the miRNA targets enrichment analysis for miR-34a and miR-21 paired with all considered pathways. [score:2]
In addition to miR-34a and miR-21, other miRNAs have recently been described as being dysregulated in BOS. [score:2]
Since the latter signaling pathway is important in epithelial-mesenchymal transition (EMT), it is reasonable to think that miR-21 plays a role in this process [62]. [score:1]
miR-34a and miR-21 are double-DIG labeled miRCURY LNA®microRNA Detection Probes and have the sequences 5'-ACAACCAGCTAAGACACTGCCA-3', and 5'-TCAACATCAGTCTGATAAGCTA-3' respectively. [score:1]
0161771.g001 Fig 1Two selected miRNAs (i. e., miR-34a and miR-21) obtained from the computational analysis were then validated in wet lab experiments (blue boxes). [score:1]
The factors present in both lists were: let-7a, miR-34a, miR-21 and miR-9 family. [score:1]
Given these premises, we selected miR-34a, the top-ranked miRNA in Fig 5 (VMTs) and miR-21, as candidate miRNAs for ISH analysis. [score:1]
Moreover, hypoxia, which is a well-recognized stimulus for EMT [63], is a potent miR-21 inducer. [score:1]
The mature miR-21 sequence is strongly conserved throughout evolution and is encoded by a single intergenic gene located on the plus strand of chromosome 17q23.2, where it overlaps with the protein-coding gene VMP1. [score:1]
The airway lumen, which can be recognized by the peripheral elastic fibers, is totally occluded by collagen deposition and myofibroblasts (F), which were strongly positive for miR-21 (E, blue staining). [score:1]
Moreover, miR-21 and miR-34a had not yet been described in BOS in previous human studies. [score:1]
Besides its involvement in fibro-proliferative processes in several organs [54][56][57][58][59][60][61], miR-21 has been shown to play an important role in several other physiological and pathological processes [62]. [score:1]
Preliminary validation of the selection of miRNAs was attained both through literature analysis during the computational phase; and by subsequent in situ hybridization experiments on miR-34a and miR-21, two of the resulting candidate miRNAs. [score:1]
Two selected miRNAs (i. e., miR-34a and miR-21) obtained from the computational analysis were then validated in wet lab experiments (blue boxes). [score:1]
ISH for two candidate miRNAs (miR-34a and miR-21) was performed on formalin-fixed/paraffin-embedded samples of normal human and rat lungs, lung explants of BOS patients and rat mo dels of acute and chronic lung rejection (outbred CD SPF/VAF), and on mesenchymal cells obtained from bronchoalveolar lavage (BAL) of lung recipients. [score:1]
The second factor, miR-21 ranked twenty-second in the VMTs list (Fig 5) and fifteenth in the CMTs list (Fig 6). [score:1]
Indeed, an HIF-1alpha binding site is present in the pri- miR-21 promoter [64]. [score:1]
Hybridization with 40nM miR-21 probe, 1nM U6 probe and 20nM scramble probe was carried out at 50°C for 60 min. [score:1]
Literature data in support of role of miR-21 in fibrogenesis are more consistent. [score:1]
We proceeded to validate the analysis of the ranked lists of miRNAs by means of wet lab experiments (ISH) on two highly-ranked miRNAs that appeared in both lists: miR-34a and miR-21. [score:1]
[1 to 20 of 41 sentences]
26
[+] score: 96
The let-7d 27 and miR-29 28 down-regulation, and the miR-21 up-regulation 29 contribute to PF. [score:7]
E-cadherin down-regulation and α-SMA up-regulation were further observed in miR-21 -treated A549 cells, which could be blocked by sulindac effectively. [score:7]
In summary, our results demonstrated that sulindac prevents EMT progression and ameliorates PF by reversing IFN-γ -induced STAT3-related miR-21 expression, which highlightes the mechanism of the sulindac application and provides new targets for PF therapy. [score:5]
The miR-21 -treated A549 cells exhibited morphological changes of EMT, converting from their epithelial phenotype into fibroblastic phenotype, with decreased E-cadherin and increased α-SMA expressions, while sulindac (0.125 mmol/l) reversed the EMT and its marker expression. [score:5]
Interleukin-6, which acts on STAT3 signalling and up-regulates miR-21 in an autocrine manner, reportedly contributes to arsenite -induced EMT 9. The JAK-STAT3 signal pathway is also an important signal transduction pathway that can be activated by different cytokines, such as interferon gamma (IFN-γ) 10. [score:4]
MiR-21, as a STAT3-related factor, contributes to the EMT induced by arsenite 9. The up-regulation of miR-21, also contributes to PF according to previous reports 29, which was supported by our experiments. [score:4]
The above experiments also showed that sulindac reduced miR-21 expression by regulating the STAT3 pathway. [score:4]
These findings showed that sulindac reduces miR-21 expression by regulating the STAT3 pathway. [score:4]
Our results illustrated that miR-21 up-regulation can promote EMT in PF. [score:4]
The increased miR-21 level in BLM -treated lungs sharply decreased upon sulindac treatment compared with the saline control (Fig. 4B), indicating that miR-21 expression may be regulated by sulindac through the STAT3-related signals. [score:3]
Sulindac reduces STAT3 pathway-related miR-21 expression. [score:3]
Next, we found that miR-21 expression also evidently decreased in the sulindac -treated A549 cells and further decreased after AG490 treatment (Fig. 4D). [score:3]
The above results illustrated that sulindac could ameliorate EMT by reducing miR-21 expression. [score:3]
Figure 4Sulindac reduces miR-21 expression. [score:3]
However, the EMT and related factors induced by 2 μg miR-21 can be reversed after miR-21 inhibitor treatment (2 μg ASO-21; Fig. 6A and B). [score:3]
An increased miR-21 expression was also reported to be primarily localized in myofibroblasts, mediating the fibrogenic activation of pulmonary fibroblasts and lung fibrosis 29. [score:3]
The results showed that the miR-21 expression was increased in IFN-γ -treated cells after IFN-γ activated STAT3 (Fig. 4C). [score:3]
Figure 7Sulindac suppressed miR-21 -induced EMT. [score:3]
The effect of miR-21 was inhibited after 2 μg ASO-21 treatment. [score:3]
Our results demonstrated that sulindac reversed the TGF-β1 -induced EMT in A549 cells and ameliorated the BLM -induced PF in rat lungs by blocking STAT3-realted miR-21 expression. [score:3]
Notably, increased miR-21 expression in the BLM -induced PF lungs was found. [score:3]
These results demonstrated that sulindac could reverse EMT by regulating STAT3-related miR-21. [score:2]
A reporter gene assay has demonstrated that miR-21 overexpression is dependent on STAT3 activation 30. [score:2]
In the miRNA experiments, transient (Table S1) transfection of miR-21 was performed with Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen, USA). [score:1]
Our results showed that miR-21 gradually increased in BLM -treated lungs and peaked after 14 days, and was still higher after 28 days than that in untreated or saline -treated (sham) control lungs (Fig. 4A). [score:1]
The morphology of 2 μg miR-21 -treated cells remained fibroblast-like, which was similar to the TGF-β1 -induced cells converted from epithelial phenotype into fibroblastic phenotype. [score:1]
Meanwhile, the morphology also maintained fibroblast-like cells in the 2 μg miR-21 -treated cultures (Fig. 6A). [score:1]
assay confirmed the higher α-SMA expression and the lower E-cadherin level in the 2 μg miR-21 -transfected A549 cells compared with the control treatment, which was similar to the behaviour of the TGF-β1 -treated cells (Fig. 6B). [score:1]
Figure 6Effect of miR-21 on EMT. [score:1]
The morphology in 2 μg miR-21 -treated cells became fibroblast-like cells, which can be reversed by sulindac. [score:1]
Moreover, miR-21 level remarkably decreased in sulindac -treated rat lungs. [score:1]
To further test this proposal, we investigated miR-21 expression in A549 cells treated with sulindac, IFN-γ, or AG490. [score:1]
In addition, the higher miR-21 level induced by IFN-γ was blocked by AG490 treatment (Fig. 4C), indicating that miR-21 is a downstream miRNA in the STAT3 pathway. [score:1]
Therefore, we investigated whether miR-21 expression is affected by sulindac in ameliorating the process of PF through the STAT3-related pathway. [score:1]
We then found that 2 μg miR-21 treatment would evidently promote the process of EMT (Fig. 6A and B). [score:1]
[1 to 20 of 35 sentences]
27
[+] score: 91
Further studies revealed that inhibition of renal fibrosis in CHYS -treated diabetic rats was associated with inhibition of TGF-β1/Smad3 signaling as demonstrated by upregulation of Smad7 but downregulation of TGF-β1, TGF-β receptors, activation of Smad3, and expression of miRNA-21. [score:13]
Blockade of TGF-β/Smad3 -mediated renal fibrosis by downregulating TGF-β1 and microRNA-21 expression, thereby restoring the balance of Smad signaling by upregulating an inhibitory Smad7, resulting in a possible underlying mechanism by which CHYS inhibits diabetic nephropathy associated with fibrosis. [score:13]
In the present study, treatment with CHYS was able to downregulate renal microRNA-21, which may result in upregulation of renal Smad7 through which activation of TGF-β/Smad3 and Smad3 -dependent microRNA-21 expression were inhibited. [score:11]
In situ hybridization revealed that expression of microRNA-21 was significantly upregulated in the diabetic kidney in both glomeruli and tubulointerstitium, presumably by mesangial cells, podocytes, tubular epithelial cells, and interstitial fibroblasts, which were largely inhibited by treatment with CHYS or fosinopril (Figure 6A). [score:8]
Moreover, recent studies also demonstrated TGF-β/Smad3-mediates renal fibrosis by upregulating microRNA-21 in both diabetic and non-diabetic kidney diseases [16]– [18]. [score:6]
CHYS downregulates microRNA-21 expression in the kidney of diabetic rats. [score:6]
During renal fibrosis, microRNA-21 is upregulated in both diabetic and non-diabetic kidney disease [16], [18]. [score:6]
Increasing evidence show that upregulation of microRNA-21 plays a critical role in renal fibrosis including DN [36], [37]. [score:4]
In situ hybridization (A. Magnification×200) and Real-time PCR (B) for microRNA-21 expression. [score:3]
Because it has been reported that microRNA-21 is a downstream of TGF-β/Smad3 and plays a pathogenic role in renal fibrosis in both diabetic and non-diabetic kidney diseases [16], [18]. [score:3]
0090807.g006 Figure 6 In situ hybridization (A. Magnification×200) and Real-time PCR (B) for microRNA-21 expression. [score:3]
We then examined the expression of microRNA-21 in the diabetic kidney treated with or without CHYS or fosinopril. [score:3]
Note that examples of microRNA-21 expression by mesangial cells (opened arrowheads), podocytes (closed arrowheads), tubular epithelail cells (T), and interstitial fibroblasts (arrows) are illustrated in DN panel. [score:3]
It is now clear that microRNA-21 is regulated by TGF-β/Smad3 and acts as a downstream mediator of TGF-β/Smad3 -driven renal fibrosis [16]. [score:2]
5′-digoxigenin (DIG) and 3′-DIG labeled antisense-locked nucleic acid oligonucleotides for hsa-microRNA-21 5′-3′(/5DigN/−TCAACATCAGTCTGATAAGCTA/3 Dig_N/) and U6, hsa/mmu/rno, 5′-3′(GTGTAACACGTCTATACGCCCA) as a negative control were purchased from Exiqon (Vedbaek, Denmark). [score:1]
MicroRNA-21 expression in individual samples was quantified by real-time PCR with the TaqMan MicroRNA Assay (Applied Biosystems, Foster City, CA, USA) as described previously [27]. [score:1]
U6 was used as an internal standard, and the ratio of microRNA-21 was normalized with U6. [score:1]
In Situ Hybridization5′-digoxigenin (DIG) and 3′-DIG labeled antisense-locked nucleic acid oligonucleotides for hsa-microRNA-21 5′-3′(/5DigN/−TCAACATCAGTCTGATAAGCTA/3 Dig_N/) and U6, hsa/mmu/rno, 5′-3′(GTGTAACACGTCTATACGCCCA) as a negative control were purchased from Exiqon (Vedbaek, Denmark). [score:1]
After deparaffinization and deproteinization (15 μg/mL) for 10 minutes at 37°C, slides were dehydrated in gradient ethanol and hybridized with DIG-antisense microRNA-21 probe (30 nM) at 53°C in a 1× hybridization buffer for 1 h. After being washed, slides were blocked and incubated with alkaline phosphatase-conjugated anti-DIG Fab fragments (1∶800; Roche Applied Science, Indianapolis, IN, USA) and visualized for color detection. [score:1]
We have previously shown that Smad3 binds the Smad binding site located in the microRNA-21 promoter and induces pri-microRNA-21 transcription [16]. [score:1]
Thus, microRNA-21 functions in a feed-forward loop that leads to enhanced TGF-β/Smad3 signaling [18], [38]. [score:1]
[1 to 20 of 21 sentences]
28
[+] score: 88
A contusion injury down-regulated expression of miR1, miR124, mi129-2, and up-regulated miR21, 1–7 days after treatment. [score:9]
In contrast, miR21 expression was up-regulated in contused subjects (p [miR21] < 0.001), and there was no change in the expression of miR146a. [score:8]
This overall pattern replicates key components of our earlier study (Strickland et al., 2011), which showed that a contusion injury down-regulates miR1, miR129, and miR124, and up-regulates miR21 and miR146a. [score:7]
A step-wise linear regression analysis revealed that variation in miR124, miR21, and miR146 accounted for a significant proportion of the variation in IGF-1 mRNA expression, and that miR21 and miR124 accounted for variation in BDNF mRNA expression, suggesting that both BDNF and IGF-1 regulation involves a network of miRNAs. [score:6]
BDNF mRNA expression was largely explained by miR21 and miR124 expression (both Fs > 7.57, p < 0.001), which together explained 24.8% of the variance. [score:5]
FIGURE 4 Correlation analyses to assess the relationship between miR146a miRNA expression and expression of miR1, miR21, and miR124 following SCI. [score:5]
As BDNF and IGF-1 can be mRNA targets of miR1, we hypothesized that a statistical relationship would exist between expression changes in miR1 and that of BDNF and IGF-1. Pearson’s product–moment correlations (combining data for dorsal and ventral spinal cord and for day 1 and 7 post-shock) indicated two groups of significant correlations between SCI-sensitive miRNAs, BDNF, and IGF-1. There were significant correlations between BDNF and both miR21 and miR124, and between IGF-1 and miR1, miR124, and miR129-2 (Table 4). [score:5]
Our previous study showed that miR1, miR124, and miR129 were significantly down-regulated following a spinal cord contusion, while miR146a and miR21 were transiently induced (Strickland et al., 2011), and that these miRNAs were sensitive to opioid analgesics like morphine (Strickland et al., 2014). [score:4]
For example, miR124 suppresses activation of resting microglia and macrophages prior to injury, and both miR21 and miR146a have been shown to negatively regulate astrocyte activation following SCI (Ponomarev et al., 2011; Bhalala et al., 2012; Iyer et al., 2012; Willemen et al., 2012; Kynast et al., 2013). [score:4]
FIGURE 1 Bar graphs depicting qRT-PCR analysis of miRNA expression of miR1, miR21, miR124, miR129-2, and miR146a at the lesion site for sham animals and after unshocked or shock treatment in contused animals at 1 h following tailshock treatment. [score:3]
Both miR21 [F [(2,13)] = 15.4, p < 0.0003] and miR146a [F [(2,13)] = 6.2, p < 0.01] were significantly increased following SCI (all post hoc comparisons relative to sham control, p < 0.02), and exposure to intermittent tail shock did not result in further alterations of miRNA expression (Figure 1). [score:3]
FIGURE 3 Bar graphs depicting qRT-PCR analysis of miRNA expression of miR1, miR21, miR124, miR129-2, and miR146a at the lesion site for sham animals and after unshocked or shock treatment in contused animals at 7 days following tailshock treatment. [score:3]
FIGURE 2 Bar graphs depicting qRT-PCR analysis of miRNA expression of miR1, miR21, miR124, miR129-2, and miR146a at the lesion site for sham animals and after unshocked or shock treatment in contused animals at 1 day following tailshock treatment. [score:3]
Contused rats exhibited increased miR21 and miR146a expression 1 h after shock treatment. [score:3]
We found that the contusion injury increased expression of miR21 and miR146a at 1 h relative to the sham control. [score:3]
For example, recent research has shown that another member of the neurotrophin family, nerve growth factor (NGF) induces the expression of miR21, and miR21 in turn promoted NGF -induced neuronal differentiation (Montalban et al., 2014). [score:3]
microRNA-21 regulates astrocytic response following spinal cord injury. [score:2]
For IGF-1, the analyses revealed that miR124, miR21, and miR146a (in that order) each accounted for an independent proportion of the variance (all Fs > 6.36, p < 0.05), and together explained 42.3% of the variance. [score:1]
MiR-21 is an Ngf-modulated microRNA that supports Ngf signaling and regulates neuronal degeneration in PC12 cells. [score:1]
mRNA Primers Forward Reverse BDNF TGGACATATCCATGACCAGAAA CACAATTAAAGCAGCATGCAAT IGF-1 CCGCTGAAGCCTACAAAGTC GGGAGGCTCCTCCTACATTC GAPDH AGTATGTCGTGGAGTCTACTG TGGCAGCACCAGTGGATGCAG miRNA Primers/cat# Target Sequence Sequence reference hsa-miR-1/#204344 UGGAAUGUAAAGAAGUAUGUAU MIMAT0000416 hsa-miR-21-5p/#204230 UAGCUUAUCAGACUGAUGUUGA MIMAT0000076 hsa-miR-124-3p/#204319 UAAGGCACGCGGUGAAUGCC MIMAT0000422 hsa-miR-129-2-3p/# 204026 AAGCCCUUACCCCAAAAAGCAU MIMAT0004605 hsa-miR-146a-5p/# 204688 UGAGAACUGAAUUCCAUGGGUU MIMAT0000449 U6 snRNA/# 203907 All data were analyzed using SPSS software version 18 (SPSS; Chicago, IL, USA). [score:1]
miR1 miR21 miR124 miR129-2 miR146a BDNF mRNA Pearson correlation 0.069 0.332** -0.289* -0.164 0.154 Sig. [score:1]
We previously reported that miR1, miR21, miR124, miR129-2, and miR146a were significantly affected by a spinal cord contusion (Strickland et al., 2011). [score:1]
In the unshocked rats, miR21 remained elevated in the dorsal (at 1 day) and ventral (at 7 days) regions. [score:1]
Pearson’s correlations indicated a significant correlation between miR1 (black diamonds), miR21 (white squares), and miR124 (gray triangles), and miR146a (Pearson’s r = 0.59, P < 0.001, Pearson’s r = 0.69, P < 0.001, and Pearson’s r = 0.39, P < 0.005, respectively). [score:1]
In contused shocked rats, miR21 remained elevated in both the dorsal and ventral region across days (1 and 7). [score:1]
Three main clusters of miRNAs correlate significantly together: miR1 correlates with miR21, miR124, miR129-2, and miR146a, miR124 correlates with miR1, miR129-2, and miR146a, and miR146a correlates with miR1, miR21, and miR124. [score:1]
In combined analysis of data obtained from both dorsal and ventral spinal cord, and at both 1 and 7 days, there were significant correlations between miR1 and miR21, miR124, miR129-2, and miR146a (Figure 4A), between miR124 and miR1, miR129-2, and miR146a, and between miR146a and miR1, miR21, and miR124 (for all Pearson’s rs, p < 0.05, see Table 3; Figure 4B). [score:1]
Post hoc univariate ANOVAs indicated a main effect of time on miR1, miR21, miR124, and miR146a, a main effect of treatment on miR1, miR21, miR124, and miR129-2, and a main effect of spinal region on miR1 and miR146a (all Fs > 9.14, p < 0.005). [score:1]
miR1 miR21 miR124 miR129-2 miR146a miR1 Pearson correlation 0.282* 0.575** 0.349** 0.589** Sig. [score:1]
[1 to 20 of 29 sentences]
29
[+] score: 87
For that reason, rather than selecting the common targets to both algorithms, we chose PicTar algorithm to match upregulated miRNAs (miR-21, miR-98, miR-27a, miR-143, let-7d, miR-126, miR-22) with downregulated putative targets in Ortis et al. and vice versa (Table 4). [score:11]
Eight miRNAs from the PCR-confirmed 11 miRNAs, are common to both in vitro and in vivo inflammation conditions; 7 upregulated (miR-21, miR-98, miR-27a, miR-143, let-7d, miR-126 and miR-22) and one (miR-129) downregulated (Table 3). [score:7]
Using quantitative PCR -based high throughput analysis, we have confirmed upregulation of 7 (miR-21, miR-98, miR-27a, miR-143, let-7d, miR-126, and miR-22) and downregulation of 1 (miR-129) miRNAs out of the 26 activated miRNAs identified in our settings. [score:7]
Our results suggest that overexpression of miR-21 in MIN6 cells could regulate the expression of Pdcd4 and Pclo steady-state mRNA levels. [score:6]
In agreement with our results, cytokines increased miR-21 expression in β-cells, while miR-21 downregulation conferred cytoprotection to islets exposed to IL-1 β in vitro [25]. [score:6]
Overexpression of miR-21 achieved by the addition of a mimic miR-21, but not of an irrelevant mimic miRNA (control), decreased the expression of both Pdcd4 and Pclo mRNAs in MIN6 cells (Figure 1(b)). [score:5]
Downregulation of Pdcd4 by miR-21 has been associated with attenuation of cytotoxic effects of oxidative stress and ischemia-reperfusion in cardiomyocytes [95, 96], decreasing the proinflammatory effects of TLR4 signaling [94], and also preventing type 1 diabetes in rodents [49]. [score:4]
On one hand, during inflammation miR-21 contributes to the impairment of islet cells function by interfering with insulin exocytosis via downregulation of Pclo. [score:4]
Therefore, we could confirm the specificity of miR-21 to induce downregulation of endogenous Pclo in β-cells. [score:4]
On the other hand, miR-21 could reduce cytokine -mediated apoptosis in β-cells via downregulation of Pdcd4. [score:4]
These results suggest that in pancreatic islets miR-21 targets both Pdcd4 and Pclo genes. [score:3]
Overexpression of miR-21 in MIN6 Cells. [score:3]
Furthermore, miR-21 targets the Pclo gene which acts as a Ca [2+] sensor via formation of a cAMP-GEFII(Epac2)-Rim2 complex in PKA-independent cAMP insulin secretion. [score:3]
In vitro treatment of MIN6 cells with cytokines induced the expression of miR-21 (Figure 1(a)). [score:3]
It has been identified as miR-21 target in several systems [84]. [score:3]
Programmed cell death 4(Pdcd4) and Piccolo (Pclo) are miR-21 potential targets (Table 4). [score:3]
Regulation of Endogenous mRNA by miR-21. [score:2]
Therefore, miR-21 has the ability to regulate genes such as Pclo and Pdcd4 that might affect β-cells in conflicting manner. [score:2]
The miR-21: Pclo interaction site has a mismatch in the “seed” region; however, it displays a more extensive base pairing at the 3′ end of the miRNA (Figure 1(c)). [score:1]
Since miR-21 was identified as the most reproducibly induced miRNA in vitro and in vivo, with the highest score “ d” in SAM analysis (Table 3), we focused on this miRNA. [score:1]
Quantification of miR-21 and mRNA was carried out in a 7500 Fast Real-time PCR system, utilizing TaqMan reagents (Applied Biosystems) using (RQ) values. [score:1]
Low plasma levels of miR-21 and miR-126 have been detected in patients with type 2 diabetes [92]. [score:1]
The MIN6 cells were transfected with 200–400 nM mimic miR-21 (Dharmacon) or 200–400 nM irrelevant control using transfection reagent “Dharmafect” following the manufactures instructions. [score:1]
The number of amplification cycles, Ct, is normalized to endogenous control 18S rRNA for the TLDA, and beta-actin and snoRNA135 for mRNA and miR-21 assessments, respectively. [score:1]
Only V2 has an miR-21 recognition site in its 3′UTR. [score:1]
[1 to 20 of 25 sentences]
30
[+] score: 87
Other miRNAs from this paper: rno-mir-146a, rno-mir-155
Expression levels of miR-155 and miR-21 were up-regulated significantly in mo del group than in control group and down-regulated significantly in acupuncture group than in mo del group, and there was no significance between acupuncture and control group. [score:9]
To be specific, expressions of miR-155 and miR-21 were downregulated and miR-146a was upregulated after acupuncture treatment. [score:9]
Previous studies have suggested the involvement of miRNAs in CAG; we further proved that expressions of miR-155 and miR-21 were upregulated and miR-146a was downregulated in gastric tissues of CAG rats. [score:9]
And knockdown of NF- κB by a specific inhibitor could markedly suppress expression of miR-21 [42], which could slow down the process of gastric cancer. [score:8]
Expression levels of miR-155 and miR-21 were upregulated significantly in the mo del group compared to those in the control group and downregulated significantly in the acupuncture group compared to those in the mo del group, and there was no significance between the acupuncture and control group. [score:7]
Similarly, miR-21 was also significantly overexpressed in CAG antrum mucosa [22], which upregulated by activating NF- κB and cyclooxygenase-2/prostaglandin signaling [41, 42]. [score:6]
These results have suggested that miR-155, miR-21, and miR-146a are potential targets of NF- κB, which are involved in an important signaling pathway in CAG [44], and efficacy of acupuncture in treatment of CAG may take effect by modifying expressions of miR-155, miR-21, and miR-146a via NF- κB pathway, thus to alleviate inflammation reaction of gastric mucosa. [score:5]
However, there is no definite conclusion on downstream targets of NF- κB-miR-155/miR-21/miR-146a signaling. [score:3]
Link et al. observed a gradual increase trend of miR-155 and miR-21 expression in preneoplastic gastric mucosa [22], including CAG stage, indicating that miR-155 and miR-21 were essential to persistent inflammation of gastric mucosa. [score:3]
In conclusion, we proposed that acupuncture may exert its therapeutic effects via NF- κB-miR-155/miR-21/miR-146a signaling, including (1) changes of transcription factors (such as NF- κB); (2) changes of miRNAs (miR-155/miR-21/miR-146a); (3) changes of downstream targets (such as TSLP, remaining inconclusive). [score:3]
Additionally, significant improvements of histological changes in CAG rats after altering NF- κB/miR-155/miR-21/miR-146a expression levels are powerful evidence to validate therapeutic roles of NF- κB-miR-155/miR-21/miR-146a signaling in response to acupuncture treatment. [score:3]
Figure S3 showed that acupuncture may exerts its therapeutic effects via NF- κB-miR-155/miR-21/miR-146a signaling, which including (1) changes of transcription factors (such as NF- κB, which evoked by H. pylori infection, physical damage or chemical damage); (2) changes of miRNAs (miR-155/miR-21/miR-146a); (3) changes of downstream targets (such as TSLP, remain inconclusive). [score:3]
What is more, downstream targets of miR-155/miR-21/miR-146a including I-kappa B kinase epsilon, Fas -associated death domain protein [40], and TSLP [43] have been reported. [score:3]
Possible limitations of the study include the fact that exact function of miR-155/miR-21/miR-146a, interaction between NF- κB, miR-155, miR-21, and miR-146a, and existence of NF- κB-miR-155/miR-21/miR-146a signaling and its definite downstream targets in response to acupuncture therapy remain inconclusive, which require further researches in the future work. [score:3]
Previous researches have shown that miR-155, miR-21, and miR-146a were associated with gastritis [22, 24– 26], indicating that miR-155, miR-21, and miR-146a may function as inflammation regulators in CAG. [score:2]
In conclusion, previous researches have indicated that miR-155, miR-21, and miR-146a may function as inflammation regulators in CAG. [score:2]
Fold change (RQ = 2 [−ΔΔCt]) values of miR-155, miR-21, and miR-146a were shown in Table 5. Pearson's test results indicated that there were a positive correlation relationship between miR-155 and miR-21 and negative correlation relationships between miR-146a and miR-155/miR-21, respectively. [score:1]
2 [−ΔCt] Values of miR-155, miR-21, and miR-146a. [score:1]
The abovementioned findings suggested that miR-155, miR-21, and miR-146a were involved in the pathogenesis of CAG and might play an important role in modulation effect of acupuncture in treatment of CAG. [score:1]
2 [−ΔCt] Values of miR-155, miR-21, and miR-146a Table 4 (and Figure S2) showed 2 [−ΔCt] values of miRNAs obtained from different groups. [score:1]
Therefore, our findings implied that acupuncture may act through transcription factors and subsequent epigenetic changes, such as NF- κB-miR-155/miR-21/miR-146a signaling. [score:1]
Correlations among miR-155, miR-21, and miR-146a. [score:1]
Recently, increasing researches have suggested involvement of miRNAs in different processes of gastric carcinogenesis [21, 22], especially miR-155, miR-21, and miR-146a [22– 24]. [score:1]
And there were negative correlation relationships between miR-146a and miR-155/miR-21, respectively, indicating antagonism effects of them on CAG. [score:1]
Additionally, our results indicated that there was a positive correlation relationship between miR-155 and miR-21, indicating synergistic effects of these two miRNAs, as what has been reported before [38]. [score:1]
[1 to 20 of 25 sentences]
31
[+] score: 86
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
These miRNAs were chosen as representative of the different patterns that were observed: up-regulation (miR-21-5p) or down-regulation (miR-222-3p) during latency; up-regulation (miR-181c-5p) or down-regulation (miR-500-3p) in the chronic period; up-regulation (miR-146a-5p) or down-regulation (miR-551b-3p) in the entire course of the disease. [score:21]
Continuing modifications in the expression pattern of miRNAs in the course of chronic epilepsy support the hypothesis that epileptogenesis is a dynamic process that continues even after the initial diagnosis of the disease, i. e. after the initial spontaneous seizures 1. The comparison between chronic epileptic rats and the human cases identified four miRNAs (miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that are similarly up-regulated in expression levels in both species. [score:10]
Continuing modifications in the expression pattern of miRNAs in the course of chronic epilepsy support the hypothesis that epileptogenesis is a dynamic process that continues even after the initial diagnosis of the disease, i. e. after the initial spontaneous seizures 1. The comparison between chronic epileptic rats and the human cases identified four miRNAs (miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that are similarly up-regulated in expression levels in both species. [score:10]
Sestrin 1 (SESN1), a predicted target of miR-21-5p, is down-regulated during latency after amygdala stimulation 23. [score:6]
Most of the miRNAs up-regulated during latency in the GCL displayed pick expression levels in the late phase of latency (7 days after SE), but a subset (miR-21-5p, miR-674-3p and miR-3564-5p) was increased the most 4 days after SE. [score:6]
Second, the chronic phase was accompanied by significant alterations in miRNA expression in the rat GCL, and comparison with data from epileptic patients identified several miRNAs (notably miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that were up-regulated in both human and rat epileptic hippocampus. [score:6]
First, a subgroup of miRNAs (miR-15b-5p, miR-17-5p, miR-18a-5p, miR-19a-3p, miR19b-3p, miR-20a-5p, miR-20b-5p, miR-21-5p, miR-23b-5p, miR-24-3p, miR-27a-3p, miR-92a-3p, miR-93-5p, miR-142-3p, miR-344b-2-3p, miR-431, miR-466b-5p and miR-674-3p) displayed increased expression levels during latency (4 and 8 days after SE), decreased their expression levels at the time of the first spontaneous seizure and returned to control levels in the chronic phase (Fig. 2, Supplementary Fig. S1). [score:5]
We identified four miRNAs (miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that were up-regulated in both epileptic humans and rats (Table 1). [score:4]
Moreover, mutations in the myocyte enhancer factor 2C (MEF2C) gene, a neuronal transcription factor that may have a role in neuronal dysfunction and neurodegeneration 27, has been observed in patients with epilepsy 28 and has been identified as a target of miR-21-5p and miR-21-3p 27. [score:4]
For example, the up-regulation of miR-21-5p may be involved in the initiation of the cell signaling pathway associated with epilepsy 26. [score:4]
In fact, the expression patterns of miR-20b-5p, miR-142-3p, miR-181d-5p, miR-212-5p, miR-344b-5p and miR-674-3p were identical to those observed using the microarray, and those of miR-21-5p and miR-146a-5p were very similar, although not identical (Fig. 4). [score:3]
All these miRNAs displayed a peak in expression levels 8 days after SE, except for miR-21-5p, miR-27a-3p, miR-142-3p and miR-674-3p that peaked earlier (4 days after SE). [score:3]
The other 24 performed the analysis in plasma samples obtained from the trunk blood, reporting an increase in miR-142-5p levels during the acute phase, miR-21-5p in the early stage and of miR-146a-5p in the chronic stage, that reflect parallel changes in miRNAs expression observed in the brain. [score:3]
This finding, combined with the evidence that another member of the sestrins family, SESN3, controls a proconvulsant transcriptional program in human TLE 29, suggests a correlation between miR-21-5p and the mechanisms that lead to seizures onset. [score:1]
[1 to 20 of 14 sentences]
32
[+] score: 79
That the tumor suppressor genes Fxbw7, Pdcd4, and Stk40 were downregulated at the mRNA and protein level in marked-ZD tumor group (Figure 6) and that they were predicted to interact to alter network of target proteins [65, 66, 77] (Figure 7) provide support that miR-223, miR-21, and miR-31 have an important role in ESCC and may be useful prognostic biomarkers and therapeutic targets for ESCC. [score:10]
We then showed that the expression of the most functionally related gene, Pten, was also down-regulated in the ESCC-bearing ZD3T esophagus that overexpressed miR-21 at the mRNA level by qPCR (P = 0.02, n = 6 rats/group) and at the protein level by immunohistochemistry compared to ZS counterpart (Figure 7C). [score:7]
That the three tumor suppressor targets are predicted to interact to alter network of cancer-related proteins [65, 66, 77] provide support that miR-223, miR-21, and miR-31 have an important role in ESCC and may be useful therapeutic targets in ESCC. [score:7]
Oncogenic miR-21 exerts its anti-apoptotic effects by targeting the tumor suppressors PDCD4 and PTEN [64, 67]. [score:5]
A. The displayed esophagus-specific nine-gene network shows predicted functional relationships among the genes that are most functionally related to Stk40, Pdcd4 and Fbxw7 (tumor-suppressor targets of miR-31, mir-21 and miR-223, respectively). [score:5]
The oncomiR miR-21 that was prominently overexpressed (up 4.2 fold) in the highly hyperplastic ZD3 esophagus, however, was not differentially expressed in the less hyperplastic ZD6 or ZD12 esophagus (Figure 1B: PCNA, 22 weeks). [score:5]
miR-223, miR-21, and miR-31 can target many important tumor suppressor genes, including FXBW7 [25, 61], STK40 [60, 62, 63], and PDCD4 [64]. [score:5]
Figure 7 A. The displayed esophagus-specific nine-gene network shows predicted functional relationships among the genes that are most functionally related to Stk40, Pdcd4 and Fbxw7 (tumor-suppressor targets of miR-31, mir-21 and miR-223, respectively). [score:5]
miR-223, miR-21, and miR-31 are the top -upregulated species in the high ESCC-burden, marked-ZD esophagus. [score:4]
The mechanism(s) by which miR-223 and miR-21 are upregulated by ZD remains to be elucidated. [score:4]
miR-21 is one of the most consistently overexpressed oncomiRs in solid cancers [84], including ESCC [22– 24, 29]. [score:3]
Our study suggests that miR-223, miR-31 and miR-21 alone or in combination could be used as therapeutic targets for treatment of ESCC. [score:3]
A genuine oncogene, mice conditionally overexpressing miR-21 develop lymphoma [85]. [score:3]
We obtained a nine-gene network of functional relationship predictions in the esophagus (Figure 7A) showing that Fbxw7, Stk40, and Pdcd4 were functionally related to several cancer-related genes, such as Pten, tumor suppressor of miR-21 [67, 68], oncogene Bcl2 [69], a Wnt signaling pathway transcription factor Tcf4 [70], the dead box protein family of RNA helicases Ddx6 [71, 72], fibroblast growth factor receptor 1 Fgfr1 [73– 75], and Ppp3ca, a component of calcium/calcineurin signaling that includes apoptosis [76]. [score:3]
Cellular localization of miR-223, miR-31 and miR-21 expression in human ESCC tissue. [score:3]
Localization of miR-223, miR-31, and miR-21 in human esophageal squamous cell carcinoma (ESCC) tissue by in situ hybridization (ISH). [score:1]
Following deparaffinization, rehydration in graded alcohol and proteinase K treatment, tissue sections were hybridized with miR-31 probe (20 nM), miR-223 or miR-21 probe (50 nM) in hybridization buffer (Exiqon) at 50°C - 57°C for 14 h in a hybridizer (Dako, Glostrup, Denmark). [score:1]
In situ hybridizationmiRCURY locked nucleic acid (LNA)™ microRNA detection probes, namely, rno-miR-21, rno-miR-31, rno-miR-223, hsa-miR-31, hsa-miR-223, negative controls (rno-miR-31) with mismatches at two position, were purchased from Exiqon (Vedbaek, Denmark). [score:1]
A limitation of this study is the fact that the underlying biological mechanisms of the key dysregulated miRNAs in ESCC development, namely, miR-223, miR-21, and miR-31, were not investigated. [score:1]
All 12 cases showed intense to moderate miR-31, miR-223, and miR-21 ISH signal in near serial sections of moderately to poorly differentiated ESCC tumor samples (Figure 5). [score:1]
miRCURY locked nucleic acid (LNA)™ microRNA detection probes, namely, rno-miR-21, rno-miR-31, rno-miR-223, hsa-miR-31, hsa-miR-223, negative controls (rno-miR-31) with mismatches at two position, were purchased from Exiqon (Vedbaek, Denmark). [score:1]
Whether miR-223 and miR-21 co-localize in the same ESCC tissue is not known. [score:1]
[1 to 20 of 22 sentences]
33
[+] score: 71
Despite extensive disagreement, several microRNAs showed concordant changes in expression across studies; these included the upregulation of miR-223 and miR-21 and the downregulation of miR-124 and miR-219, which were observed in most, if not all, of the examined studies. [score:9]
Preliminary studies using microarray analyses to examine microRNA expression profiles post-SCI in mice [5] and rats [6] have confirmed significant and common changes in the expression of several microRNAs (e. g., miR-21 overexpression) and have identified potential downstream targets for some of these [6]. [score:9]
MicroRNA miR-21 targets PTEN, a negative regulator of NF-κB [97], as well as PDCD4, which promotes NF-κB activation and inhibits the expression of IL-10 [98], [99], [100]. [score:8]
According to Sahni et al. [102], BMP -induced downregulation of the inflammatory miR-21 causes GFAP overexpression and astrogliosis following SCI. [score:6]
Nakanishi et al. [5] observed similar changes in miR-223 and miR-124 expression, which were also observed by Liu et al. [6], and these studies also identified coincident expression changes in miR-21, miR-146a, and miR-17, among others. [score:5]
Expression changes respect to control/sham 1 dpo 7 dpo Name Liu Present Liu Present rno-miR-130b 1.42 NE rno-miR-146a 1.72 INC S rno-miR-15b 1.15 DEC NS rno-miR-17 1.74 INC NS rno-miR-18a 2.71 NE 3.41 NE rno-miR-200c 4.12 NE rno-miR-206 3.26 NE rno-miR-20a 1.69 NC rno-miR-20b-5p 1.83 NE rno-miR-21 1.37 INC S rno-miR-214 2.01 INC NS rno-miR-219-5p −1.82 DEC S rno-miR-221 1.1 NE rno-miR-223 3.58 INC S 3.4 INC S rno-miR-24-2* 2.41 DEC NS rno-miR-290 3.66 INC NS 2.96 DEC S rno-miR-378 1.31 INC NS rno-miR-410 −1.21 NE rno-miR-466b 3.05 DEC S rno-miR-541 1.11 INC S rno-miR-874 2,8 NEData restricted to microRNAs with significant changes in expression (2-fold or greater) according to Liu et al. [6]. [score:5]
A comparison between these identified microRNAs and those showing expression changes in the present microarray analysis revealed similar expression changes for miR-21 24 hours after SCI as well as for 4 other microRNAs, namely, miR-184, miR-340-5p, miR-369-3p and miR-466b, at 7 dpo (Table 2). [score:5]
It is possible that the changes in expression for both mir-125b and miR-21 observed in the present study are associated with an infiltration or a response by cell types other than astrocytes. [score:3]
Furthermore, the microRNAs miR-21 and miR-223 have previously been reported to be overexpressed in other nervous system array studies [5], [25]. [score:3]
The latter samples only showed increased expression in a restricted number of microRNAs, particularly miR-21. [score:3]
When the changes in expression were analyzed at 7 dpo, miR-21 and miR-146a levels were found to be significantly increased at 7 dpo in comparison to the control and sham groups. [score:3]
The microRNA miR-21, which was the most highly overexpressed microRNA at 7 dpo, has been shown to play a role in apoptosis [26], [27], [28]. [score:3]
The Q-PCR analysis from animals sacrificed at 3 days postoperation revealed that miR-21 and miR-223 are significantly upregulated in injured animals compared to both control and sham animals. [score:3]
MicroRNAs miR-21, miR-223, miR-146a, and miR-219-5p showed significant expression changes in our study (identified with both a t-test and a Rank Product test) as well as in other reports [6], [25]. [score:3]
The inflammatory effects of miR-21 are less clear, as they exhibit both pro- and anti-inflammatory activities in the NF-κB pathway. [score:1]
These 53 microRNAs include members of the miR-17-92 cluster, miR-21, or the nervous system-specific miR-124 (see the table in file S3). [score:1]
We validated the changes in the levels of the microRNAs miR-21, miR-223, miR-146a, miR-219-5p, miR-29c, miR-468, miR-145 and miR-107 using Q-PCR. [score:1]
[1 to 20 of 17 sentences]
34
[+] score: 68
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
Collectively, these results indicate that FoxO transcription factors are required for Cdc25A upregulation by A β. FoxOs elevate Cdc25A expression by suppressing miR-21 levels following A β treatmentWe next probed the mechanism by which FoxOs regulate Cdc25A in response to A β treatment. [score:9]
For these experiments, we overexpressed miR-21 activity in neuronally differentiated PC12 cells by transfecting them with an miR-21 mimic or with a control mimic in the presence or absence of A β. Our reasoning was that the overexpressed miR-21 mimic should over-ride the inhibitory actions of A β on endogenous miR-21 levels and therefore suppress the elevation of Cdc25A caused by A β exposure. [score:9]
Western blots also verified upregulation of Cdc25A protein following A β treatment in the presence of the control mimic and that this effect was fully suppressed in cells transfected with the miR-21 mimic (Figures 7f and g). [score:6]
Taken together our findings thus support a neuronal pathway in which A β treatment activates FoxO transcription factors that in turn downregulate miR-21, leading to elevated Cdc25A expression. [score:6]
Significantly, this upregulation was nearly completely blocked in miR-21 mimic -overexpressing cells (Figure 7e). [score:6]
FoxOs elevate Cdc25A expression by suppressing miR-21 levels following A β treatment. [score:5]
It was reported that Cdc25A is suppressed by miR-21 in colon cancer cells [29] and that FoxO3a induces apoptosis of lung cancer cells by negatively regulating miR-21 in response to doxorubicin. [score:4]
[28] We found that a miR-21 mimic is sufficient to block Cdc25A mRNA and protein induction by A β and that miR-21 is downregulated in A β -treated neurons by a mechanism requiring FoxO transcription factors. [score:4]
Our study thus favors a mechanism in which A β elevates Cdc25A expression and activity and provides an explanation for how this occurs via FoxO–miR-21 signaling. [score:3]
These findings suggest a pathway in which NGF deprivation or A β treatment leads successively to Akt inactivation, FoxO activation, suppression of miR-21 levels and consequent elevation of Cdc25A (Figure 8). [score:3]
These findings thus indicate that A β negatively regulates miR-21 in neuronal cells and that this action is mediated by FoxO transcription factors. [score:2]
To determine whether this response is mediated by FoxOs, we knocked down FoxOs in neuronal PC12 cells, treated them with A β and assessed miR-21 levels by RT-PCR. [score:2]
This also revealed a substantial reduction in miR-21 following A β treatment and this effect was completely abolished in FoxO knockdown cells (Figure 7c). [score:2]
[29] We therefore assessed whether FoxOs regulate Cdc25A via miR-21 in the context of A β treatment. [score:2]
It has been reported that FoxO3a transcriptionally represses miR-21 in cancer cells following doxorubicin treatment [28] and that miR-21 negatively regulates Cdc25A. [score:2]
However, in contrast to NGF deprivation and A β treatment, Cdc25A activation by camptothecin did not change Cdc25A levels (and therefore not likely the FoxO–miR-21 pathway), but rather was correlated with loss of activity of the checkpoint 1 kinase (Chk1). [score:1]
Our findings establish for the first time that Cdc25A is a required upstream activator of the apoptotic cell cycle pathway in trophic factor-deprived neurons and that its levels under such conditions are elevated by a pathway involving FoxOs and miR-21. [score:1]
Next, we evaluated whether the A β-promoted decrease in miR-21 levels is responsible for elevating Cdc25A expression. [score:1]
[1 to 20 of 18 sentences]
35
[+] score: 60
Other miRNAs from this paper: rno-mir-148b, rno-mir-25, rno-mir-26a, rno-mir-133a, rno-mir-148a
Correlation test showed that miR-21 expression in AIPI rat plasma was positively correlated with its relative expression in lavaged lungs (r = 0.530, p < 0.05) (Fig.   4d). [score:5]
*: p < 0.05, **: p < 0.01, ***: p < 0.001 In order to determine whether circulating miR-21 and miR-26a change in the development of airway inflammation, we studied the level of expression of miR-21 and miR-26a in rats with antigen -induced pulmonary inflammation. [score:4]
Content of circulating miR-21 and miR-26a was not correlated with the corresponding intracellular expression or various cell counts in blood. [score:3]
In addition, plasma miR-21 and miR-26a levels did not correlate with total IgE, various counts of different types of leukocyte or miRNA expression in corresponding blood cells. [score:3]
The positive correlation between BALF miR-21 or miR-26a expressions and BALF cell count indicated that the cell-free miR-21 or miR-26a may originate from infiltrated inflammatory cells in airways. [score:3]
There was no difference in the plasma level of miR-21 and miR-26a between different age groups of wheezing + LRI children, and gender did not influence on plasma level of expression of miR-21 and miR-26a (Fig.   1c). [score:3]
Plasma miR-21 and miR-26a levels were not significantly correlated with various leukocyte counts or miRNA expression in blood cells. [score:3]
The miR-21 expression increased in plasma (p < 0.05), lungs (5.7 fold increase, p < 0.01) and spleens (3.3 fold increase, p < 0.01) in the chronic AIPI rats compared with that of the control group. [score:2]
Increasing miR-21 and miR-26a were found in plasma and bronchoalveolar lavage fluid of AIPI rats. [score:1]
The results showed that plasma level of both miR-21 and miR-26a were not correlated with those blood components. [score:1]
MiR-21 and miR-26a in blood cells from 19 indifferent control, 35 LRI control and 70 wheezing + LRI children were detected using RT-qPCR. [score:1]
Secondly, ROC results showed that plasma miR-21 was more preferable to plasma miR-26a and plasma total IgE as biomarker, and were of potential clinical significance. [score:1]
Table S5: correlation analysis of plasma miR-21 or miR-26a and various leukocyte counts. [score:1]
Fig. 2Clinical implication of plasma miR-21 and miR-26a in childhood wheezing. [score:1]
b ROC curves of plasma total IgE, plasma miR-21 and miR-26a for differentiation of childhood wheezing. [score:1]
In a set of wheezing + LRI patients (n = 20) and age- and gender-matched LRI control children (n = 20), miR-21, miR-25, miR-26a, miR-133a and miR-148 showed potential statistical differences between the patient and control groups (p < 0.10) (Fig.   1a). [score:1]
In the present study, we showed that plasma miR-21 and miR-26a are strongly implicated in childhood wheezing and airway inflammation. [score:1]
AUC values for the combination of plasma total IgE and plasma miR-21, as well as the combination of plasma total IgE, plasma miR-21 and miR-26a were 0.814 and 0.830 respectively. [score:1]
b RT-qPCR results of miR-21, miR-25, miR-26a, miR-133a and miR-148 in plasma from 35 indifferent control, 35 LRI control and 70 wheezing + LRI children. [score:1]
Circulating miR-21 and miR-26a increase in wheezing children and AIPI rats. [score:1]
Hence, in this situation, plasma miR-21 and miR-26a can be used to identify some recurrent wheezing children with high asthma risk. [score:1]
Both the miR-21 and miR-26a levels sharply decreased in chronic AIPI rat BALF. [score:1]
d Scatter dot plots of correlation between plasma and lung miR-21. [score:1]
*: p < 0.05, **: p < 0.01, ***: p < 0.001 Firstly, the increase of plasma miR-21 and miR-26a was screened out and validated in wheezing children. [score:1]
Firstly, the increase of plasma miR-21 and miR-26a was screened out and validated in wheezing children. [score:1]
Plasma miR-21 was more preferable to miR-26a and total IgE for diagnosis. [score:1]
In addition, BALF miR-21 (r = 0.468, p < 0.01) and miR-26a (r = 0.524, p < 0.01) were both highly positively correlated with BALF cell counts (Fig.   4e-f). [score:1]
It is known that miR-26a and miR-21 are induced during mechanical stretch in human smooth muscle cells [14, 28]. [score:1]
a- b miR-21 (a) and miR-26a (b) in plasma, BALF, spleens and lavaged lungs of rats from control, acute and chronic AIPI rats. [score:1]
Area under curve (AUC) reflects preferable index for variable separation, and our data showed that plasma miR-21 (AUC of 0.802, p < 0.001) was more preferably than plasma miR-26a (AUC = 0.769, p < 0.001), and plasma total IgE (AUC = 0.688, p < 0.01) (Fig.   2b). [score:1]
Previous studies have shown that miR-21 participates in various molecular events important for inflammatory and remo deling process of pulmonary cells [11, 25– 27]. [score:1]
In summary, this study demonstrated the increase of circulating miR-21 and miR-26a and their clinical potential in pediatric recurrent wheezing, and also found that these circulating miRNAs increased in plasma and bronchoalveolar lavage fluid from animals under inflammatory stress. [score:1]
Fig. 1Differential levels of miR-21 and miR-26a in plasma from wheezing children. [score:1]
These findings on intracellular miR-21 and miR-26a combined with our findings on extracellular ones might provide more clues on their potential as indicators for lung inflammation. [score:1]
Moreover, circulating miR-21 and miR-26a levels were highly positively correlated with infiltrated cell counts in bronchoalveolar lavage fluid of AIPI rats. [score:1]
MiR-21 and miR-26a significantly increased in plasma from wheezing children. [score:1]
Circulating miR-21 and miR-26a in BALF were strongly correlated with the infiltrated inflammatory cell numbers. [score:1]
The increase of plasma miR-21 and miR-26a was screened out from 11 candidate miRNAs and validated in wheezing children. [score:1]
e Scatter dot plots of correlation between BALF miR-21 (miR-26a) and BALF cell counts. [score:1]
Correlation analyses were performed between plasma miR-21 (miR-26a) and 14 various indexes for blood components including total leukocytes and platelet numbers, absolute and relative cell counts of monocytes, neutrophils, basophils, lymphocytes, eosinophils and miR-21/miR-26a (Additional file 1: Table S5). [score:1]
ROC plots of plasma miR-21, miR-26a and total IgE as the potential wheezing index were obtained using MedCalc software. [score:1]
c Scattered dot plots of plasma miR-21 and miR-26a in wheezing + LRI children of different ages and genders. [score:1]
[1 to 20 of 42 sentences]
36
[+] score: 56
When we compared the mRNA and miRNA profiles, differentially regulated in PKD, with Argonaute (a comprehensive database on miRNAs; [45, 71]), there were few genes reported as miRNA target like tropomyosin 1, alpha (TPM1) as a target of miR-21, the beta polypeptide of tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein (YWHAB), regulatory subunit 9B of protein phosphatase 1 (PPP1R9B), early growth response 3 (EGR3) and dynamin 1-like (DNM1L) as targets of miR-31, plysia ras-related homolog A2 (RHOA) as targets of miR-217, etc. [score:10]
We verified the expression changes of the only up-regulated miRNA, miR-21: in the qPCR assays, it was 3.5 fold up-regulated in the kidney of diseased animals, compared to healthy ones. [score:9]
miRNA Target Genes Pathways miR-128 ABCB9, BTG1, DSCR1, RASD1 ABC transporters General miR-136 GRN, PPP1R9B miR-147 HOXA1, PTGFRN miR-148 EGR3, SCN3A miR-181b IGF1R, NKX6-1 Adherens junction, Maturity onset diabetes of the, Focal adhesion, **Long term depression miR-196a ABCB9, CPB2, IRS1, MAPK10 ABC transporters General, Complement and coagulation cas, Adipocytokine signaling pathwa, Insulin signaling pathway, Type II diabetes mellitus, Fc epsilon RI signaling pathwa, Focal adhesion, **GnRH signaling pathway, **MAPK signaling pathway, Toll like receptor signaling p, Wnt signaling pathway miR-203 SARA1 miR-20 BTG1, SARA1, YWHAB Cell cycle miR-21 TPM1 mir-216 GNAZ **Long term depression miR-217 RHOA Adherens junction, Axon guidance, Focal adhesion, Leukocyte transendothelial mig, Regulation of actin cytoskelet, TGF beta signaling pathway, T cell receptor signaling path, Tight junction, Wnt signaling pathway miR-31 ATP2B2, DNM1L, EGR3, PPP1R9B, YWHAB **Calcium signaling pathway, Cell cycle miR-7 SLC23A2 miR-7b HRH3, NCDN, SLC23A2 **Neuroactive ligand receptor in b: miRNAs and their targets (from TargetScan and miRanda). [score:8]
We could not find negative co-relations between the predicted targets of the only up-regulated miRNA, miR-21, whose expression was verified by qPCR analysis too. [score:8]
Out of 30 miRNAs, 29 were down-regulated in PKD/Mhm (cy/+) animals and only one miRNA, miR-21, was up-regulated. [score:7]
We were unable to find a direct, down-regulated target, for miR-21. [score:7]
We predict that several of the differentially regulated genes are miRNA targets and miR-21, miR-31, miR-128, miR-147 and miR-217 may be the important players in such interaction. [score:4]
Expression of 3 miRNAs (miR-21, 31 and 196a) significantly regualted on miRNA microarray was verified using qPCR assays. [score:2]
miR-21 has been reported in kidney [45] but its function has yet not been established. [score:1]
[1 to 20 of 9 sentences]
37
[+] score: 54
In contrast, miR-21 expression may vary between chronic hypoxia, monocrotaline, and hypoxia/SU5416 mo dels of PAH with downregulation such that either enhancement of miR-21 expression with miR mimetics (Hypoxia/SU5416 mo del) or downregulation of miR-21 expression with inhibitors (MCT mo del and some hypoxia mo dels) may be beneficial [16– 18]. [score:15]
In contrast, the miRNA panel from lung specimens of MCT rats overexpressing hPGIS exhibited restoration of dysregulated miRNA levels to levels of naïve control rats, with downregulation of miRNAs that had been increased by MCT (miR-17, miR-21, and miR-223), and upregulation of miRNAs that had been decreased by MCT (miRs 424 and 503), Fig 5C]. [score:10]
The upregulation of miR-21 and miR-223 for all tissues examined indicates the possibility they are ubiquitously upregulated in all tissues affected by PAH, while other miRNAs may have a more tissue-specific dysregulation, for example miR-124 which is predominantly dysregulated in adventitial fibroblasts. [score:9]
Downregulation of miR-204 also occurred in PLs and CLs with upregulation of miR-21 in both PLs and CLs. [score:7]
Importantly, miR-21 and the miR-17-92 cluster have been shown to be involved in BMPR2 down-regulation. [score:4]
Among these the miR-17–92 cluster, miR-21, miR-145, miR-204 and miR-210 are dysregulated in PASMCs, miR-124 is primarily dysregulated in fibroblasts in the adventitia, and miR-17, miR-21, miR-424, and miR-503 appear to play important roles in PAECs. [score:3]
MiR-21 and 223 have been reported as upregulated in human blood samples from PAH subjects [36]. [score:3]
MiR-17, miR-21, and miR-145 dysregulation have been linked to TGFβ, BMPR2 and RhoA/RhoB kinase signaling [24– 26]. [score:2]
Expression levels of miR-17-5p, miR-21-5p, miR-126-3p, miR-145-5p, miR-150-5p, miR-204-5p, miR-223-3p, miR-328-3p, miR-424-5p (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424), and miR-503-5p were evaluated. [score:1]
[1 to 20 of 9 sentences]
38
[+] score: 54
The miRNA array data have been deposited in the Gene Expression Omnibus (accession number [GEO: GSE22181]) miRNA expression was quantified using real-time RT-PCR on the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems) to verify the upregulated miRNA targets detected by the miRNA array from the spinal segments (miR-384-3p, miR-325-5p, miR-342-5p, and miR-340-5p) and DRGs (miR-21) in the denervation and sham control groups, and the muscle-specific miRNAs (miR-1, miR-133a, and miR-206) in the soleus muscles of the sham control, entrapment, and decompression groups. [score:10]
miR-21 was reported to play a cytoprotective role against injury via its target genes [39, 40]; however, the role and target genes of miR-21 expression in the DRGs after denervation were beyond the scope of this study. [score:7]
On the other hand, after sciatic nerve denervation, we observed 1 downregulated miRNA (miR-144) and 1 upregulated miRNA (miR-21) in the DRGs (Figure 1). [score:7]
We detected 1 downregulated miRNA (miR-144) and 1 upregulated miRNA (miR-21) after sciatic nerve denervation. [score:7]
To localize the expression of miR-21 in the DRGs, in situ hybridization of miR-21 was performed to differentiate whether the upregulation occurred in the neurons or the interstitial connective tissue. [score:6]
Real time RT-PCR revealed that the expression of miR-21 in the DRGs was increased by ~6 fold; it was detected 1 week after denervation and lasted for up to 6 months (Figure 2D). [score:3]
In this study, we had demonstrated an ~6-fold increase in the expression of miR-21 in DRG neurons at 1 week after denervation that lasted for up to 6 months. [score:3]
We used in situ hybridization to localize miR-21 expression in the DRG sections. [score:3]
Real time RT-PCR revealed that the expression of miR-21 in the DRGs was detected after 1 week of denervation with an ~6-fold increase that lasted for up to 6 months (Figure 2D). [score:3]
miR-21 is one of the most prominent miRNAs implicated in human malignancies [36]. [score:1]
For the sham control experiment, the tissue sections were hybridized with rno-U6 probes or without rno-miR-21 probes as positive or negative controls, respectively. [score:1]
Cryosections were fixed in 4% paraformaldehyde, acetylated in 0.1 M triethanolamine (pH 8.0), and then treated with proteinase K. After washing with phosphate-buffered saline (PBS), the specimens were incubated with 10 pmol of locked nucleic acid (LNA) -modified oligonucleotide probe (Exiqon, Woburn, MA, USA) complementary to Rattus norvegicus (rno)-miR-21 and labeled with digoxigenin (DIG) at 50°C overnight. [score:1]
In addition, using DIG-labeled miR-21 probes, intense signals for miR-21 were also observed in the perinuclear region of the neurons (Figure 2C). [score:1]
Intense signals for miR-21 in the perinuclear region of the neurons were also observed in the tissue sections at 1 month after denervation injury by using digoxigenin-labeled miR-21 probes (Figure 2C). [score:1]
[1 to 20 of 14 sentences]
39
[+] score: 51
Interestingly, we found that Xe pretreatment significantly upregulated miR-21 expression in adult rat kidney at 24 hr after 70% Xe exposure (P<0.05) (Figure 7 A). [score:6]
We also found that gentamicin treatment activated miR-21 expression at 4 day after 7-day gentamicin administration, and Xe+gentamicin group showed higher miR-21 expression than either the gentamicin or N [2]+gentamicin group (Figure 7 B). [score:5]
B: gentamicin treatment significantly up-regulated miR-21 4 days after 7-day gentamicin administration, which was further increased by Xe. [score:4]
The possible mechanisms for this protection include up-regulation of miR-21, hypoxia-inducible factor 2α (HIF-2α) and its downstream effector vascular endothelial growth factor (VEGF). [score:4]
Xe Pretreatment Upregulated miR-21. [score:4]
A: Xe pretreatment significantly upregulated miR-21 in rat kidneys 24 hrs after Xe pretreatment. [score:4]
Our previous work showed that up-regulation of miR-21 contributed to the protection against renal ischemia-reperfusion injury, including renal cell apoptosis, conferred by ischemic preconditioning [49]. [score:4]
0064329.g007 Figure 7A: Xe pretreatment significantly upregulated miR-21 in rat kidneys 24 hrs after Xe pretreatment. [score:4]
In this study, we found that Xe upregulated miR-21, a strong anti-apoptotic factor, in kidney and attenuated tubular cell apoptosis, miR-21 might contribute to Xe-conferred amelioration of gentamicin -induced renal injury. [score:4]
Expression level of miR-21 was quantified using real-time reverse transcription -PCR with the Taqman chemistry (Applied Biosystems) as described previously [25]. [score:3]
Expression of miR-21 in rat kidneys. [score:3]
miR-21 has been shown to promote proliferation, inhibit apoptosis, and act as a strong anti-apoptotic factor [29], [30], [47]. [score:3]
It has been shown that miR-21 is a strong anti-apoptotic factor [29], [30]. [score:1]
Given that Xe treatment attenuated tubular cell apoptosis (see above), we measured expression of miR-21 in our renal cortex samples by Taqman real-time PCR. [score:1]
Several miRNAs, such as the miR-29 family, miR-382 and miR-21, have been shown to be relevant to renal injury and repair [25], [47]– [49]. [score:1]
[1 to 20 of 15 sentences]
40
[+] score: 47
As shown in Fig.   6A, oral administration of ethanol induced up-regulation of c-fos and c-jun expression (1.85-fold and 3.16-fold, respectively) and down-regulation of miR-21 expression (1.00-fold). [score:11]
Up-regulated expression of miR-21 can inhibit alcohol induced apoptosis in human gastric epithelial cells [28]. [score:8]
Figure 6Effect of β-PAE on the mRNA expression of c-fos and c-jun, miRNA expression of miR-21 and expression of NF-κB and ERK1/2 signalling-related proteins in the gastric mucosa of ethanol -induced rats (n = 3–5). [score:7]
Therefore, β-PAE up-regulates the expressions of c-fos and c-jun mRNA, as well as miR-21 microRNA. [score:6]
Expression of c-fos and c-jun mRNA and miR-21 microRNA in gastric tissues. [score:3]
Thus, β-PAE pretreatment resulted in the highest expression of miR-21. [score:3]
Similarly, our results demonstrated that β-PAE not only enhanced ERK 1/2 activity, but also enhanced c-fos and c-jun mRNA and miR-21 microRNA expressions. [score:3]
Gene Orientation Sequence (5′ to 3′) c-fos Forward GCC TCG TTC CTC CAG TCC GA Reverse TGC GAT GGA AAG GCC AGC CC c-jun Forward CAG GTG GCA CAG CTT AAA CA Reverse CGC AAC CAG TCA AGT TCT CA β-actin Forward GCC AGA GCG GGA GTG GTG AA Reverse GGC TTG GGC TCA GGG TCA TT miR-21 Stem-loop CTC AAC TGG TGT CGT GGA GTC GGC AAT TCA GTT GAG TCA ACA TC Forward ACA CTC CAG CTG GGT AGC TTA TCA GAC TGA Reverse CTC AAC TGG TGT CGT GGA U6 Forward CTC GCT TCG GCA GCA CA Reverse AAC GCT TCA CGA ATT TGC GT All data are expressed as the mean ± SD, and a value of P < 0.05 was considered statistically significant. [score:2]
Additionally, administration of lansoprazole (3.16-fold), PA (2.90-fold) or β-PAE (3.22-fold) significantly restored the ethanol -induced depletion of miR-21. [score:1]
Determination of c-fos and c-jun mRNA and miR-21 microRNA by qRT-PCR. [score:1]
In addition, AP-1 can activate miR-21 transcription [27]. [score:1]
β-actin acted as an internal control for the relative quantification of c-fos and c-jun, and U6 acted as an internal control for the relative quantification of miR-21. [score:1]
[1 to 20 of 12 sentences]
41
[+] score: 45
Specifically, miR-195 potentially regulates vesicle -associated membrane protein 1 (VAMP1), miR-30a targets actinin, alpha 1 (ACTN1), miR-21 targets paired-like homeodomain 2 (PITX2) in D6; miR-132 potentially regulates solute carrier family 2, member 1 (SLC2A1), nuclear receptor subfamily 4, group A, member 2 (NR4A2) and Cdc42 guanine nucleotide exchange factor 9 (ARHGEF9), miR-203 targets calcium binding protein 7 (CABP7), miR-17-5p targets early growth response 2 (EGR2) in S6; miR-330 potentially regulates CD247, nerve growth factor receptor (NGFR) and FAT tumor suppressor homolog 3 (FAT3), miR-338 targets ADAM metallopeptidase domain 17 (ADAM17), miR-218 targets src kinase associated phosphoprotein 1 (SKAP1), miR-185 targets calcium channel, voltage -dependent, N type, alpha 1B subunit (CACNA1B) in S9. [score:20]
The expression of miR-21 is significantly up-regulated in the hippocampus after traumatic brain injury in rodents, with expression level peaking by 3 days post-injury and returning to near-sham level by 15 days post-injury [35]. [score:8]
Moreover, miR-21 expression was also significantly up-regulated following traumatic spinal cord injury in another recent report [11], the results of which are similar to our study. [score:6]
PITX2, the target of miR-21 listed in Table 2, was demonstrated to regulate regionally specific terminal neuronal differentiation in the developing ventrolateral thalamus and midbrain and to be involved in the control of retina regeneration [36], [37]. [score:4]
PTEN was shown to be a direct target of miR-21 [38]. [score:4]
It is, therefore, intriguing to speculate that miRNAs, including miR-195, miR-30a and miR-21 (in D6), may participate in a molecular network involving multiple reciprocal nodes that together orchestrate and fine-tune diverse targets and signaling in axon outgrowth. [score:3]
[1 to 20 of 6 sentences]
42
[+] score: 45
The overexpression of sod3 correlated with simultaneous activation of Akt and Erk1/2, consequent FoxO3a cytoplasmic entry, anti-apoptotic mir-21 upregulation and pro-apoptotic bim mRNA downregulation. [score:9]
Recently, FoxO3a was found to negatively regulate an anti-apoptotic microRNA, mir-21 by binding the mir-21 promoter to suppress its expression [21]. [score:6]
Temporal simultaneous activation of Erk1/2 and Akt leads to phosphorylation and consequent cytoplasmic translocation of FoxO3a, which then increases miR-21 production and downregulates the bim mRNA expression. [score:6]
0024456.g004 Figure 4Temporal simultaneous activation of Erk1/2 and Akt leads to phosphorylation and consequent cytoplasmic translocation of FoxO3a, which then increases miR-21 production and downregulates the bim mRNA expression. [score:6]
Since it was recently shown that in the nucleus FoxO3a suppresses the anti-apoptotic miR-21 transcription [20], [21] we next analyzed the microRNA (miRNA) expression. [score:5]
Based on the quantitative real time-PCR data, the expression of mir-21 in sod3 overexpressing ischemic tissues at 3-day time point was significantly (p<0.001) increased as compared to uninjured control muscles. [score:4]
In line with this, we demonstrated increased mir-21 expression in vivo in sod3-transduced tissues (Figure 3E). [score:3]
Based on our data, sod3 overexpression caused activation of Erk1/2 and Akt pathways involving cytoplasmic entry of FoxO3, increased miR-21 production, and decreased BCL-2 interacting mediator of cell death (bim) mRNA synthesis. [score:3]
Additionally, we obtained increased mRNA production of elk-1, ets-1, and microRNA 21 (miR-21), whereas synthesis of bim mRNA was decreased in sod3 overexpressing tissues. [score:3]
[1 to 20 of 9 sentences]
43
[+] score: 43
If targeted tumors express sufficient delta-opioid receptors, DOR activation could promote miR-21 down-regulation in hypoxic tumors without affecting the surrounding normal tissue. [score:8]
Hyaluronan -induced PKC activation in breast cancer cells initiates signaling that culminates in the upregulation of miR-21 and the repression of the tumor suppressor, programmed cell death 4 (PDCD4) [32]. [score:6]
The combination of DOR activation and hypoxia dramatically downregulated miR-21 expression both in the kidney and cortex, which suggests a more generic response. [score:6]
In the cultures, blockade of miR-21 activation with antagomir transfection reduced proliferation and increased tumor suppressor expression [32], [34], [35]. [score:5]
While hypoxia and UFP-512 individually had no effect after 5 days, the combination of two produced a dramatic 70% suppression in miR-21 expression. [score:5]
After 5 days, this effect was lost and continued exposure resulted in a 60% upregulation of miR-21 in cortex exposed to 10-day hypoxia (Figure 6c). [score:4]
Enhancement of miR-21 expression is associated with increased cell proliferation, PDCD4 and Sprouty repression, and chemotherapy resistance in mo dels of cardiac hypoxia preconditioning, pulmonary artery smooth muscle cells, glioblastoma and ovarian tumors [32], [33], [34], [35], [36]. [score:3]
In the hypoxic mo dels, DOR activation reduced miR-21 expression by over 70% in 5-day group. [score:3]
For example, DOR activation increased miR-21 under normoxic condition in the 10-day group. [score:1]
In fact, several miRNAs, besides miR-21, showed a selective response to DOR activation under hypoxia, but not normoxia. [score:1]
UFP-512 mediated an early 40% reduction in miR-21 within 24 hours of administration. [score:1]
[1 to 20 of 11 sentences]
44
[+] score: 40
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
A study identifying miRNAs expressed in myometrial and leiomyoma smooth muscle cells (MSMC and LSMC) using microarray and real time PCR reported that E [2] inhibited the expression of miR-21 in MSMC and LSMC, whereas E [2] increased and inhibited miR-26a in MSMC and LSMC, respectively [210]. [score:9]
After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127. [score:7]
In contrast, ICI 182,780 increased the expression of miR-20a and miR-21 in MSMC and LSMC, and miR-26a in MSMC, while inhibiting the expression of miR-26a in LSMC [210]. [score:7]
A recent study reported that miR-21 expression was reduced in breast tumors and that antisense to miR-21 suppressed MCF-7 breast cancer cell growth in vitro and as tumor xenografts in mice by regulating Bcl-2 [13]. [score:6]
By 18 wks of E [2] treatment, the mammary glands were characterized by lobular involution and hyperplasia, and only 1 miRNA was down-regulated (miR-139) and 5 miRNAs were up-regulated (miR-20b, miR-21, miR-103, mir-107, miR-129-3p, and miR-148a). [score:5]
Interestingly, we recently reported that overexpression of miR-21 in MCF-7 cells increased soft agar colony formation, reflecting increased tumorigenicity of these cells [193]. [score:3]
We demonstrated that miR-21 binds to a seed element in the 3'-UTR of the programmed cell death 4 (PDCD4) gene and reduces Pdcd4 protein expression [193]. [score:3]
[1 to 20 of 7 sentences]
45
[+] score: 39
MiR-21 is significantly upregulated at 12 h and 24 h in astrocytes however in neurons upregulation occurred only after 24 h. MiR-210 is significantly upregulated in astrocytes at 8 h, 12 h and 24 h. In neurons, miR-210 showed a significant variability between each set of experiments. [score:10]
They found that miR-21 and miR-210 expression are upregulated at 24 h after reperfusion that is in line with our findings in neurons and astrocytes exposed to OGD conditions. [score:6]
Similarly, in accord with our findings, Ren dell and colleagues [35] reported upregulation of miR-21 and miR-30b occurring 24 h after TBI in brain tissue in a rat mo del. [score:4]
MiR-21 was upregulated 1.5-fold at 12 h and 1.94-fold (p<0.05) at 24 h post-OGD as compared to expression in control neurons. [score:4]
We screened the same miRNAs as described above (miR-21, miR-29b, miR-30b, miR-107, miR-137, miR-210) and found that IGF-I significantly decreases the expression of mir-29b in neurons. [score:3]
MiR-21 showed a trend of upregulation (>1.6-fold, p<0.05) only at 12 h post-OGD. [score:3]
IGF-I did not have an effect on the expression levels of mir-21, mir-30b, mir-107, mir-137, or mir-210 in neurons. [score:3]
MiR-21 is upregulated in astrocytes 12 h after ischemia, the time when multiple free radicals are present in ischemic brain. [score:3]
MiR-21 showed a similar expression alteration in neurons and astrocytes. [score:2]
We screened the same miRNAs as described above (miR-21, miR-29b, miR-30b, miR-107, miR-137, miR-210). [score:1]
[1 to 20 of 10 sentences]
46
[+] score: 37
Additionally, it has been verified that miR-21 overexpression can down-regulate the Pdcd4 tumor suppressor and stimulate invasion, intravasation and metastasis in colorectal cancer [31]. [score:8]
For example, the precursor sequences of the up-regulated miRNAs (miR-21, miR-10b) and down-regulated miR-148b* observed in our study are located at 17q23, 3q23 and 12q13. [score:7]
In detail, five miRNAs were significantly up-regulated (miR-21, miR-34c-3p, miR-470*, miR-10b, let-7i*) and two miRNAs significantly down-regulated in SP of HCC cells (miR-200a*, miR-148b*). [score:7]
Moreover, overexpression of miR-21 was also previously associated with poorly differentiated HCC, and this miRNA is known to participate in down-regulation of phosphatase and tensin homolog (PTEN) [32]. [score:6]
These target genes were PTEN (miR-21), P53 (miR-34c), Rho C (miR-10b), RAS (let-7i), and ZEB1 (miR-200a). [score:3]
As shown in Figure 4A, the results showed that the expression levels of miR-21, miR-34c-3p, miR-16, miR-10b, and let-7i* in SP of HCC cells compared to SP of fetal liver cells were increased 3.5 ± 0.84, 2.1 ± 0.52, 2.2 ± 0.46, 3.9 ± 0.61, and 2.8 ± 0.25 -fold respectively, which were consistent with miRNA microarray results (P < 0.05). [score:2]
A total of 68 miRNAs, including miR-10b, miR-21, miR-470*, miR-34c-3p, and let-7i*, were identified as overexpressed in SP of HCC cells compared to fetal liver cells. [score:2]
Here we validated significant overexpression of miR-10b, miR-21, and miR-34c-3p in SP fractions of HCC compared to SP fractions of normal fetal liver cells. [score:2]
[1 to 20 of 8 sentences]
47
[+] score: 36
miR-21-5p overexpression significantly reduced the expression of the direct targets of miR-21 [38], PTEN and PDCD-4, and the apoptosis marker gene caspase-3, conversely, enhanced expression of the anti-apoptotic gene Bcl-2 (Figure 4E). [score:10]
As a result, under hypoxia condition, overexpression of miR-21-5p significantly suppressed the reduction of cell viability (p < 0.05; Figure 4B), reduced the cell membrane damage (p < 0.05; Figure 4C), and obviously promoted cell survival (Figure 4D). [score:5]
Cheng Y. H. Zhu P. Yang P. Liu X. J. Dong S. M. Wang X. B. Chun B. Zhuang J. Zhang C. X. Ischaemic preconditioning-regulated miR-21 protects heart against ischaemia/reperfusion injury via anti-apoptosis through its target PDCD4Cardiovasc. [score:4]
Consistent with previous research [36, 38], our results suggest that upregulation of miR-21-5p and miR-378-3p mitigated hypoxia -induced apoptosis and enhanced cell viability, thereby supporting adaptation of the cell to the hypoxic conditions. [score:4]
These results demonstrate that miR-152-3p and let-7i-5p resemble miR-21-5p and miR-378-3p, which are highly expressed in hypoxic H9c2 cells-derived exosomes, and have anti-apoptotic and pro-viability effects in H9c2 cells under hypoxic stress. [score:3]
Cardiac fibroblast-derived exosomes deliver miR-21* to cardiomyocytes to induce myocardial hypertrophy by targeting SORBS2 and PDLIM5 [12]. [score:3]
To further investigate the biological function of hypoxia -induced exosomal miRNAs in H9c2 cell apoptosis, we selected miR-21-5p, miR-378-3p, miR-152-3p, and let-7i-5p, which were significantly upregulated in hypoxic exosomes and participated in apoptosis, for functional verification. [score:2]
miR-21-5p and miR-210-3p are enriched in exosomes secreted from mouse cardiac fibroblast-derived induced pluripotent stem cells (iPS cells), and prevent H9c2 cells apoptosis by regulating Nanog and HIF-1α, respectively [13]. [score:2]
Among these miRNAs, miR-21-5p, and miR-378-3p have been reported to have anti-apoptotic effects in cardiomyocytes under hypoxic stress [36, 37]. [score:1]
Based on our small RNA-seq results and bioinformatic prediction, we selected several miRNA to use to verify function, including miR-21-5p, miR-378-3p, miR-152-3p, and miR-let-7i-5p. [score:1]
Interestingly, we found that some exosomal DE miRNAs, including miR-21-5p, miR-378-3p, miR-152-3p, and let-7i-5p, had potential anti-apoptotic and pro-viability effects in H9c2 cells under hypoxic stress. [score:1]
[1 to 20 of 11 sentences]
48
[+] score: 36
FOXP2 is a predicted target of miR-21; its expression is higher in epicardium than endocardium [112] (Fig. 10), which is the opposite to the gradient for miR-21 expression. [score:7]
Calcineurin Aα (PPP3CA) is a predicted target of miR-21 and miR-99b (TargetScan 6.2) and is expressed more in epicardium than endocardium [113]. [score:7]
TargetScan 6.2 predicts 307 conserved targets for hsa-miR-21, 56 for hsa-miR-99b and 154 for hsa-miR-486-5p. [score:5]
As the mid-myocardium (as used in the present study) also contains fibroblasts and vascular endothelial cells, the contribution of these cell types to the expression of miRNA needs to be considered; miR-21 (which we detected as 30th highest) has been shown to be expressed up to 4-fold higher in cardiac fibroblasts than myocytes [119] as well as being highly detected in various vascular beds [54], [55], [120]. [score:4]
05) transmural expression gradients for miR-10b, miR-21, miR-99b and miR-486 (Fig. 10). [score:3]
This is consistent with miR-21 influencing transmural FOXP2 expression. [score:3]
We have found that most miRNAs are not expressed in a gradient across the ventricular wall, with the exceptions of miR-10b, miR-21, miR-99b and miR-486. [score:3]
miR-21 is abundant in cardiac fibroblasts [119], in which calcineurin may be involved in regulating cell proliferation [144], [145]. [score:2]
Thus a role for miR-21 and/or miR-99b in influencing transmural physiology is an intriguing possibility but requires further study. [score:1]
miR-21 is enriched in endothelial cells [54], [55], [120], in which it mediates the endothelial-to-mesenchymal transition [146] and angiogenesis [147], [148]. [score:1]
[1 to 20 of 10 sentences]
49
[+] score: 35
Other miRNAs from this paper: rno-mir-210
In particular, HRS beneficial effects against I/R injury were likely exerted by Treg, TGF-β1 up-regulation and miR-21, miR-210, NF-κB and TNF-α down-regulation. [score:7]
Aberrant miR-21 expression has been reported in traumatic brain injury and increased miR-21 expression has been linked to increased cell survival, growth, and proliferation and decreased apoptosis [38, 39]. [score:5]
HRS Modulated miR-210 and miR-21 Expression. [score:3]
Compared with the sham and sham + H [2] groups, miR-210 and miR-21 expression in group I/R was significantly increased at 24 and 96 h after reperfusion (P < 0.05), while miR-210 and miR-21 expression in group H [2] was significantly decreased at 24 and 96 h compared with group I/R (P < 0.05) (Fig.   2). [score:3]
The expression of miR-210 and miR-21 in all groups was negatively correlated with the pyramidal cells number in the CA [1] area of the hippocampus at 24 h after reperfusion (P < 0.05, Pearson correlation coefficient r = −0.65 and P < 0.05, r = −0.84, respectively). [score:3]
The trend of miR-21 expression was similar to that of miR-210. [score:3]
miR-21 expression in the hippocampus at 6, 24, and 96 h after I/R with or without HRS; *P < 0.05 vs Sham and Sham + H [2] groups, [#]P < 0.05 vs I/R group. [score:3]
a miR-21 expression by qRT-PCR analysis of total RNA isolated from hippocampal tissue harvested at the indicated times after injury. [score:3]
When the cerebral I/R injury was treated with HRS immediately after reperfusion, miR-210 and miR-21 expressions were decreased significantly at 24 and 96 h. Our results of an increased miR-210 and miR-21 after I/R injury and their decrease in the HRS treated rats, together with the histological examination and behavioral test results shown in our study, suggested that miR-210 and miR-21 may be considered markers of cerebral I/R injury. [score:2]
HRS Regulated miR-210 and miR-21 in the Hippocampus After I/R. [score:2]
Since increasing evidence suggests that miRNA expression profile in cerebral I/R injury changes significantly, miR-210 and miR-21 in the hippocampus were measured at 6, 24 and 96 h after reperfusion. [score:1]
[1 to 20 of 11 sentences]
50
[+] score: 33
Other miRNAs from this paper: rno-mir-1
Further, microRNA-21 expression was found to be significantly lower in SS animals, and these findings against previous studies showing upregulation of microRNA-21 in response to aortic binding. [score:6]
We observed a strong effect of stenosis on the microRNA-21 expression, in which was down-regulated in the SS group (Figure 5B). [score:6]
Nevertheless, some issues show to be clarified: (i) Is microRNA-21 upregulated in both ventricles in response to chronic elevated afterload? [score:4]
This issue was well reported in studies showing that the PI3K inhibitor abrogated the protective miR-21 effect on myocardial apoptosis (Tu et al., 2013). [score:3]
Figure 5 Exercise training decreases microRNA-1 (A) and normalizes microRNA-21 (B) myocardial expression in PAS animals (SHAM, n = 4; SS, n = 6; TS, n = 6). [score:3]
Thus, it is possible that steady-state microRNA-21 level can mediate inhibition of apoptosis induced by PAS in our trained animals. [score:3]
MicroRNA-21 contributes to myocardial disease by stimulating MAP kinase signalling in fibroblasts. [score:2]
Thum et al. (2008) reported that microRNA-21 knockdown prevented cardiac hypertrophy and fibrosis in response to pressure overload. [score:2]
On the other hand, a restored microRNA-21 level was reported with exercise. [score:1]
Ischemic postconditioning -mediated miRNA-21 protects against cardiac ischemia/reperfusion injury via PTEN/Akt pathway. [score:1]
The simple interpretation of these findings could indicate that the increase in microRNA-21 with exercise would not provide for myocardial remo deling. [score:1]
In this regard, microRNA-21 ablation has been advocated as a beneficial therapeutic to cardiac remo deling. [score:1]
[1 to 20 of 12 sentences]
51
[+] score: 32
Using these hepatocyte and non-hepatocyte cell lines and primary tissues, we performed unsupervised clustering analysis by selecting 7 down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) and 4 up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Total RNA extracted from Dex/OSM treated AR42J-B13 cells (7 Days) and mock controls were used for Northern blot analysis using antisense probes against down-regulated miRNAs (miR-93, miR-106b and miR-130b) and up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Both up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182) and down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) were chosen as a parameter for comparison. [score:7]
Among the 13 up-regulated miRNAs, miR-122a, miR-21, miR-22 were the most enriched in transdifferentiated hepatocytes with a fold change of ∼70, ∼20 and ∼10, respectively (Table 2). [score:4]
As shown in Table 2, we found increased expression of liver specific miRNAs in transdifferentiated hepatocytes, including miR-122a, miR-21, miR-22, miR-182, miR-29 and miR-30. [score:3]
Mature miRNA of miR-93, miR-106b, miR-130b, miR-21, miR-22 and miR-182 were differentially expressed after transdifferentiation. [score:3]
By computer software prediction, HNF-4 binding sites are also present in the 5′ upstream regions of miR-21, miR-30b and miR-30d. [score:1]
[1 to 20 of 7 sentences]
52
[+] score: 31
Among the miRNAs differentially expressed in Liu's study, rno-miR-132-3p, rno-miR-146b-5p, rno-miR-223-3p, rno-miR-21-5p, and rno-miR-214-3p were upregulated, which was just the same as our findings. [score:6]
Out of the 19 reported miRNAs that were dysregulated, miR-21-3p was the only one miRNA identified as the upregulated gene in the above-mentioned two studies. [score:5]
Other investigators showed that miR-21 could inhibit CD40 expression through SIRT1-NF- κB signaling, which might negatively regulate inflammatory processes in renal tubule epithelial cell [19– 21]. [score:4]
Among them, rno-miR-674-5p, rno-miR-672-5p, rno-miR-138-1-3p, and rno-miR-21-3p were significantly expressed and might play important roles in the regulatory network. [score:4]
Among these differentially expressed miRNAs, rno-miR-130b-3p, rno-miR-132-3p, rno-miR-181a-1-3p, rno-miR-222-3p, rno-miR-351-5p, and rno-miR-21-3p had the largest positive fold changes, while rno-miR-335, rno-miR-192-3p, rno-miR-194-5p, rno-miR-192-5p, rno-miR-499-5p, and rno-miR-210-3p had the largest negative fold changes (Table 1). [score:3]
Moreover, miR-21 was regarded as modulatory reaction of oxidative stress since the SOD expression was decreased and ROS formation increased [22]. [score:3]
It prompts us to believe that, no matter whether mediated by hypercalciuria or hyperoxaluria, miR-21 was the common miRNA that was overexpressed in the process of stone formation, which might subsequently cause oxidative stress or stimulate renal tubular epithelial cells apoptosis and tubulointerstitial fibroblast proliferation, thus resulting in the fibrotic dysfunction of kidney by certain downstream signaling pathways such as PTEN/Akt pathway [23]. [score:3]
Recent study suggested that miR-21 might participate in the development of fibrosis via promoting the proliferation of interstitial fibroblasts and increasing the abnormal deposition of the extracellular matrix [18]. [score:2]
With respect to oncogenic miRNA, miR-21 was traditionally regarded as highly associated with variety of tumors, such as breast cancer, ovarian cancer, or urothelial carcinoma [15– 17]. [score:1]
[1 to 20 of 9 sentences]
53
[+] score: 31
Target prediction and pathway analysis identified Notch1 as a possible target in the network of differentially expressed miRNAs and genes in both skin and intestinal T cells, where it is potentially targeted by both miR-21 and miR-326. [score:9]
In particular, downregulation of miR-874 (−2.89-fold change, p = 0.002), mir-20b (−3.37-fold change, p = 0.005), miR-330 (−4.11-fold change, p = 0.006), and miR-326 (−2.22-fold change, p = 0.008), and upregulation of miR-3545-5p (1.97-fold change, p = 0.006), miR-3548 (2.59-fold change, p = 0.006), and miR-21 (3.52-fold change, p = 0.017) was observed. [score:7]
When compared to T cells from peripheral blood, qRT-PCR analyses of purified TCRαβ [+] blood T cells from the same rats indicated a similar expression pattern, with upregulation of miR-21, miR-99a, miR-223, miR-326, and miR-345-5p (Figure 6D), indicating that the GvHD grade during sampling of T cells may be crucial in terms of miRNA expression. [score:7]
Validation by qRT-PCR analysis of miR-874 from another independent experiment showed a trend toward downregulation in intestinal T cells, while miR-21 was not differentially expressed (Figure 6C). [score:6]
As input for the analysis, we chose miR-21, miR-99a, miR-223, miR-326, miR-345-5p, and miR-743b, and also genes involved in GvHD pathogenesis as well as T cell activation, proliferation, and migration. [score:1]
The generated network depicted in Figure 7A demonstrates that miR-21, miR-223, and miR-326 may all interact in the same network of molecular responses related to T cell activation and migration. [score:1]
[1 to 20 of 6 sentences]
54
[+] score: 31
We found that the expression levels of other two miRNAs (i. e., miR-150 and miR-155) were up-regulated only in the vesicular-fraction, while the expression of both miR-21 and miR-33 was found to be up-regulated in RNA isolated from vesicles enriched pellets and down-regulated in the RNA isolated from vesicles -depleted sera. [score:14]
The expression of miRNA associated to regeneration [i. e., miR-21 (P = 0.03) and miR-33 (P = 0.04)] is up-regulated over the analyzed time points reaching the highest-level 6 days after PHx (Fig. 6, middle row). [score:6]
On the other hand, miR-150 and miR-155 were found up-regulated only in the VEP fractions, while miR-21 and miR-33 were found differentially regulated across the two populations. [score:5]
However, the expression of miRNAs associated to infection and inflammation (i. e., miR-150 and miR-155) is unchanged in the VDS fraction (Fig. 7, middle row), while the expression of regeneration -associated miRNAs [i. e., miR-21 (P = 0.01) and miR-33 (P = 0.02)] is significantly reduced in the VDS RNAs. [score:5]
Specifically, we found that the cytokines used in this study significantly increased levels of miR-122, miR-150, miR-21, miR-192 and miR-194 associated to EVs secreted from PCs. [score:1]
[1 to 20 of 5 sentences]
55
[+] score: 30
Since miR-21-3p is related to myocardial hypertrophy and miR-542-3p is regulated to p53 expression and more importantly, both of them were regulated by YQFM, we hypothesized that YQFM might have the effects against cardiac hypertrophy and apoptosis. [score:5]
Targeting miR-21-3p inhibits proliferation and invasion of ovarian cancer cells. [score:5]
miR-21-3p regulates cardiac hypertrophic response by targeting histone deacetylase-8. Cardiovasc. [score:4]
Based on these findings, we presumed that YQFM could alleviate hypertrophy and apoptosis in heart tissue during CHF in order to maintain heart function by regulating the miRNAs expression such as miR-21-3p and miR-542-3p. [score:4]
According to recent reports, miR-21-3p could regulate cardiac hypertrophic response (Bang et al., 2014; Romay et al., 2015; Yan et al., 2015), inflammatory reaction (Yan et al., 2015), vascular reparation (Zahedi et al., 2016), aortic Stenosis (Jing et al., 2016), sepsis -associated cardiac dysfunction and cancer (Báez-Vega et al., 2016; Wang et al., 2016a). [score:2]
The result clearly indicated that the expression of miR-21-3p significantly decreased in MI group compared to sham-operated controls. [score:2]
miR-21-3p controls sepsis -associated cardiac dysfunction via regulating SORBS2. [score:2]
Among them, miR-21-3p, miR216-5p, and miR542-3p are related to myocardial hypertrophy, cancer and apoptosis, respectively. [score:1]
MiR-21-3p and miR-542-3 were further verified by RT-PCR. [score:1]
MiR-21-3p and miR-542-3p were two important altered miRNAs found in YQFM treated group according to miRNA profiling study. [score:1]
However, the p-values of miR-21-3p and miR-542-3p between YQFM treated and MI group are 0.11 and 0.40, respectively, which is not statistical significant. [score:1]
The close relationship between these miRNAs especially for miR-21-3p and miR-542 and myocardial function drew our attention. [score:1]
Finally, as Table 1 showed, seven differentially expressed miRNAs were picked out complying with fold change (fc)≥4 (or ≤1/4) (both Sham group and YQFM group compared to MI group) and Reverse Rate (RR) (YQFM group compared to MI group) between 1 and 2. Finally, miR-21-3p, miR216-5p, miR219a-2-3p, miR381-3p, miR466c-5p, miR542-3p, and miR-702-5p were considered as the differentially reversed miRNAs regulated by YQFM. [score:1]
[1 to 20 of 13 sentences]
56
[+] score: 29
Other miRNAs from this paper: rno-mir-33
The top 10 most significantly differentially expressed miRNAs are listed in Table I. The rno-miR-21-5p and rno-miR-33-5p were the most significantly up- and downregulated differentially expressed miRNAs, respectively (Fig. 1). [score:8]
In the present study, the majority of the 152 differentially expressed miRNAs were upregulated, including miR-21. [score:6]
However, miRNA-21 was significantly upregulated in the present study as a differentially expressed miRNA. [score:6]
A number of previous studies have indicated that the downregulation of miRNA-21 is strongly associated with the processes of tumors or cancer (40– 42). [score:4]
This result indicates that the upregulation of miRNA-21 may be involved in the initiation of the cell signaling pathways associated with epilepsy, which is supported by a study by Marquez et al (43). [score:4]
miRNA-21 is able to mediate tumor growth (39). [score:1]
[1 to 20 of 6 sentences]
57
[+] score: 29
We selected up-regulation of oncogenic miRNAs such as mir-21 as well as down-regulation of the tumor suppressor miRNAs Let-7e, mir-135a, and mir-375 for our analysis. [score:9]
In this study, it remains intriguing that up-regulation of miRNAs such as miR-21 and miR-34a is associated with activation of their target oncoprotein expression after AA treatment for 12 weeks. [score:8]
In order to validate the changes in miRNA expression detected by a deep-sequencing, we conducted quantitative real-time PCR analysis to examine expression levels of six miRNAs including rno-miR-378, rno-miR-182, rno-miR-21, rno-miR-34a, rno-miR-34b, and rno-miR34c. [score:5]
For example, miR-21 was up-regulated in rat kidney. [score:4]
Moreover, the oncogenic miRNA, mir-21 was increased 3.8 fold, whereas the tumor suppressor miRNAs, Let-7e, mir-135a, and mir-375 were decreased by 2.9, 2.7 and 5.9 fold, respectively. [score:3]
[1 to 20 of 5 sentences]
58
[+] score: 29
In this study, we observed an increase in miR-21-5p in HF-rats, in accordance with previous reports showing an upregulation of miR-21 in HF with preserved LV ejection fraction [19] or in fibroblasts of hypertrophied hearts [20]. [score:4]
We observed a significantly increased expression of the 4 other miRNAs in LV, at 7 days post-MI for miR-23a-3p (Fig.   1D), at 2 months post-MI for miR-21-5p (Fig.   1D) and miR-21-3p (Fig.   1A) and at both times for miR-222-3p (Fig.   1D). [score:3]
Our data shows the potential of miR-21-5p, miR23a-3p and miR-222-3p, and their target SOD2, as new biomarkers of post-MI HF. [score:3]
Dong S microRNA-21 promotes cardiac fibrosis and development of heart failure with preserved left ventricular ejection fraction by up -regulating Bcl-2Int. [score:3]
miR-21 is highly expressed in most of the cardiovascular cells, especially cardiomyocytes and cardiac fibroblasts [7]. [score:3]
Interestingly, SOD2 is regulated by 5 of 13 miRNAs selected by IPA, i. e. mir-21-3p, miR-21-5p, miR-23a-3p, miR-145-5p and miR-222-3p (Fig.   1A). [score:2]
Duan X Expression of MicroRNA-1 and MicroRNA-21 in different protocols of ischemic conditioning in an isolated rat heart mo delCardiol. [score:2]
We were unable to quantify detectable levels of miR-21-3p. [score:1]
The same information was found for the circulating levels of miR-21-5p (Fig.   3A, bottom panel) and miR-23a-3p (Fig.   3B, bottom panel). [score:1]
The same information was found for the circulating levels of miR-21-5p (Fig.   3A, right panel). [score:1]
Interestingly, the REVE-2 molecular network previously built with 23 circulating molecules quantified in blood samples of REVE-2 patients, shows that these 3 miRNAs were highly central molecules with the highest betweeness centrality for miR-21-5p and miR-222-3p [17], indicating that they are crucial molecules to maintain functionality and coherence of signaling mechanisms in the REVE-2 network. [score:1]
Our studies based on in vivo rat experimental mo del and in vitro cardiomyocyte mo dels prompted us to assess levels of circulating SOD2 and interacting miRNAS (miR-21-5p, miR-23a-3p and miR-222-3p) in patients with high LV remo deling following MI. [score:1]
In this study, we showed for the first time, that levels of circulating miR-21-5p, miR-23a-3p and miR-222-3p decrease in patients with high remo deling at baseline and increase at 3 months post-MI. [score:1]
In most of these studies, miR-21 is associated with an anti-apoptotic effect 19, 21. [score:1]
Interestingly, miR-21-5p, miR-23a-3p and miR-222-3p were significantly decreased in the plasma of 7 days MI-rats and significantly increased at 2 months post-MI (Fig.   1E) without any modulation of SOD2 in plasma of HF-rats (not shown). [score:1]
Here, we focused on 3 miRNAs, miR-21-5p, miR-23a-3p and miR-222-3p and their target SOD2, detected in plasma that we characterized for their potential as biomarkers of HF. [score:1]
[1 to 20 of 16 sentences]
59
[+] score: 28
In human natural regulatory T cell FOXP3 expression is affected by both miR-21 and miR-31, although the regulation of miR-21 is indirect [52]. [score:6]
MiR-21, miR-31 and miR-488 are down-regulated, while miR-153, miR-135b, miR-135a and miR-298 are up-regulated in secretory-stage enamel formation compared to maturation-stage. [score:6]
For example, miR-21 and miR-31 facilitate invasion and metastasis of colon carcinoma cells by suppressing the same target TIAM1 in TGF-β signaling pathway [51]. [score:5]
Seven differentially expressed miRNAs (miR-21, miR-31, miR-488, miR-153, miR-135b, miR-135a and miR298) in secretory- and/or maturation-stage enamel organs were confirmed by in situ hybridization. [score:3]
1 SLC8A3 -3.8 rno-miR-21/489 5.2/67.0 All fold changes represent the ratio of maturation to secretory phase expression values. [score:3]
The expression patterns of seven selected miRNAs (miR-21, miR-31, miR-488, miR-153, miR-135b, miR-135a and miR-298) were examined (Figure  6E-R). [score:3]
In situ hybridization analyses of miR-21, miR-31 and miR-488 generated higher signal intensities in maturation-stage enamel organ cells than in secretory-stage enamel organ cells (Figures  6E and 4J), and this data correlates well (same directional change) with the miRNA qPCR array data/fold increase (i. e., miR-21, miR-31, miR-488 increased by 5.2, 9.5 and 6.9 fold, respectively) (Additional file 1). [score:2]
[1 to 20 of 7 sentences]
60
[+] score: 28
Addition of UFP-512 suppresses these miRNAs and enhances the expression of a subset of mRNAs targeted by miR-21 and miR-29b. [score:7]
Hypoxia for 1 day reduced miR-21 expression by 40% and the addition of UFP-512 further reduced its expression to 25% of the control levels (Figure 8). [score:5]
The downregulation of miR-21 and miR-29b produced by either hypoxia or DOR activation in 1-day group appeared to be reversed by day 5 unless the two treatments (hypoxia plus DOR activation) were given simultaneously. [score:4]
DOR activation may regulate ionic homeostasis partially via miR-21 since PKCε and several K [+] channels are predicted targets of miR-21. [score:4]
Recent evidence also suggests the miR-21 inhibition of the PKC substrate MARCKS [37]. [score:3]
Relative miRNA expression levels of miR-21 and miR-29b in the kidney following either 1, 5, or 10 days of hypoxia as determined by quantitative RT-PCR. [score:3]
Either hypoxia or UFP-512 alone had no effect of miR-29b at 5 days, but the combination significantly stunted miRNA levels similar to miR-21. [score:1]
After 5 days the hypoxia -induced reduction disappeared, but the combination of hypoxia and UFP-512 produced a dramatic loss of miR-21. [score:1]
[1 to 20 of 8 sentences]
61
[+] score: 27
Other miRNAs from this paper: hsa-mir-21, hsa-mir-145, rno-mir-145
Moreover, elevated miR-21 levels were shown to be positively correlated with: increased expression of pro-proliferative markers (G1/S and G2/M cyclins and cyclin -dependent kinases); low expression of “tumor suppressors” (p21, p27, and pRb); high expression of anti-apoptotic Bcl-2/Bcl-2 dimers; low expression of pro-apoptotic Bcl-2/Bax dimers (caspases 9 and 3); and decreased cytochrome c release from the mitochondria. [score:11]
Conversely, downregulation of miR-21 to levels found in lean-prone animals resulted in significant collateral growth recovery in obese-prone animals, associated with a decrease in VSMC proliferation (66); concomitant with a restoration of apoptosis of neutrophils (67). [score:4]
Interestingly, miR-21 expression was also significantly increased in jejunal enterocytes isolated from obese-prone JCR:LA-cp rat. [score:3]
Collectively, this study established that miR-21 can regulate neutrophil apoptosis and is a required component for successful collateral enlargement. [score:2]
We have recently shown that microRNA (miR)-145 and miR-21 are important regulators of arteriogenesis. [score:2]
miR-21 levels were markedly increased in the heart of obese-prone animals, shown to be positively correlated with VSMC proliferation (66) and decreased apoptosis of neutrophils (66). [score:1]
The concentration of miR-21 in these animals was also increased in intestinal lymph and in the high-density lipoprotein (HDL) fraction isolated from the lymph (66). [score:1]
These results suggest that altered enterocyte lipid and lipoprotein metabolism and/or HDL -dependent lymphatic cholesterol transport may be inter-related to the elevated cardiac miR-21 levels observed in the obese-prone JCR:LA-cp mo del. [score:1]
miR-21 levels in enterocytes were examined because, in the obese-prone animal, the intestine has overproduction of lipids associated with increased secretion of chylomicrons (CM), and HDL is also found in the lymphatics isolated from the intestine (68). [score:1]
miR-21 is well accepted as a major pro-survival and pro-proliferative miR. [score:1]
[1 to 20 of 10 sentences]
62
[+] score: 25
Thirteen miRNAs, including miR-21, were upregulated in early-stage dilated cardiomyopathy, whereas 11 miRNAs including miR-499 were downregulated [39]. [score:7]
MiR-499 and miR-21 were downregulated in LPS -induced cells in a dose- and time -dependent manner, while there was no significant change to miR-1, miR-133, and miR-208 expression. [score:6]
MiR-21 blocked pancreatic β-cell death [28] and miR-183 suppressed apoptosis in esophageal cancer cells [29] by targeting PDCD4. [score:5]
In our previous work, we showed that miR-499 and miR-21 were upregulated in H [2]O [2] -induced cardiomyocyte apoptosis [21]. [score:4]
A known LPS-responsive miRNA, miR-21 [25], was used as the positive control, and showed decreased expression (Fig.   1a). [score:3]
[1 to 20 of 5 sentences]
63
[+] score: 25
miR-21-5p, miR-34a-5p, miR-146b-5p, miR-149-3p, miR-224-5p, miR-451-5p, miR-1949, miR-3084a-3p, and miR-3084c-3p demonstrated more abundant expression and a two-fold or greater significant increase in expression with Cd treatment. [score:5]
miR-21-5p, miR-34a-5p, miR-146b-5p, miR-149-3p, miR-224-5p, miR-451-5p, miR-1949, miR-3084a-3p, and miR-3084c-3p were more abundantly expressed and demonstrated a two-fold or greater increased expression in the Cd-treatment group. [score:5]
We used real-time PCR to confirm the increased expression of miR-21-5p, miR-34a-5p, mir-146b-5p, miR-224-5p, miR-3084a-3p, and miR-3084c-3p in the renal cortices from Cd -treated animals versus the saline controls. [score:3]
Saikumar J. Hoffmann D. Kim T. M. Gonzalez V. R. Zhang Q. Goering P. L. Brown R. P. Bijol V. Park P. J. Waikar S. S. Expression, circulation, and excretion profile of microRNA-21, -155, and -18a following acute kidney injuryToxicol. [score:3]
Previous research demonstrated increased expression of miR-21 in the kidneys of mice with ischemia/reperfusion injury or gentamicin -induced kidney injury, and miR-21 levels were also increased in the urine of patients with acute kidney injury versus healthy patients [37]. [score:3]
Selected miRNAs that demonstrated a statistically significant (p ≤ 0.05) altered expression using µParaflo™ microRNA microarray were validated using the following TaqMan [®] Advanced miRNA assays: miR-21-5p (rno481342_mir), miR-34a-5p (rno481304_mir), miR-146b-5p (rno480941_mir), miR-224-5p (rno481010_mir), miR-3084a-3p (rno481040_mir), miR-3084c-3p (rno481313_mir), and miR-455-3p (rno481396_mir). [score:2]
Cheng Y. Liu X. Zhang S. Lin Y. Yang J. Zhang C. MicroRNA-21 protects against the H [2]O [2] -induced injury on cardiac myocytes via its target gene PDCD4J. [score:2]
The cellular effects of elevated miR-21 on proximal tubule epithelial cells may be both protective and/or damaging as miR-21 has been shown to limit damage resulting from reactive oxygen species and affect apoptosis and fibrosis [20, 38, 39]. [score:1]
As shown in Figure 3, real-time PCR demonstrated a significant increase in the Cd -treated group for the following miRNAs: a 2.7-fold increase in miR-21-5p (Figure 3A), a 10.8-fold increase in miR-34a-5p (Figure 3B), a 2-fold increase in miR-146b-5p (Figure 3C), a 10.2-fold increase in miR-224-5p (Figure 3D), a 2.4-fold increase in miR-3084a-3p (Figure 3E), and a 3.3-fold increase in miR-3084c-3p (Figure 3F). [score:1]
[1 to 20 of 9 sentences]
64
[+] score: 24
Among these 16 genes, two were identified as direct targets of miR-21: SLC12A1 and TCF21, both of which have been reported down-regulated in ccRCC [69, 70]. [score:7]
We found 16 genes down-regulated in tumor, inversely correlated with miR-21 and enriched (via KEGG) in the cell adhesion (CAM) pathway at p = 0.0006. [score:4]
For instance, loss of miR-149, miR-200c and mir-141 causes gain of function of oncogenes (KCNMA1, LOX), VEGFA and SEMA6A respectively and increased levels of miR-142-3p, miR-185, mir-34a, miR-224, miR-21 cause loss of function of tumor suppressors LRRC2, PTPN13, SFRP1, ERBB4, and (SLC12A1, TCF21) respectively. [score:3]
For example, miR-21, miR-210 and miR-155 reduce pro-apoptotic signaling in response to a hypoxic environment and are consistently over-expressed in a variety of human tumors (Table 1). [score:3]
B-E. Agilent chip expression levels of miR-200c, miR-244, miR-34a and miR-21 versus the levels of mRNA that they regulate: VEGFA, ERBB4, SFRP1 and SLC12A1 respectively as measured by qRT-PCR for 12 validation set samples The dark circles represent the values in ccRCC and the light circles in normal kidney. [score:2]
As the p-values in Figure 4 indicate, we validate a strong anti-correlation signature between mRNA levels of (KCNMA1, LOX), VEGF, SEMA6A, (LRRC2, PTPN13), SFRP1, ERBB4, SLC12A1 and TCF21, and their identified regulators: miR-149, miR-200c, mir-141, miR-142-3p, miR-185, mir-34a, miR-224 and miR-21 respectively. [score:2]
In Figure 3B-E, we plot the qRT-PCR expression levels of ERBB4, SFRP1, SLC12A1 and VEGFA versus Agilent chip measured levels of their regulatory microRNA (miR-224, miR-34a, miR-21 and miR-200c) for the twelve samples of Figure 3A. [score:2]
We found that hypoxia related microRNA had the most significant fold changes, with miR-210, miR-155 and miR-21 being amongst the top. [score:1]
[1 to 20 of 8 sentences]
65
[+] score: 24
Other miRNAs from this paper: rno-mir-132, rno-mir-145, rno-mir-214, rno-mir-222, rno-mir-223
For example, miR-21 promotes neurite outgrowth by directly down -regulating Sprouty2 expression; while miRNA-145 inhibites neurite outgrowth by inhibiting Robo2 expression. [score:11]
For example, miR-223 is highly expressed in neutrophils that are present in the spinal cord during the early phase of spinal cord injury [30]; miR-132 regulates dendritic spine morphology and synaptic physiology, contributes to the maturation of dendrites in newborn neurons in the adult hippocampus, and impacts the plasticity of visual cortex circuits [31], [32]; miR-21 is highly expressed in the spinal cord and DRGs following traumatic injury, thus promoting neurite outgrowth by down -regulating expression of Sprouty2 protein [18], [25]. [score:9]
Several miRNAs, including miR-222 as well as miR-21 and miR-214, have been established as regulators of PTEN expression [41], [42]. [score:4]
[1 to 20 of 3 sentences]
66
[+] score: 23
Since dysregulation of miRNAs such as miR-21 is directly linked with cardiac diseases like ischemic heart disease and since resveratrol can ameliorate myocardial ischemic reperfusion injury through the modulation of several miRNAs, the results of the present study explains the mechanism of complex regulatory network mediated by resveratrol through miRNA in cardioprotection. [score:8]
There was a tremendous upregulation of miR-21 expression in basal level controls with resveratrol (up 391.4) and longevinex (760.9) which was lowered considerably in IR (up 61.5 and 59.3). [score:6]
Differential expression was observed in over 25 miRNAs, some of them, such as miR-21 were previously implicated in cardiac remo deling. [score:3]
J Exp Clin Cardiology In Press 24 Thum T Gross C Fiedler J Fischer T Kissler S 2008 MicroRNA-21 contributes to myocardial disease by stimulating MAP kinase signalling in fibroblasts. [score:2]
miR-21 were shown to regulate the ERK-MAP kinase signalling pathway in cardiac fibroblasts, which has role on global cardiac structure and function [24]. [score:2]
Longevinex exceeded the effect of resveratrol in 15 of the 25 miRNAs including miR-10a, miR-20b, miR-21. [score:1]
Treatment with resveratrol in cancer cell line SW480 results in decreased level of miR-21 and miR29c whereas it was increased in healthy heart when treated with resveratrol. [score:1]
[1 to 20 of 7 sentences]
67
[+] score: 23
Other miRNAs from this paper: rno-mir-146a, rno-mir-223, rno-mir-155
Interestingly, the combined upregulation of miR-21 and downregulation of mR-155 may possibly be responsible of high carb diets (in this case sucrose) mediating the adipose tissue expansion. [score:7]
Also, upregulated miR-21 levels in serum are associated with nonalcoholic fatty liver disease, especially in men [20]. [score:6]
Chronic ingestion of sucrose induced the upregulation of miR-21 and miR-223 in plasma and EVs. [score:4]
The changes observed in miR-21 total plasma and EVs, upon sucrose chronic exposure, are likely associated with the increased adipose tissue mass. [score:1]
This miRNA may have a role in sustaining adipose tissue expansion as reported in a study using miR-21 antagomiRs in the db/db mice [22]. [score:1]
For the miR-21 levels, only a trend for higher abundance was found in the sucrose group (p = 0.057) (Figure 3). [score:1]
Previous reports show that miR-21 levels increase in the white adipose tissue of mice with high fat diet -induced obesity and during human adipocyte stem cells proliferation [19]. [score:1]
Such is the case of miR-21, miR-146a, miR-155, and miR-223 [9– 11]. [score:1]
The relative abundance of miRNAs present in plasma EVs was miR-223 > miR-21 > miR-155 > miR-146a (Figure 3). [score:1]
[1 to 20 of 9 sentences]
68
[+] score: 22
0172429.g005 Fig 5 The expression levels of miRNAs miR-107, miR-181c, miR-103, miR-101, miR-29a, miR-21 and miR-9 expression levels were down-regulated in the serum of diabetic rats and IOMe -injected rats (A). [score:8]
The expression levels of miRNAs miR-107, miR-181c, miR-103, miR-101, miR-29a, miR-21 and miR-9 expression levels were down-regulated in the serum of diabetic rats and IOMe -injected rats (A). [score:8]
The expression levels of miR-107, miR-181c, miR-103, miR-101, miR-29a, miR-21 and miR-9 were significantly down regulated in the blood serum of diabetic and IOMe -injected rats (Fig 5A) whereas, the expression levels of these miRNAs are normally high. [score:6]
[1 to 20 of 3 sentences]
69
[+] score: 22
For example, the expression of tumor suppressor genes, like PTEN [26] and P53 [27], which are the targets of miR-21 and miR-34c, were significantly reduced in the premalignant foci and HCC nodules [28]. [score:7]
Similarly, the expression of oncogenic miRNAs like miR-21, miR-10b, let-7i, miR-34c, were increased more than 2 fold in EpCAM [+] liver cancer cells; whereas miR-125b, miR-200a, miR-148b were most down-regulated. [score:6]
miR-21, miR-10b and miR-34c have been reported to be upregulated in various types of cancers, including HCC [25]. [score:4]
Our previous report also revealed that the relative expression levels of miR-92b, miR-21, miR-34c, miR-10b, and let-7i in EpCAM [+] liver cancer cells compared to fetal liver cells were increased (P<0.05). [score:2]
Our data showed that the mir-92b might contribute to the malignant transformation of the liver stem cells, which may be a new valuable marker of HCC, and the analogy between the already confirmed miRNAs such as antioncogene mir-200a [45] or Oncogene mir-21 [46]. [score:1]
miRNA-200a and miR-21 were found to be involved in the malignant transformation of liver stem cells. [score:1]
In our later study, we are planning to combine the miR-92b with miR-200a or miR-21 to search for the mechanisms of malignant transformation. [score:1]
[1 to 20 of 7 sentences]
70
[+] score: 22
Next, the expression of four endogenous miRNAs (miR-122, miR-192, miR-21 and miR-16) was analyzed by qPCR, showing that the detection of the analyzed targets sequence is linear (as shown by the linear regression R [2]). [score:5]
Additionally, our data indicate that administration of FGF4 along with IL-1α and INF-β significantly down-regulates miR-21, which regulates cell cycle progression during mouse liver regeneration 47. [score:5]
Of note, miR-21, a well-characterized oncomiR regulating cell cycle progression 47, is significantly down-regulated by FGF4, IL-1α and INF-β administration, suggesting a potential tumor-suppressor or anti-proliferative activity of these factors on hepatocytes. [score:5]
Microarray analysis identified a panel of miRNAs, which are either highly expressed in the heart (miR-1, miR-133a and miR-16) or in the liver (miR-122, miR-192 and miR-194) or invariant (miR-21; Supplementary Figure 1a). [score:3]
As proof of principle, miRNA-specific primers targeting miR-122-5p, miR-122-3p and miR-21-5p were designed following the standard miQPCR design and without the additional 3′ end ‘G’ (for sequences see Supplementary Table 1a). [score:2]
To identify whether miQPCR primer design is able to discriminate between mature miRNAs and their precursors miRNA-specific primers targeting miR-122-5p, miR-122-3p and miR-21-5p were designed according to the standard miQPCR design protocol (i. e. containing a 3′ end ‘G’ overlapping with the miLINKER) or without miLINKER overlap. [score:1]
Total RNA from heart or liver were reverse transcribed according to the miQPCR and TaqMan protocols and the expression of 7 miRNAs (miR-1, miR-133b, miR-16, miR-122, miR-194 and miR-21) and a small nuclear RNA (RNU6) was measured by qPCR with respectively SYBR-Green (top panel) or TaqMan probes (lower panel). [score:1]
[1 to 20 of 7 sentences]
71
[+] score: 21
For example, miR-21 overexpression in the murine monocytes attenuated cytokine -induced inflammation and lipid accumulation, whereas upregulation of miR-21 in human endothelial cells enhanced the inflammatory response [44]. [score:6]
As depicted in Fig 6, among the miRNAs elevated in serum in our study, LPS has been shown to increase expression of miR-10a, miR-100, miR-508/511, miR-30c, and miR-125b in human fibroblast-like synoviocytes [41], increase expression of miR-146a in a human monocyte cell line [42], and increase miR-21 in cultured murine monocytes [43]. [score:5]
Paradoxically, enhanced muscular fibrosis accompanies decreased expression of PAI-1 attributed to miR-21 inhibition in an engineered murine mo del of muscular dystrophy [45]. [score:5]
Included among the 46 miRNAs with increased expression were 7 (miR-21, miR-16, miR-26a, miR-26b, miR-23a, miR-23b, miR-126) included in surveys of the most abundant miRNAs in human platelets [23, 24] and the miR-126 gene products miR-126-3p and miR-126-5p that are also enriched in vascular endothelial cells and endothelial microparticles [25]. [score:3]
Most had peak increases relative to controls at the 8-hour (n = 21) or 24-hour (n = 21) post-treatment time points, with one miRNA (miR-23a) having peak increase at the 1-hour time point, one miRNA (miR-363) having a peak increase at the 4-hour time point, and 2 miRNAs (miR-21, miR-99) with peak increases at the 48 hour time point. [score:1]
Among the individual miRNAs previously associated with endothelial cell and monocyte activation and sepsis in humans and rodents [27– 29], we found increases in our study of miR-16, miR-21, miR-126, miR-146a, miR-150, miR-511, and miR-23b. [score:1]
[1 to 20 of 6 sentences]
72
[+] score: 20
In contrast, expressions of mir-21 and mir-320 were significantly downregulated and GS-Rb1 incubation in mo del group could reverse the differences in a certain extent. [score:6]
Mir-21 is another cardiac enriched microRNA, which has been proved to be involved in ischemic heart disease, myocardial remo deling, and vascular proliferative diseases [29]. [score:4]
Overexpression of mir-21 plays an important role during cardiomyocytes apoptosis and ischemia/reperfusion- (I/R-) induced heart damages [30, 31]. [score:3]
The expression level of mir-1, mir-29a, and mir-208 was increased in the H/I group (5.9-, 3.4-, and 9.3-fold versus control, relatively), while that of mir-21 and mir-320 was significantly decreased (0.35- and 0.41-fold versus control, relatively). [score:3]
Our results showed that mir-21 and mir-320 significantly decreased in the H/I injured cardiomyocytes and increased by GS-Rb1 treatment following H/I, which suggested that mir-21 and mir-320 might be the potential microRNA targets of GS-Rb1 to protect cardiomyocytes. [score:3]
Mir-320 has the familiar function with mir-21. [score:1]
[1 to 20 of 6 sentences]
73
[+] score: 20
This alteration could explain the down-regulation of the neuron-specific miRNA, miR-124 [21]; similarly, astrocyte activation upon injury might be a consequence of the up-regulation of miR-21 [22]. [score:7]
We found that miR-21 and miR-221 were upregulated in the ipsilateral ventral horn after ventral combined with dorsal root avulsion. [score:4]
This result is consistent with the study by Bin Yu et al., who showed that miR-21 and miR-221 were upregulated in the dorsal root ganglia after resection of the sciatic nerve in rats [30]. [score:4]
Ventral combined with dorsal root avulsion resulted in a sustained upregulation of 10 miRNAs, including miR-19b-3p, miR-20b-5p, miR-21-5p, miR-27a-3p, miR-29b-3p, miR-106b-3p, miR-142-3p, miR-322-5p, miR-352, and let-7a-5p (Figure  2E). [score:4]
Eleven of the miRNAs, including miR-21-5p, demonstrated a sustained increase; however, only miR-466c-3p presented a sustained decrease 3 and 14 days after the injury. [score:1]
[1 to 20 of 5 sentences]
74
[+] score: 20
Several of the progression -associated miRNAs identified mirror those found to be changed during progression in human normal, DCIS, and IDC breast cancer samples, including an upregulation of miR-21 and a downregulation of miR-10b, miR-125b, and miR-126 [15]. [score:7]
The majority of these progression -associated miRNAs, including miR-10a, miR10b, miR-124, miR-125b, miR-126, miR-145, were increasingly downregulated with increasing lesion severity, while 2 miRNAs, miR-21 and miR-200a, were upregulated with advancing tumor progression. [score:7]
The 8 miRNAs we found from our profiling (specifically, miR-10a, miR-10b, miR-21, miR-124, miR-125b, miR-126, miR-145, and miR-200a) each showed progressive changes in expression with advancing lesion grade. [score:3]
However, the expression of miR-21 and miR-200a increased throughout progression, a pattern that suggests these miRNAs function as oncomiRs in this mo del. [score:3]
[1 to 20 of 4 sentences]
75
[+] score: 19
As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice. [score:7]
Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice. [score:7]
The adipogenic miR-21 has also been demonstrated to be upregulated in human obesity [33] and to enhance adipogenesis in human adipose tissue-derived mesenchymal stem cells (hASCs) by mediating TGF-β signaling [34]. [score:4]
Some of the circulating miRNAs identified in this study have also been reported in the adipose tissue of DIO mice or implicated in adipogenic processes [11– 13], including Let-7, miR-103, miR-15, the miR-17-92 cluster (miR-17, miR-20a, and miR-92a), miR-21, miR-221, and miR-30b. [score:1]
[1 to 20 of 4 sentences]
76
[+] score: 19
Bish et al. [14] reported that strong cardiac shPLB expression in canines altered the expression of several miRs and induced toxic side effects such as transiently increased serum levels of troponin I. To investigate whether scAAV6-shPLBr and scAAV6-amiR155-PLBr treatment might affect the expression levels of selected cardiac miRs that had been analyzed in the in vivo study of Bish et al. [14], the levels of miR-1, miR-21, miR-124, miR-195 and miR-199a were determined in CM at day 14 after transduction with 25×10 [3] vg/c of scAAV6-shPLBr, scAAV6-amiR155-PLBr, scAAV6-shCon or scAAV6-amiR155-Con. [score:5]
To analyse the expression of miR-1, miR-21, miR-124, miR-195, and miR-199a, 10 ng of total RNA, isolated from CM, were reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit (Life Technologies, Applied Biosystems Inc. [score:3]
Both miR-21 regulation as well as PLB-SERCA2a interaction are known to be regulated via β-adrenergic receptor signaling [57], [58]. [score:3]
Another interesting finding of the miR analysis was a significantly higher expression of miR-21 in CM after treatment with PLB silencing vectors as compared to the respective control vectors. [score:2]
Thus our data suggest that PLB-SERCA2a system could be an upstream regulator of miR-21 in the β-adrenergic signaling cascade. [score:2]
Expression levels were determined by real-time PCR using the TaqMan MicroRNA Assays rno-miR1, hsa-miR21, hsa-miR124, hsa-miR195 and hsa-miR199a (Life Technologies, Applied Biosystems Inc. [score:2]
MiR-21 is overexpressed in many tumors and considered as key regulator of oncogenic processes [54]. [score:2]
[1 to 20 of 7 sentences]
77
[+] score: 18
miR-21 was found to be induced in response to high glucose [36, 37] and targets the tumor suppressor protein phosphatase and tensin homolog deleted in chromosome 10 (Pten), which plays important roles in liver glucose metabolism, lipogenesis, steatohepatitis, and hepatocellular carcinoma [38– 40]. [score:5]
By contrast, miR-26b-5p, miR-199a-3p, miR-377–3p, miR-let-7f-5p, miR-200a-3p, miR-21–5p, miR-152–3p, and miR-192–5p expressions were repressed by SO diet consumption. [score:3]
Other validated target of miR-21 are the fas ligand (Faslg) [41], Pdcd4 [42], and Tiam1 [43] which are also related to diabetes [42, 44]. [score:3]
Other validated targets of miR-21 related to diabetes are the fas ligand (Faslg), Pdcd4 and Tiam1. [score:3]
miR-21 targets Pten, which is involved in liver glucose metabolism and other related process. [score:3]
Likewise, we observed a decrease in the expression of several hepatic miRNAs, namely miR-192–5p, miR-10b-5p, miR-377–3p, and miR-215 after FO compared with OO and PO diets and miR-21–5p and mir-26b-5p after FO compared with PO diets. [score:1]
[1 to 20 of 6 sentences]
78
[+] score: 18
For example, it has been shown that miR-21 expression is downregulated in early diabetic nephropathy [41], while miRNA-15a is closely associated with polycystic kidney disease [42]. [score:8]
Treatment with triptolide enhanced expression of five miRNAs (rno-miR-146b-5p, rno-miR-20b-5p, rno-miR-142-3p, rno-miR-223-3p, and rno-miR-21-5p), while that of five other miRNAs (rno-miR-668, rno-miR-203-3p, rno-miR-382-5p, rno-miR-344b-3p, and rno-miR-30b-3p) was significantly downregulated (Tables 3 and 4, and Figure 8). [score:6]
For example, in rats with ischemic acute kidney injury (AKI), miR-21 was induced after renal ischemia in kidney tissues, and miR-494 was upregulated [21, 22]. [score:4]
[1 to 20 of 3 sentences]
79
[+] score: 18
Cluster analysis of over-expressed miRNAs (Figure S1A) and under-expressed miRNAs (Figure S1B) indicated that some deregulated miRNAs might play their roles in groups, such as up-regulated miR-10b and miR-21 and down-regulated miR-200a* and miR-148b*. [score:12]
In this study, miR-10b, miR-21 and miR-92b were frequently over-expressed. [score:3]
MiR-21 has been demonstrated to target PTEN [52] and results in the further modulation of HCC cell migration and invasion. [score:2]
Brain Res In press 67 Folini M Gan dellini P Longoni N Profumo V Callari M 2010 miR-21: an oncomir on strike in prostate cancer. [score:1]
[1 to 20 of 4 sentences]
80
[+] score: 17
We observed that the expression of miRNA-21 was upregulated in the stimulated astrocytes. [score:6]
Due to the critical function of miRNA-21 in various inflammatory signaling pathways, miRNA-21 has become an attractive and promising target in inflammation-related diseases. [score:5]
Ziu et al. [14] found upregulation of miRNA-21 in the astrocytes exposed to OGD. [score:4]
Also miRNA-21 has a novel role in regulating astrocytic hypertrophy and glial scar progression after spinal cord injury [44]. [score:2]
[1 to 20 of 4 sentences]
81
[+] score: 17
The most upregulated miRNAs were miR-146a-5p, miR-132-5p, miR-21-5p at 1.63, 1.61, and 1.56-fold of the control, respectively, while the most downregulated miRNAs were miR-29b-3p, miR-352, miR-30e-5p at 0.60, 0.70, and 0.72-fold of the control, respectively. [score:7]
The most upregulated microRNAs were miR-132-3p, miR-212-3p and miR-21-5p, which were increased by 1.75, 1.83 and 1.89-fold respectively. [score:4]
Changes in the expression of miR-21 and miR-34a were found in our study and in a study by Risbud and Porter using the hippocampus from epileptic rats [25]. [score:3]
The largest increases in expression occurred in miR-212-3p, miR-132-3p and miR-21-5p at 1.54, 1.52 and 1.41 fold of the control levels respectively (Table 1). [score:3]
[1 to 20 of 4 sentences]
82
[+] score: 17
The unique miRNA expression patterns distinguishing the ASH group from the control group were composed of six downregulated (miR-199a-3p, miR-214, miR-93, miR-146a, miR-191 and let-7b) and six upregulated (miR-129, miR-490, miR-21, miR-503, miR-183 and miR-185) miRNAs. [score:9]
As expected, several miRNAs, including miR-185 (10) and miR-21 (12), which were identified to be differentially expressed in ALD patients by microarray, were also identified as differentially expressed in ALD in this animal mo del study. [score:5]
Chronic ethanol feeding was observed to alter the expression levels of several miRNAs during liver regeneration, including miR-34a, miR-103, miR-107, miR-122 (11) and miR-21 (12). [score:3]
[1 to 20 of 3 sentences]
83
[+] score: 17
MiRNAs exhibiting old-age expression included miR-21, miR-146a (Figure  6A,C), and members of the miR-29 family (miRa/b/c), which exhibit low expression at young age with increasing expression at older ages (78 and 104 weeks) (Figure  5J-L). [score:7]
Of the nine miRNAs in this IRI-specific expression signature, six showed differential expression in our study (four of which exhibited increasing expression with age, including miR-21, miR-146a, miR-192, and miR-194) (Figure  6). [score:7]
Although miR-21 exhibited a conspicuous pattern of higher expression in males compared to females at 78 and 104 weeks (both ages exhibiting >1.5 fold difference), the sex difference was not statistically significant. [score:2]
For example, nine miRNAs (miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805, and miR-194) have been identified in C57BL/6 mice as promising biomarkers of kidney injury after renal ischemia reperfusion injury (IRI) [15]. [score:1]
[1 to 20 of 4 sentences]
84
[+] score: 16
It was reported that IPre up-regulated miR-1, miR-21 and miR-24, and the protein expression of HSP70 was up-regulated by pretreatment of these miRNAs. [score:9]
MiR-320 was down-regulated, while miR-21, miR-146b and miR-491 were up-regulated after IR injury [16]. [score:7]
[1 to 20 of 2 sentences]
85
[+] score: 16
PDCD4 has been wi dely reported to be regulated post-translationally by mTOR/p70S6kinase/β-TRCP dependent proteasomal degradation and post-transcriptionally by miR-21 [50], [63]. [score:4]
At this point, though the mechanism is not clear, we speculate that during a global inhibition of de novo mRNA synthesis using Act D, miR-21 biogenesis could also be affected. [score:3]
To note, Lu et al. [52] has reported that miR-21 translationally represses PDCD4 as against the normal post-transcriptional based silencing. [score:3]
n = 3. In view of the fact that PDCD4 is regulated by miR-21 [51], [52], we next determined if ethanol regulates PDCD4 at the post-transcriptional level. [score:3]
Given these facts, in this context, we hypothesize an Act-D induced miR-21 reduction might relieve the translation check that it had on PDCD4. [score:3]
[1 to 20 of 5 sentences]
86
[+] score: 16
The analysis based on their fold changes showed a significant (P < 0.05) upregulation of miR-200c-3p (predicted to regulate IL-13 and VEGF-alpha), miR203a-3p (predicted to regulate IL-24 and PRKC α), miR29-3p (predicted to regulate TNFRS1A), and miR-21-5p (predicted to regulate NFk-B activity), in ocular tissues of LPS+RvD1 -treated rats compared to the vehicle+LPS group (Figure 4). [score:7]
These were miR-21-5p that is predicted to regulate NFk-B activity; miR-200c-3p that is predicted to negatively regulate IL-13, LEPR, NTF3, PRKC α, RIPK2, and VEGFA indicating decreased of proinflammatory cytokines [29]; miR-203a-3p predicted to regulate IL-24 and PRKC α; miR-29b-3p predicted to negatively regulate HDAC4, IL-1RAP, Lif, PDGF α, PDGFc, VEGFA, and TNFRSF1. [score:5]
Interestingly, upregulation of miR29-3p and miR-21-5p induced by RvD1, significant already at the lowest dose of 10 ng/kg, was concomitant with the decrease of TNF- α and NF- κB levels in the ocular tissue (Figures 5 and 6). [score:4]
[1 to 20 of 3 sentences]
87
[+] score: 16
miR-21 AGO2 immunoprecipitation miRNA target T-lymphocytes • Analysis of purified RISC complexes with associated miRNAs and bound mRNA targets offers an approach to identify functional miRNA targets based on their physical interaction in vivo. [score:7]
• These data significantly extends the number of bona-fide miR21-target genes • This dataset could be analysed in conjunction with other AGO2 RNA IP datasets to compare the effectiveness of different techniques to identify new miRNA targets The Affymetrix mRNA profile data are provided as CEL files deposited on GEO (GSE37212)(doi:10.1016/j. [score:5]
RNA was extracted from miR-21 over -expressing Jurkat cells (pRRL-21) and matched control cell line (pRRL-Ctrl). [score:3]
1 C. Carissimi, N. Carucci, T. Colombo, S. Piconese, G. Azzalin, E. Cipolletta, F. Citarella, V. Barnaba, G. Macino, V. Fulci, miR-21 is a negative modulator of T-cell activation, Biochimie, vol. [score:1]
[1 to 20 of 4 sentences]
88
[+] score: 15
MicroRNA-21 has an inhibitory effect on sprouty 1 (Spry1), phosphatase and tensin homolog (PTEN) and Smad 7, all known to suppress the TGF- β1 signaling pathway (Zhang et al. 2007; Thum et al. 2008; Roy et al. 2009; Adam et al. 2012; Li et al. 2013), therefore increases in may lead to an upregulation of TGF- β1 signaling. [score:7]
MicroRNA-21 and microRNA-29 are among the most abundantly expressed microRNAs in heart and are known to regulate fibrosis by their action on mRNA of extracellular matrix proteins and TGF- β1 (van Rooij et al. 2008; Liang et al. 2012). [score:4]
Adam O Lohfelm B Thum T Gupta SK Puhl SL Schafers HJ Role of miR-21 in the pathogenesis of atrial fibrosisBasic Res. [score:1]
microRNA-21. [score:1]
MicroRNA-21 mRNA expression level in MI+AST-120 group was significantly lower compared to the MI+Veh group (P < 0.05, Fig. 2A). [score:1]
Also, an important question, whether the uremic toxin IS promotes myocardial fibrosis by altering cardiac TGF β1-microRNA-21 and/or TGF β1-microRNA-29b signaling remains unexplored. [score:1]
[1 to 20 of 6 sentences]
89
[+] score: 15
To better understand the biological processes linked to differentially expressed miRNAs and their predicted target genes, we constructed an interaction network where rno-miR-674-5p, rno-miR-672-5p, rno-miR-138-5p and rno-miR-21-3p were found to be highly connected, which means that they may play crucial roles in the regulatory network. [score:6]
Interestingly, Wang et al. (2011) reported that miR-674-5p was able to stimulate the expression of osteogenic marker genes; miR-138-5p is a risk factor for pancreatic cancer (Yu et al., 2015) and Alzheimer’s disease (Lugli et al., 2015); and miR-21-3p increases resistance to cisplatin in a range of ovarian cell lines (Pink et al., 2015). [score:5]
Rno-miR-674-5p, rno-miR-672-5p, rno-miR-138-5p, and rno-miR-21-3p had high degrees of connectivity and may play crucial roles in this regulatory network. [score:2]
Rno-miR-674-5p, rno-miR-672-5p, rno-miR-138-5p, and rno-miR-21-3p were found to have the highest degrees of connectivity. [score:1]
control rats (Table 1 and Table S2); of these rno-miR-184, rno-miR-21-3p and rno-miR-672-5p had the largest positive fold changes, while rno-miR-484, rno-miR-138-1-3p and rno-miR-201-3p had the largest negative fold changes. [score:1]
[1 to 20 of 5 sentences]
90
[+] score: 14
Cheng et al. [2] reported that miR-21 inhibits cell death under H/R conditions by regulating expression of the programmed cell death 4 (PDCD4) gene, which is also targeted by miR-499 [2]. [score:8]
According to recent studies, miRs regulate cells or tissues exposed to myocardial infarction or ischemia, with reports finding that miR-21 protects hearts from ischemic injury via PDCD4 expression [2], miR-361 transfected into rat hearts causes mitochondrial fission and myocardial ischemic injury [36], and miR-30b protects cardiomyocytes by inhibiting cyclophilin D [3]. [score:6]
[1 to 20 of 2 sentences]
91
[+] score: 14
12 of these miRNAs were ≥50% up-regulated in both groups with particularly strong increases in expression for miR-199a, miR-21, miR-214, miR-221, miR-222, and miR-31 (Figure 2B). [score:6]
Several miRNAs, including miR-21, miR-27, miR-31, miR-199a, miR-214 and miR-222 were up-regulated in these mouse mo dels in the same directions and to similar extents as observed in this study [11], [18]. [score:5]
Effect of altered cardiac workload on heart weight and the expression of miR-145 and miR-21. [score:3]
[1 to 20 of 3 sentences]
92
[+] score: 14
Ahn et al. showed that lycopene inhibits hepatic steatosis by normalizing miR-21 expression, which was down-regulated in hepatic steatosis [36]. [score:8]
Ahn J. Lee H. Jung C. H. Ha T. Lycopene inhibits hepatic steatosis via microRNA-21 -induced downregulation of fatty acid -binding protein 7 in mice fed a high-fat diet Mol. [score:6]
[1 to 20 of 2 sentences]
93
[+] score: 14
For liver cancer, one recent study reported that miR-21, miR-31, miR-122, miR-221, miR-222 were significantly up-regulated in HCC tissues, whereas miR-145, miR-146a, miR-200c, and miR-223 were found to be down-regulated [15]. [score:7]
For instance, some miRNAs, such as miR-29, miR-21 and miR-221, has been reported to regulate tumor cell growth, apoptosis, migration and invasion by targeting proteins involved in those cellular pathways [7- 9]. [score:4]
However, authors concluded that high level of miR-21, miR-31, miR-122, and miR-221 expression was correlated with cirrhosis but only miR-21 and miR-221 were associated with tumor stage. [score:3]
[1 to 20 of 3 sentences]
94
[+] score: 13
Of the 50 miRNAs differentially regulated in chronic hypertension, miR-21 was the most upregulated and was used as a positive control in our analysis. [score:5]
In summary, we found that the expression of miR-21, -132 and -212 were up-regulated by 3.4-, 1.4- and 1.8-fold, respectively, in the left ventricle of AngII -induced hypertensive animals, as compared to controls (Figures 2A and S1). [score:5]
miR-21, miR-155 and miR-221/222 have recently been shown to regulate AngII signaling in cardiac fibroblasts [14– 16] and in endothelial cells [17], while miR-29 regulates fibrotic pathways [18]. [score:3]
[1 to 20 of 3 sentences]
95
[+] score: 13
Other miRNAs from this paper: rno-mir-34a, rno-mir-127, rno-mir-378a, rno-mir-378b
For example, up-regulated miR-21 was reported to be involved in regulating the proliferative phase of LR by targeting Pellino-1 (Peli1) [8] and B-cell translocation gene 2 (Btg2) [9], Down-regulated miR-378 has a regulatory role by inhibiting DNA-synthesis-promoting gene ornithine decarboxylase (Odc1) during the early phase of LR [9]. [score:13]
[1 to 20 of 1 sentences]
96
[+] score: 12
Other miRNAs from this paper: rno-mir-23b, rno-mir-34a
For instance, miR-21 expression was up-regulated during the early phases of LR, which inhibits Peli1 and potentially regulate NF-κB signaling [15]; miR-23b was down-regulated in the termination phase of LR, and may contribute to activation of the TGF-β1/Smad3 signaling [16]. [score:12]
[1 to 20 of 1 sentences]
97
[+] score: 12
Other miRNAs from this paper: rno-mir-126a, rno-mir-192, rno-mir-210, rno-mir-126b, rno-mir-155
Saikumar et al. [22] demonstrated that kidney miR-21 and miR-155 were upregulated after IRI, while blood miR-21 and miR-155 were downregulated. [score:7]
A study on 120 adult patients undergoing cardiac surgery showed that miR-21 levels in the urine and plasma were upregulated in AKI patients and both were associated with AKI progression [16]. [score:4]
The areas under the curve (AUCs) for urine and plasma miR-21 associated with established AKI were 0.68 (95% CI: 0.59–0.78) and 0.80 (95% CI: 0.73–0.88), respectively [16]. [score:1]
[1 to 20 of 3 sentences]
98
[+] score: 11
For instance, miR-17~92 facilitated LR in an oestrogen -dependent manner [16], an increased expression of miR-34a led to inhibited hepatocyte proliferation during the late phase of LR [17], and miR-21 was upregulated in the early stage of LR, which targeted Pellino-1 to regulate NF-kappaB signaling [18]. [score:11]
[1 to 20 of 1 sentences]
99
[+] score: 11
In the mo del group, 17 miRNAs were downregulated, including miR-1, miR-133, miR-29, miR-126, miR-212, miR-499, miR-322, miR-378, and miR-30 family members, whereas the other 18 miRNAs were upregulated, including miR-21, miR-195, miR-155, miR-320, miR-125, miR-199, miR-214, miR-324, and miR-140 family members. [score:7]
Among these differentially expressed miRNAs, miR-1, miR-133, miR-29, miR-126, miR-499, miR-30, miR-21, miR-195, miR-155, miR-199, miR-214, and miR-140 have been reported to be related to MI [25– 36], while the other miRNAs have not been reported directly in MI. [score:4]
[1 to 20 of 2 sentences]
100
[+] score: 11
Other miRNAs from this paper: rno-mir-146a, rno-mir-155
And it has been reported that acupuncture can down-regulate the expression of miR-21, NF-γB p65 and miR-155 and up-regulate the expression of miR-146a in rats with CAG [16]. [score:11]
[1 to 20 of 1 sentences]