sort by

67 publications mentioning rno-mir-199a

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-199a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 285
Our major findings are: (1) cardiac miR-199a-5p expression was increased in the HF heart tissues compared with the sham-operation group, and JunB expression was relatively lower in the HF group; (2) mir-199a-5p expression increased and JunB expression decreased after stimulation with Ang II; (3) miR-199a-5p promoted apoptosis induced by Ang II stimulation; (4) Jun B was a direct target of miR-199a-5p; and 5) JunB played a protective role in myocardial apoptosis. [score:11]
The expression level in the overexpression group was significantly higher than that in the normal control group (P < 0.01), and miR-199a-5p expression was suppressed in the inhibitor group (P < 0.01) compared with the normal control group (Fig.   4B). [score:10]
MiRNAs inhibit the expression of their target genes by binding to the seed sequence in the 3′UTR of the gene, and JunB was predicted to be a potential target gene for miR-199a-5p through bioinformatics analysis. [score:9]
Also, miR-199a-5p promotes Ang II -induced cell apoptosis in vitro and directly suppresses the expression of its target JunB. [score:8]
In the present study, we first showed that JunB expression was repressed by Ang II and downregulated in H9C2 cells once miR-199a-5p expression was increased. [score:8]
Therefore, we conclude that miR-199a-5p promotes apoptosis by enhancing the expression of pro-apoptotic genes and suppressing the expression of anti-apoptotic genes. [score:7]
In addition, our findings support the premise that miR-199a-5p is a potential therapeutic target for treatment of MI in the clinic, as revealed by another study showing that one of the mechanisms by which atorvastatin prevents ischemia-reperfusion -induced cardiac injury is suppression of miR-199a-5p expression [22]. [score:7]
Thus, we conclude that miR-199a-5p inhibits Jun B expression by targeting the binding sequence located in its 3′ UTR. [score:7]
Targeted mutagenesis was performed to generate a specific mutation on the potential miR-199a-5p target site (from wt, CACACACTGGACTCTGGCCTGC, to mutant ACCATGTAGCACTCTG), designed as pmiR-RB-REPORT™ -mut. [score:6]
He XJ Up-regulated miR-199a-5p in gastric cancer functions as an oncogene and targets klothoBMC Cancer. [score:6]
In conclusion, we demonstrated in the present study that the expression of miR-199a-5p is upregulated in failing hearts of a rat AMI mo del. [score:6]
Lino Cardenas CL miR-199a-5p Is upregulated during fibrogenic response to tissue injury and mediates TGFbeta -induced lung fibroblast activation by targeting caveolin-1PLoS Genet. [score:6]
Mechanistically, miR-199a-5p regulates cell proliferation, motility, and angiogenesis by directly and indirectly targeting caveolin-1 (Cav-1) 15– 17. [score:6]
Based on our previous work (unpublished), JunB was downregulated in failing hearts and predicted to be a target for mir199a-5p. [score:6]
As expected, compared with that in the control group, flow cytometry (FCM) showed that the percentage of apoptotic cells was significantly increased by Ang II stimulation, which was further enhanced by the overexpression of miR-199a-5p but suppressed by the inhibition of miR-199a-5p (Fig.   4C). [score:6]
To verify that miR-199a-5p is a direct target for miR-199a-5p, we constructed a target reporter using a pmiR-RB-REPORT™ (Ribobio, USA) carrier. [score:6]
We further used molecular approaches to identify JunB as a direct target of miR-199a-5p, as evidenced by the finding that an increase in miR-199a-5p activity suppressed the activity of the pmiR-RB-REPORT™-JunB-WT reporter but not the pmiR-RB-REPORT™-JunB-mut reporter. [score:6]
In the cardiac setting, miR-199a-5p expression is elevated in hypertrophic hearts, and overexpression of miR-199a-5p induced cardiomyocyte proliferation and enlarged cell size 24, 25. [score:5]
Mechanistically, miR-199a-5p triggers apoptosis at least in part by suppressing JunB expression. [score:5]
To further explore the effect of miR-199a-5p on apoptosis, we overexpressed or inhibited miR-199a-5p in H9C2 cells in the presence of Ang II stimulation. [score:5]
Among those upregulated miRNAs, miR-199a-5p expression was 3.4-fold higher in failing hearts compared with control hearts [11]. [score:5]
We also found that the expression of JunB was influenced by mir-199a-5p expression. [score:5]
Of 84 apoptotic pathway-related genes examined, 7 showed significant differences in expression between the miR-199a-5p overexpression group and the control group (Fig.   5 and Table  1). [score:5]
However, we did not rule out the possibility that miR-199a-5p may regulate the expression of those pro-apoptotic genes indirectly. [score:5]
End-stage HF mice exhibited increased expression of miR-199a-5p and decreased expression of JunB in hearts. [score:5]
After exposure of H9C2 cells to 100 nM Ang II for 24 h, miR-199a-5p expression was significantly increased and JunB expression was decreased (Fig.   6). [score:5]
We examined the expression of JunB in H9C2 cells transfected with normal control, mimics, and inhibitors of miR-199a-5p by both RT-qPCR and Western blot. [score:5]
Apoptotic cells exhibited increased expression of miR-199a-5p and decreased expression of JunB. [score:5]
Figure 1 MI mice exhibited increased expression of miR-199a-5p and decreased expression of JunB in heart. [score:5]
Expression levels of seven pro-apoptotic genes were increased significantly upon miR-199a-5p overexpression. [score:5]
Figure 6 MiR-199a-5p expression increased and JunB expression decreased in Ang II -treated myocardial cells. [score:4]
Given that miR-199a-5p promoted cardiomyocyte proliferation and apoptosis and that JunB repressed cell proliferation and apoptosis as observed in the cancer and vascular fields, it is highly likely that JunB is one of the molecules that mediates the downstream effects exerted by upregulated miR-199a-5p in HF, JunB is known to be involved in mediating cell apoptosis. [score:4]
In this study, we provided evidence that JunB is a direct target of miR-199a-5p. [score:4]
Based on these findings together, we predicted that JunB may be a direct target for mir199a-5p according to the functional mechanism of the miRNA. [score:4]
Figure 7JunB was identified as a direct target of miR-199a-5p. [score:4]
In the present study, we found that JunB was a direct target of miR-199a-5p. [score:4]
Zhang H Qiliqiangxin Attenuates Phenylephrine-Induced Cardiac Hypertrophy through Downregulation of MiR-199a-5pCell Physiol Biochem. [score:3]
Identification of JunB as a target of miR-199a-5p. [score:3]
The target genes for miR-199a-5p were predicted using bioinformatic tools Targetscan, mirbase, and pictar, and the specific primers for these genes were designed by Primer 5.0. [score:3]
As expected, pmiR-RB-REPORT™-WT was significantly inhibited by miR-199a-5p mimics, but pmiR-RB-REPORT™-mut was not (Fig.   7C). [score:3]
Thus, we argue that miR-199a-5p mediates JunB expression. [score:3]
To verify whether JunB is the target of miR-199a-5p, we cloned the wild-type (WT) and mutant miR-199a-5p binding sites on the 3′UTR of the JunB gene into the pmiR-RB-REPORT vector. [score:3]
In the present study, we used heart tissues of a rat HF mo del and sham operation group to explore mir199a-5p and JunB expression patterns and the roles they play in myocardial cell apoptosis. [score:3]
JunB expression was mediated by the miR-199a-5p levels in H9C2 cells transfected with mimics, inhibitor and NC as evaluated by RT-qPCR (A) and Western blot (B) analyses. [score:3]
Zuo Y Wang Y Hu H Cui W Atorvastatin Protects Myocardium Against Ischemia-Reperfusion Injury Through Inhibiting miR-199a-5pCell Physiol Biochem. [score:3]
Increasing Ang II concentration elevated miR-199a-5p expression in vitro. [score:3]
The miR-199a-5p expression level was determined by quantitative RT-PCR. [score:3]
For instance, miR-199a-5p promotes proliferation and migration of gastric cancer cells via targeting klotho [23]. [score:3]
We searched the targets of miR-199a-5p through a common database and screened several genes related to apoptosis, cell growth, and cell cycle. [score:3]
Zhang ZH Jiao LI Xiong XM Chen WY Liu SM Regulatory effect of miR-199a-5p on cardiomyocyte hypertrophy in ratChinese Journal of Pathophysiology. [score:2]
Prediction of target gene of miR-199a-5p and primer design. [score:2]
Other mechanisms potentially underlying the regulation of AngII -induced apoptosis by miR-199a-5p remain to be elucidated. [score:2]
Since miR-199a-5p induced cell apoptosis, we next investigated whether genes related to the apoptotic pathway are differentially regulated by miR-199a-5p overexpression using. [score:2]
Increasing Ang II concentration elevated miR-199a-5p expression in vitroAng II stimulation of H9C2 cells for 24 h increased miR-199a-5p levels in a dose -dependent manner, with 1 nM Ang II treatment significantly increasing miR-199a-5p levels compared with 0 nM group (**P < 0.01, Fig.   3). [score:2]
Song XW MicroRNAs are dynamically regulated in hypertrophic hearts, and miR-199a is essential for the maintenance of cell size in cardiomyocytesJ Cell Physiol. [score:2]
Therefore, we believe that miR-199a-5p mediates apoptosis at least in part through regulating the activity of JunB. [score:2]
Chen R Regulation of IKKbeta by miR-199a affects NF-kappaB activity in ovarian cancer cellsOncogene. [score:2]
However, whether miR-199a-5p can directly mediate cardiomyocyte apoptosis is poorly understood. [score:2]
Two mature miRNA-199s, miR-199a-5p (from the 5′ arm) and miR-199a-3p (from the 3′ arm), are processed from the same stem loop precursor RNA. [score:1]
We speculated that a relationship may exist between miR-199a-5p and JunB, and eventually focused on Jun B proto-oncogene (JunB) in our further research. [score:1]
Zhou G Identification of miR-199a-5p in serum as noninvasive biomarkers for detecting and monitoring osteosarcomaTumour Biol. [score:1]
H9C2 cells seeded in 24-well plates were co -transfected with pmiR-RB-REPORT™-JunB-WT or pmiR-RB-REPORT™-JunB-mut and miR-199a-5p mimics or negative control (NC) duplex (GenePharma, USA) using FuGene HD transfection reagent. [score:1]
Figure 3 Stimulation with Ang II increased concentration caused miR-199a-5p levels in a dose dependent manner in H9C2 cells. [score:1]
miR-199a-5p promoted apoptosis in H9C2 cells. [score:1]
It would be of great interest to explore if circulating mir-199a-5p levels in AMI patients are also increased and can also serve as a valuable biomarker for myocardial cell injury. [score:1]
Zeng J MicroRNA-199a-5p Regulates the Proliferation of Pulmonary Microvascular Endothelial Cells in Hepatopulmonary SyndromeCell Physiol Biochem. [score:1]
In the present study, we aimed to compare the levels of miR-199a-5p and its predicted target gene JunB between an end-stage HF group and a control group and to investigate whether miR-199a-5p and JunB are involved in cardiomyocyte apoptosis in vitro. [score:1]
The roles of miR-199a-5p in cell proliferation in both cancer and the heart have been well documented. [score:1]
Another interesting finding from our study was that miR-199a-5p exhibited pro-apoptotic activity. [score:1]
We first evaluated the transfection efficiency of fluorescently labeled miR-199a-5p mimics, inhibitors, and negative controls in H9C2 cells by fluorescence microscopy, and 80–90% of H9C2 cells were stained red (Fig.   4A). [score:1]
MiR-199a-5p levels in the hearts of the HF and sham operation groups were evaluated by RT-qPCR by using oligos specifically designed to target mir-199a-5p. [score:1]
Thus, we argue that miR-199a-5p is involved in mediating apoptosis of myocardial cells in vitro. [score:1]
We also found that miR-199a-5p mimics not only promoted Ang II -induced apoptosis, but also induced apoptosis in H9C2 cells. [score:1]
A recent study indicated that the serum miR-199a-5p level is a potential biomarker in osteosarcoma patients [21]. [score:1]
However, whether miR-199a-5p affected cardiomyocyte apoptosis was not completely clear. [score:1]
Recent studies indicated a potential role for miR-199a-5p in cardiac hypertrophy induced by G protein coupled receptor (GPCR) agonists, such as phenylephrine (PE) and angiotensin II (Ang II) 13, 14. [score:1]
[1 to 20 of 76 sentences]
2
[+] score: 74
Other miRNAs from this paper: rno-mir-138-2, rno-mir-138-1
In cells exposed to OGD, L-NAME did not significantly affect the expression of miR-199a and miR-138 while their expression levels were upregulated and downregulated, respectively following treatment with SYB and L-NAME. [score:11]
After blocking miR-199a expression, the effects of OGD on target protein expression in RAECs significantly increased, as indicated by the greater inhibition of eNOS, p-eNOS [Ser1177], Bcl-2, and S100A1, and greater promotion of HIF-1α, Bax, caspase 3, iNOS, and p-iNOS [Tyr151] (P < 0.01 or P < 0.05). [score:9]
Taken together, these results indicate that SYB attenuated hypoxia -induced vasoconstriction by upregulating miR-199a expression, decreasing HIF-1α expression, and activating the eNOS/NO signaling pathway. [score:8]
The present study also showed that hypoxia or OGD reduced miR-199a expression and, thereby, upregulated HIF-1α and increased iNOS expression. [score:8]
The overexpression of miR-199a was shown to reduce hypoxia -induced HIF-1α expression and suppress iNOS activity [19, 20]. [score:7]
Treatment with antimiR-199a downregulated miR-199a and upregulated miR-138 (P < 0.01) while SYB significantly attenuated these effects in RAECs (P < 0.01). [score:7]
miR-199a affects HIF-1α translation [19] and, thereby, inhibits iNOS activity and ET-1 generation [19, 20]. [score:5]
miR-199a affects HIF-1α mRNA translation by binding to the 3′ untranslated region [19, 20]. [score:5]
A2, B2, A3 and B3 represent the expression levels of miR-199a and miR-138 in RAECs and vascular endotheliums respectively. [score:3]
Effect of SYB on miR-199a and miR-138 expression. [score:3]
Effect of safflor yellow B (SYB) on endothelin-1 (ET-1) content and the expression levels of miR-199a and miR-138. [score:3]
Hypoxia and OGD evidently reduced and increased miR-199a and miR-138 expression levels, respectively in the vascular endothelium or RAECs compared with the respective controls (Figure 5B2–C3). [score:2]
L-NAME and anti-miR-199a effectively alleviated the effects of SYB on iNOS and eNOS in cells exposed to OGD (P < 0.01 and P < 0.05, respectively). [score:1]
Relative expression of miR199a and miR-138 was calculated using the 2 [−ΔΔCT] method on a real-time PCR system. [score:1]
The small nuclear RNA U6 was used as an internal control, and the relative expression levels of miR-199a and miR-138 were calculated using the 2 [-ΔΔCT] method [43]. [score:1]
[1 to 20 of 15 sentences]
3
[+] score: 59
Among those seventeen deregulated miRNAs miR-31 was up-regulated on day 2, day 7 and day 14. miR-199a was up-regulated on day 7 and day 14. miR-214 was up-regulated on day 7 and day 14. miR-499 was down-regulated on day 2 and day 7. Table 1 miRNAs differentially expressed in the myocardial tissues of rats with acute myocardial infarction. [score:16]
Among those seventeen deregulated miRNAs miR-31 was up-regulated on day 2, day 7 and day 14. miR-199a was up-regulated on day 7 and day 14. miR-214 was up-regulated on day 7 and day 14. miR-499 was down-regulated on day 2 and day 7. Table 1 miRNAs differentially expressed in the myocardial tissues of rats with acute myocardial infarction. [score:16]
miRNA Host gene Function of host gene miR-923 UNC45B UNC45B plays a role in myoblast fusion and sarcomere organization miR-126 EGFL7 blood vessel development; angiogenesis; and vasculogenesis miR-26b CTDSP1 n/a miR-199a DNM2/DNM3 filopodium formation; centronuclear myopathy; growth and development of megakaryocytes miR-214 DNM3 filopodium formation; centronuclear myopathy; growth and development of megakaryocytes miR-499 MYH7B cardiac muscle, striated muscle contraction, striated muscle thick filament miRNA regulates gene expression by binding and modulating the translation of specific miRNAs. [score:9]
On day 7, miR-31, miR-214, miR-199a-5p, and miR-199a-3p were up-regulated, whereas miR-181c, miR-29b, miR-26b, miR-181d, mir-126, mir-499-5p, and miR-1 were down-regulated. [score:7]
On day 14, miR-214, mir-923, miR-711, and miR-199a-3p, and miR-31 were up-regulated, of which miR-31 showed the most striking up-regulation (an increase of eight-fold compared with the sham-control). [score:6]
miRNA Host gene Function of host gene miR-923 UNC45B UNC45B plays a role in myoblast fusion and sarcomere organization miR-126 EGFL7 blood vessel development; angiogenesis; and vasculogenesis miR-26b CTDSP1 n/a miR-199a DNM2/DNM3 filopodium formation; centronuclear myopathy; growth and development of megakaryocytes miR-214 DNM3 filopodium formation; centronuclear myopathy; growth and development of megakaryocytes miR-499 MYH7B cardiac muscle, striated muscle contraction, striated muscle thick filament Microarray data mining and differential analyses resulted in 17 significantly deregulated miRNAs associated with AMI (Table 1, Figure 1). [score:5]
[1 to 20 of 6 sentences]
4
[+] score: 59
Caspase-3 was a potential target of the downregulated miR-376b-3p, calpain 2 was a potential target of the upregulated miR-199a-3p, and iNOS was a potential target of downregulated miR-291a-5p (Figure  4B). [score:16]
Of the 30 miRNAs they found upregulated in traumatic spinal cord injury, miR-223, miR-214, miR-20b-5p, miR-17, miR-146a, miR-199a-3p, miR-221-3p, miR-146b, and miR-145 were also upregulated in our study, and among the 16 downregulated miRNAs in traumatic spinal cord injury, miR-34a and miR-338 were also downregulated after ventral combined with dorsal root avulsion in our study. [score:13]
Although no miRNA in our study was predicted to target nNOS, we found that the upregulated miR-199a-3p on the 14th day after injury potentially targeted calpain 2, and the immunohistochemistry results showed that ventral combined with dorsal root avulsion resulted in a clear decrease in the expression of calpain 2. In addition, neurotransmitter transport was observed on the 14th day after ventral combined with dorsal root avulsion, and many previous studies have shown that miRNAs may regulate specific neurotransmitter systems [56]. [score:11]
While miR-142-5p and miR-219-5p were upregulated on the 3rd day after ventral combined with dorsal root avulsion, miR-17 and miR-199a-5p were upregulated on the 14th day after ventral combined with dorsal root avulsion and were predicted to target VGLUT1. [score:9]
miR-142-5p and miRNA-219-5p, which were upregulated on the 3rd day; and miR-17 and miR-199a-5p, which were upregulated on the 14th day. [score:7]
In the present study, by using the miRWalk database, we determined that the following altered miRNAs target the VGLUT1 gene: miR-142-5p, miR-219-5p, miR-17 and miR-199a-5p. [score:3]
[1 to 20 of 6 sentences]
5
[+] score: 53
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This miRNA expression pattern is in accordance with published MRF expression results, potentially suggesting that changes in miR-199a-5p expression may be concomitant with the initiation of MBP expression. [score:9]
Besides having a strong target bias for C11Orf9, miR-199a-5p also has a significant bias for targetting DDR1, a tyrosine kinase receptor found to be upregulated during in vivo remyelination and in vitro oligodendrocyte differentiation [34]. [score:8]
The highly differential expression of miR-199a-5p, along with its high number of stringent evolutionarily conserved target sites to DDR1 mRNA, suggests a likely regulatory interaction involved in oligodendrocyte differentiation. [score:6]
From our top ten differentially expressed miRNAs at the early OP to mid OP stage transition, two miRNAs (miR-199a-5p and miR-145) show strong target bias towards C11Orf9. [score:5]
Interestingly, miR-199a-5p demonstrated a large decrease in expression beginning at the early OP stage and an increase at the final stage. [score:3]
However, while the increase of miR-199a-5p at the final stage corresponds with the decreased MRF expression at this transition, additional validation is necessary. [score:3]
Target predictions for miR-199a-5p showed high likelihood for C11Orf9 repressive interactions. [score:3]
Similarly, the expression pattern of miR-145 at these stages conformed to the same trend as miR-199a-5p. [score:3]
For instance, miR-145 and miR-199a-5p within our data showed similar expression patterns throughout differentiation and both contain conserved 8mer predicted seed pairings to multiple sites within the 3′-UTR of C11orf9. [score:3]
Importantly, miR-199a-5p showed a sharp ∼8.6-fold decrease in expression from the early OP to mid OP stage, followed by minimal ∼1.1-fold change during the mid OP to late OP stage transition. [score:3]
MiR-199a-5p, with a ∼8.6-fold decrease from OP1 to OP2 stage, contains four total evolutionarily conserved target sites (three 8mer, one 7mer-1A) within the 3′ UTR of DDR1 mRNA. [score:2]
Therefore, these data suggest that miR-199a-5p and miR-145 may be simultaneously regulating the human homolog of MRF. [score:2]
MiR-199a-5p has three sites with evolutionarily conserved 8mer seed matches to the 3′ UTR of C11Orf9, suggesting a high probability for miRNA-mRNA interactions. [score:1]
Then, miR-199a-5p levels rose (∼1.7 fold) at the final stage of differentiation. [score:1]
The key miRNAs discussed in this manuscript were validated by conducting real-time qRT-PCR for samples from the appropriate stages, including the following: miR-199a and miR-145 at the OP1, OP2, OP3, and OL stages; miR-214 at the OP1 and OP2 stages; miR-184 and miR-1183 at the GP and OP1 stages (Table 1 ). [score:1]
[1 to 20 of 15 sentences]
6
[+] score: 47
To confirm the results of the miRNA sequencing data, 4 upregulated miRNAs (rno-miR-122-5p, rno-miR-199a-5p, rno-miR-184 and rno-miR-202-5p) and 4 downregulated miRNAs (rno-miR-208a-3p, rno-miR-208a-5p, rno-miR-6314 and rno-miR-22-3p) were chosen to be further examined using real-time quantitative PCR. [score:7]
Among them, 12 miRNAs (rno-miR-10b-5p, rno-miR-122-5p, rno-miR-184, rno-miR-1843-5p, rno-miR-196c-5p, rno-miR-199a-5p, rno-miR-202-5p, rno-miR-206-3p, rno-miR-208b-5p, rno-miR-224-5p, rno-miR-298-5p and rno-miR-31a-5p) were significantly upregulated(p<0.01, fold-change >1) compared to the control group and only rno-miR-208a-3p were significantly downregulated (p<0.01, fold-change <-1) (Fig 3). [score:6]
Van Rooij E et al[42] found that 7 miRNAs were upregulated in the heart failure sample, including miR-199a-5p,which promotes heart failure by regulating UPS[43]. [score:5]
In addition, Rane[45] suggested that knockdown of miR-199 induced proapoptotic genes upregulation, and replenishing miR-199a reduced apoptosis. [score:5]
Among the top 13 differentially expressed miRNAs, the five most abundantly expressed miRNAs were rno-miR-122-5p, rno-miR-184, rno-miR-31a-5p, rno-miR-199a-5p and rno-miR-208a-3p. [score:5]
Baμmgarten et al[44] found that TWIST1/miR-199/214 pathway is downregulated in the end-stage dilated cardiomyopathy, which might contribute to the loss of cardiac mass. [score:4]
However, we found miR-199 upregulated in the late post-infarction heart failure when more cardiomyocyte apoptosis occurred. [score:4]
The results showed that the expression of rno-miR-199a-5p and rno-miR-184 gradually increased with time after MI operation. [score:3]
To further confirm the results of the miRNA sequencing and analyze the dynamic expression pattern of specific miRNAs in HF rats, the dynamic changes of miR-208a-3p (Fig 4B), miR-184 (Fig 4C), miR-122-5p (Fig 4D) and miR-199a-5p (Fig 4E) in the process of post-infarcted heart failure were analyzed. [score:3]
Time-course analysis revealed different expression patterns of 4 miRNAs: rno-miR-122-5p, rno-miR-199a-5p, rno-miR-184 and rno-miR-208a-3p. [score:3]
These studies were consistent with our results of miR-199-5p in heart failure. [score:1]
Time course analysis of miR-208a-3p (B), miR-184 (C), miR-122-5p (D) and miR-199a-5p (E) were studied. [score:1]
[1 to 20 of 12 sentences]
7
[+] score: 44
As shown in Table II, 21 (ASH versus C16) and 11 (AFL versus C12) differentially expressed miRNAs were identified through the SAM algorithm, where miR-129 and miR-199a-3p exhibited the highest degrees of upregulation and downregulation between the ASH and the respective control groups, and miR-200c and miR-93 exhibited the highest upregulation and downregulation between the AFL and the respective control group. [score:15]
Compared with the control group, 16 miRNAs were upregulated, while 13 miRNAs were downregulated in the ASH group, where miR-129 and miR-199a-3p exhibited the greatest upregulation and downregulation, respectively, of the miRNAs. [score:12]
The unique miRNA expression patterns distinguishing the ASH group from the control group were composed of six downregulated (miR-199a-3p, miR-214, miR-93, miR-146a, miR-191 and let-7b) and six upregulated (miR-129, miR-490, miR-21, miR-503, miR-183 and miR-185) miRNAs. [score:9]
Dolganiuc et al (13) demonstrated that the Lieber-deCarli alcohol diet upregulated 1% of known miRNAS, including miR-705 and miR-1224, and downregulated 1% of known miRNAs, including miR-182, miR-183 and miR-199a-3p in mice with alcoholic steatohepatitis compared with pair-fed controls. [score:6]
Reduced miR-199a-3p levels in ASH (13) may decrease hepatocyte proliferation and invasion, resulting in a small possibility of progression from alcohol -induced steatohepatitis to hepatocellular carcinoma. [score:1]
miR-199a-3p is involved in somatic cell reprogramming (28) and cell proliferation (29). [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 38
Other miRNAs from this paper: rno-mir-155
In the tissue of the corpus cavernosum, a significant downregulation of the miRNA-199 in the AD group and non-significant downregulation in the A and D groups compared to the C group were observed, whereas the miR-155 analysis demonstrated non-significant gene downregulation in the experimental groups compared to group C (Figure 4). [score:8]
Similar results were found with decreased miR-199 expression in the corpus cavernosum of rats in the alcohol and alcohol + diabetes groups, which corroborate the hypothesis that increased ET could be determined by the suppressive action of miR-199 that is hypoexpressed due to the deleterious effects of alcohol. [score:7]
Fichtlscherer et al. (28) studied plasma expression of some microRNAs known to be associated with endothelium and inflammation using quantitative PCR in patients with stable coronary disease comparing results with healthy volunteers and found significant hypoexpression of miR-199a and miR-155 in diabetics and males. [score:7]
They found an increase in ET-1 and its type B receptors as an effect of alcohol exposure, correlating the suppression of ET-1 expression by miR-199 in hepatic endothelial cells with miR-199 and miR-155 in human endothelial cells, thus indicating that these miRNAs may function as negative regulators of ET transcription control. [score:6]
The miR-199 analysis demonstrated significant downregulation in groups D and AD compared to group C, in addition to non-significant downregulation in group A (Figure 5). [score:6]
We can suggest a possible regulation of ET [B] by miR-199 mainly in group AD, since miR-199 presented a significant difference in this group and an inverse expression pattern of ET [B]. [score:4]
[1 to 20 of 6 sentences]
9
[+] score: 26
Interestingly, several potential interactions between 8 up-regulated miRNAs and 6 down-regulated aquaporins (AQPs) genes were observed for examples: miR-199a-5p, -214 and -503 can anneal to Aqp1 and Aqp12a with octamer seeds; and Aqp4 has multiple 9nt long binding sites for miR-132. [score:7]
Moreover, three miRNAs (miR-199a-5p, -214 and -132) were predicted to anneal within 3′-UTR of Rb1 (down-regulated) which is also a cell cycle inhibitor. [score:6]
For example, the putative seeds of miR-199a-5p (9nt long seed) and miR-34a (7nt long seed) within 3′-UTR region of p27 (Cdkn1b) suggest the possibility that this gene may be down-regulated by these 2 miRNAs in PKD. [score:4]
Taqman assays showed increased expression of rno-miR-199a-5p, -214, -146b and -31 in diseased kidneys (Figure 4 ). [score:4]
Of note, Ift88 and Ift122 were determined as the possible targets of rno-miR-199a-5p and -214. [score:3]
The rno-miR-199a-5p/214 transcript was previously reported during development [46] and epithelial ovarian cancer cells [47]. [score:2]
[1 to 20 of 6 sentences]
10
[+] score: 20
We suppose that SFI attenuates myocardial hypertrophy by upregulating the levels of particular miRNAs, including miR-19a-3p, miR-181d-5p, miR-210-3p, miR-352 and miR-324-3p, and downregulating miR-199a-5p. [score:7]
Our previous studies found that miR-378 inhibited caspase-3 expression and attenuated ischemic injury in cardiomyocytes [6], and that miR-199a might be a potential therapeutic target for cardiac hypertrophy or heart failure [7]. [score:7]
We think that the different expression levels of miR-199a at different time points could be due to the different physiological or pathological conditions of the heart after AAC. [score:3]
In our previous study, we showed that miR-199a was dynamically regulated during hypertrophy. [score:2]
Initially, miR-199a increased after AAC for a week, then returned to normal levels at 4 weeks, and increased again by several fold after 12 weeks. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 13
Among the miRNAs, miR-214, miR-199a-5p, miR-150, miR-199a-3p, miR-351, miR-145, miR-764, miR-497 and miR-92b were upregulated, whilst miR-7a, miR-325-5p, miR-485, miR-708, miR-344-3p, let-7f, miR-26b, miR-129, miR-29c and let-7a were downregulated. [score:7]
Another two miRNAs, miR-199a-3p and miR-129, which were found differentially expressed in the present study, were also reported to reveal altered expression levels under diabetic conditions in other studies (26, 27). [score:5]
These miRNAs include miR-214, miR-199a-5p, miR-150, miR-351, miR-145, miR-92b, miR-7a, miR-485, miR-708, let-7f, miR-26b, miR-129, miR-29c and let-7a. [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 13
Murakami et al. reported that 11 miRNAs including miR-34, miR-199a-5p, miR-199, miR-200, and let-7e were up-regulated in a CCl [4] -induced fibrosis mo del mouse [31]. [score:4]
Recently, Li et al. reported that 16 miRNAs including miR-34, miR-199a-5p, miR-221, miR-146b, and miR-214 showed progressive up-regulation in rat with hepatic fibrosis caused by dimethylnitrosamine [30]. [score:4]
FEBS J In press 31 Murakami Y Toyoda H Tanaka M Kuroda M Harada Y 2011 The progression of liver fibrosis is related with overexpression of the miR-199 and 200 families. [score:3]
Among them, miR-34 and miR-199a-5p were common in the two mo dels. [score:1]
In our CCl [4] -induced fibrosis mo del, the miR-34a in plasma was increased, whereas the miR-199a-5p in plasma was not changed. [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 13
Twist1 has been reported to regulate the expression of the miR-199a/214 cluster during development [24]. [score:5]
All results of relative expression values are shown as mean ± s. e. m. obtained from triplicate experiments (unpaired two-sample Student’s t test, * P < 0.05 and ** P < 0.01) The miR-199a/214 gene cluster is located in the Dynamin-3 (DNM3) gene as two clustered miRNAs approximately 6 kb apart. [score:3]
Lee YB Twist-1 regulates the miR-199a/214 cluster during developmentNucleic Acids Res. [score:3]
The miR-199a/214 gene cluster is located in the Dynamin-3 (DNM3) gene as two clustered miRNAs approximately 6 kb apart. [score:1]
The miR-199a/214 gene cluster is located in the 7.9-kb noncoding intron of the DNM3 gene. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 13
Adenovirus -mediated p300 expression significantly increased levels of all cluster members including miR-20a (1.95-fold ±0.03, p<0.0001, Figures 4C and D), while expression of an unrelated miRNA, miR-199, was unchanged (Figure 4D), confirming that p300 gain can positively regulate expression of this anti-angiogenic microRNA cluster. [score:8]
Relative expression of miR-17∼92 cluster members and an unrelated microRNA, miR-199, in Adp300- vs AdGFP -expressing cardiac myocytes. [score:5]
[1 to 20 of 2 sentences]
15
[+] score: 12
Knockdown of miR-199a during normoxia upregulated the expression of HIF-1α and Sirtuin-1 and induced hypoxia preconditioning [37]. [score:7]
Under hypoxia, miR-199a inhibited hypoxia-inducible-factor 1α (HIF-1α) expression and reduced cardiomyocyte apoptosis. [score:5]
[1 to 20 of 2 sentences]
16
[+] score: 12
miR-199a-5p is acutely downregulated in cardiac myocytes after hypoxia and directly targets HIF-1α and Sirtuin 1 to regulate the hypoxia-triggered pathway, it can be exploited for preconditioning cells against hypoxic damage [20]. [score:8]
Rane S. He M. Sayed D. Vashistha H. Malhotra A. Sadoshima J. Vatner D. E. Vatner S. F. Ab dellatif M. Downregulation of miR-199a derepresses hypoxia-inducible factor-1α and Sirtuin 1 and recapitulates hypoxia preconditioning in cardiac myocytesCirc. [score:4]
[1 to 20 of 2 sentences]
17
[+] score: 11
In the mo del group, 17 miRNAs were downregulated, including miR-1, miR-133, miR-29, miR-126, miR-212, miR-499, miR-322, miR-378, and miR-30 family members, whereas the other 18 miRNAs were upregulated, including miR-21, miR-195, miR-155, miR-320, miR-125, miR-199, miR-214, miR-324, and miR-140 family members. [score:7]
Among these differentially expressed miRNAs, miR-1, miR-133, miR-29, miR-126, miR-499, miR-30, miR-21, miR-195, miR-155, miR-199, miR-214, and miR-140 have been reported to be related to MI [25– 36], while the other miRNAs have not been reported directly in MI. [score:4]
[1 to 20 of 2 sentences]
18
[+] score: 11
miR-100 targets AGO2, miR-199a-3p and miR-145 target ZEB2, miR-143 targets BCL2, and miR-199a-5p targets CDKN1B, which are 4 of 7 genes targeted by the rat miRNA signature in the present study. [score:11]
[1 to 20 of 1 sentences]
19
[+] score: 11
12 of these miRNAs were ≥50% up-regulated in both groups with particularly strong increases in expression for miR-199a, miR-21, miR-214, miR-221, miR-222, and miR-31 (Figure 2B). [score:6]
Several miRNAs, including miR-21, miR-27, miR-31, miR-199a, miR-214 and miR-222 were up-regulated in these mouse mo dels in the same directions and to similar extents as observed in this study [11], [18]. [score:5]
[1 to 20 of 2 sentences]
20
[+] score: 10
Bish et al. [14] reported that strong cardiac shPLB expression in canines altered the expression of several miRs and induced toxic side effects such as transiently increased serum levels of troponin I. To investigate whether scAAV6-shPLBr and scAAV6-amiR155-PLBr treatment might affect the expression levels of selected cardiac miRs that had been analyzed in the in vivo study of Bish et al. [14], the levels of miR-1, miR-21, miR-124, miR-195 and miR-199a were determined in CM at day 14 after transduction with 25×10 [3] vg/c of scAAV6-shPLBr, scAAV6-amiR155-PLBr, scAAV6-shCon or scAAV6-amiR155-Con. [score:5]
To analyse the expression of miR-1, miR-21, miR-124, miR-195, and miR-199a, 10 ng of total RNA, isolated from CM, were reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit (Life Technologies, Applied Biosystems Inc. [score:3]
Expression levels were determined by real-time PCR using the TaqMan MicroRNA Assays rno-miR1, hsa-miR21, hsa-miR124, hsa-miR195 and hsa-miR199a (Life Technologies, Applied Biosystems Inc. [score:2]
[1 to 20 of 3 sentences]
21
[+] score: 9
Furthermore, several miRs, including miR-210 (which regulates angiogenesis) [14], miR-199a (which modulates hypoxia-inducible factor-1 α (HIF-1 α) expression) [16], and miR-494 (which upregulates p-Akt, HIF-1 α, and heme oxygenase-1 expression) [17], protect cells from hypoxia- or ischemia -induced damage. [score:9]
[1 to 20 of 1 sentences]
22
[+] score: 9
Picking out 7 miRNAs associated with heart failure and taking statistical analysis, we found that Shenfu injection could significantly downregulate the levels of rno-miR-30c-1-3p, rno-miR-125b-5p, rno-miR-133a-5p, rno-miR-199a-5p, rno-miR-221-3p, rno-miR-146a-5p, and rno-miR-1-3p (Figure 5(b)). [score:4]
Picking out 7 miRNAs associated with heart failure and taking statistical analysis, our data reveal that Shenfu injection could significantly downregulate the levels of rno-miR-30c-1-3p, rno-miR-125b-5p, rno-miR-133a-5p, rno-miR-199a-5p, rno-miR-221-3p,rno-miR-146a-5p, and rno-miR-1-3p. [score:4]
At the same time, miR-125b and miR-199a were implicated in myocardial signaling networks triggering fibrosis [30]. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 9
rno-miR-novel-8, rno-homolog-miR-26, and rno-homolog-miR-199 miRNAs were selected from Tier 1, and rno-miR-sno-57 miRNA was selected from Tier 2. In addition, we analysed the expression of miR-741-3p and miR-743a-3p and found that, in accordance with sequencing data, they were highly expressed in rat PSCs. [score:5]
rno-homolog-miR-26 and rno-homolog-miR-199 miRNAs were expressed in EFs, ESCs and iPSCs, which is consistent with the data obtained from sequencing. [score:3]
Four novel miRNAs with the following coordinates: chrX:−:151288045–151288101 (rno-miR-novel-8); chr7:+:70463555–70463594 (rno-homolog-miR-26); chr3:+:16697111–16697143 (rno-homolog-miR-199); and chr18:−:69422790–69422857 (rno-miR-sno-57) were selected for the validation. [score:1]
[1 to 20 of 3 sentences]
24
[+] score: 9
It is noteworthy that miR-1, miR-133, miR-30, miR-208a, miR-208b, mir-499, miR-23a, miR-9 and miR-199a have previously been shown to be functionally involved in cardiovascular diseases such as heart failure and hypertrophy [40], [41], [42], [43], [44], and have been proposed as therapeutic- or disease-related drug targets [45], [46]. [score:7]
Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey. [score:1]
An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A). [score:1]
[1 to 20 of 3 sentences]
25
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
For example, miR-199a was specifically expressed in neural tissues. [score:3]
Cortex let-7c-1, miR-10a, miR-21, miR-124a-1, miR-128a, miR-135b, miR-150, miR-199a, miR-217, miR-329, miR-451. [score:1]
Hypothalamus miR-17, miR-29c, miR-124a-1, miR-128a, miR-150, miR-199a, miR-217, miR-223, miR-329, miR-429. [score:1]
Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451. [score:1]
Dorsal root ganglion let-7c, miR-17, miR-145, miR-150, miR-199a, miR-223, miR-365, miR-451. [score:1]
Brain stem let-7c-1, miR-17, miR-135b, miR-150, miR-199a, miR-218-1, miR-223, miR-329. [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 8
The level of expressed miRNAs of interest, rno-miR-199a-3p, rno-miR-181a-5p, rno-miR-140-3p and rno-miR-27b-3p, were confirmed by quantitative RT-PCR in articular cartilage and subchondral bone (Figure 5A and 5B). [score:3]
Several miRNAs including miR-140, miR-199a, mir-193 and mir-29a/29b control the anabolic and catabolic regulation in cartilage [42]. [score:2]
The rno-miR-199a-3p, rno-miR-181a-5p, rno-miR-140-3p and rno-miR-27b-3p were measured from articular cartilage A. and subchondral bone B. The expression profiles of each miRNA matched the tested probes at least three times repeat. [score:1]
Figure 5The rno-miR-199a-3p, rno-miR-181a-5p, rno-miR-140-3p and rno-miR-27b-3p were measured from articular cartilage A. and subchondral bone B. The expression profiles of each miRNA matched the tested probes at least three times repeat. [score:1]
For example, rno-miR-199a-3p was decreased in cartilage of OA+SW group, however, was highly increased in bone. [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 8
miR-199a had significantly less target mRNAs up-regulated than would be expected by chance, and was not counted as having an inverse expression pattern. [score:8]
[1 to 20 of 1 sentences]
28
[+] score: 8
Our previous work also revealed that the heart failure of the rat with selenium deficiency was probably related to five upregulated miRNAs (miR-374, miR-16, miR-199a-5p, miR-195 and miR-30e) and three downregulated miRNAs (miR-3571, miR-675 and miR-450a) [11]. [score:7]
Of these miRNAs, such as rno-miR-16, rno-miR-199a-5p, rno-miR-195, rno-miR-30e, which had been reported to be involved in selenium deficiency induced heart failure [11]. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 8
In fact, our data suggest that a downregulation of miR-9 and miR-199 may contribute to inflammation by reducing the inhibition of NF-κB pathway genes, namely, p50NFκB or ikkβ [89], [90], [91]. [score:6]
Specifically, miR-Let7a, miR-107, and miR-183 have been described as regulators of cell death, and miR-181b and miR199 are involved in the control of inflammation (see file S6). [score:2]
[1 to 20 of 2 sentences]
30
[+] score: 7
Similarly, when pri-mir-21, pri-mir-199a, and pri-mir-381 primary transcripts were up-regulated, their mature miRNA forms were up-regulated as well (Figure 6). [score:7]
[1 to 20 of 1 sentences]
31
[+] score: 7
Similarly, we observed that miR-199a is up-regulated in liver fibrosis [39] but down-regulated in HCC [40]. [score:7]
[1 to 20 of 1 sentences]
32
[+] score: 7
Three miRNAs (upregulated miR-483 and downregulated let-7e and miR-199a) exhibited significantly fold changes (Fig.   1). [score:7]
[1 to 20 of 1 sentences]
33
[+] score: 6
While miR-199a, miR-376b-5p, miR-539 and miR-106 were all significantly upregulated (more than 3 times compared to the control), only miR-376b-5p and miR-539 were downregulated to the level similar to the control group after treatment with choline. [score:6]
[1 to 20 of 1 sentences]
34
[+] score: 6
Hydrogen regulates expressions of miR-9, miR-21, and miR-199, and modifies expressions of IKK-β, NF-κB, and PDCD4 in LPS-activated retinal microglia cells [64]. [score:6]
[1 to 20 of 1 sentences]
35
[+] score: 6
No differences in miRNA expression were found in kidneys of ischemic heart failure mice compared to control animals (S6 Table) and only small differences were observed between expression levels of miR-18a-5p, miR-30e-5p, miR-199a-3p and miR-223-3p in the LV of mice with ischemic heart failure compared to controls (S7 Table), however not reaching significance after Bonferroni correction for multiple testing. [score:3]
In addition to the cardiac specific miR-208a-3p and miR-499-5p, we found that the expression of let-7i-5p, miR-16-5p, miR-27a-3p, miR-199a-3p and miR-223-3p was significantly higher in the heart compared to the kidney, independent of the presence of ischemic heart failure (S4 Fig and S5 Table). [score:2]
In general, the rank order of the expression levels of the measured miRNAs was comparable in mice and rats, with the highest miRNA levels of miR-16-5p and miR-223-3p and the lowest levels of miR-199a-3p, miR-652-3p, miR-423-3p and miR-26b-5p (S1– S3 Figs). [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 6
For example, miR-199a* was reported to inhibit early chondrogenic differentiation by targeting Smad1 directly [45]. [score:6]
[1 to 20 of 1 sentences]
37
[+] score: 6
Male-biased miRNA expression was associated with pathways related to cancer (miR-130b, miR-214, miR-181b, miR-199a, miR-150, miR-135a, miR-142-3p, miR-142-5p, miR-185), hematological disease (miR-22*, miR-142-3p, miR-142-5p, miR-150, miR-181b), and renal inflammation/nephritis (miR-130b, miR-223, miR-150, miR-142-5p, miR-296*, miR-185-3p) (Additional file 2). [score:5]
For example, nine miRNAs (miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805, and miR-194) have been identified in C57BL/6 mice as promising biomarkers of kidney injury after renal ischemia reperfusion injury (IRI) [15]. [score:1]
[1 to 20 of 2 sentences]
38
[+] score: 5
By contrast, miR-26b-5p, miR-199a-3p, miR-377–3p, miR-let-7f-5p, miR-200a-3p, miR-21–5p, miR-152–3p, and miR-192–5p expressions were repressed by SO diet consumption. [score:3]
miR-199a-5p and miR-22–5p expression were higher after OO and PA diets compared with LO diet. [score:2]
[1 to 20 of 2 sentences]
39
[+] score: 5
Seven overexpressed miRNAs (miR-20a, miR-199a-5p, miR-199, miR-323, miR-301a, miR-301b and miR-130b) showed the most target mRNAs. [score:5]
[1 to 20 of 1 sentences]
40
[+] score: 4
miR that regulate targets in the mTORC1 pathway (hsa-miR-16-5p, hsa-miR-26b-5p, hsa-miR-99a-5p, hsa-miR-100-5p, hsa-miR-128a-3p, hsa-miR-133a-3p, hsa-miR-199a-3p, hsa-miR-221-3p) were analyzed using TaqMan® microRNA Assays (Applied Biosystems, Foster City, CA, USA). [score:3]
MiRNA-199a-3p regulates C2C12 myoblast differentiation through IGF-1/AKT/mTOR signal pathway. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 4
MiR-30C was computationally predicted to bind the 3′UTR of panda ADRA1D gene and miR-199a-5p to the 3′UTR of panda COMT gene (Figure 3 & Figure S2). [score:1]
Part of the panda COMT 3′UTR and predicted miRNA-199a-5p binding. [score:1]
The possible miRNA-199a-5p target with panda COMT gene and the calculated free energy was shown on the right side. [score:1]
0022602.g003 Figure 3Part of the panda COMT 3′UTR and predicted miRNA-199a-5p binding. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 4
It has been suggested that upregulation of miR-199a, -199a*, -200a, and -200b s triggers the process of liver fibrosis [12]. [score:4]
[1 to 20 of 1 sentences]
43
[+] score: 4
To confirm the deep sequencing results, we used qRT-PCR to assess the expressions of 10 of the miRNAs (miR-183-5p, miR-9a-5p, miR-199a-5p, miR-351-5p, miR200b-3p, miR-191a-3p, miR-181c-3p, miR-330-5p, miR-126a-5p and miR-351-3p) in the 12-pair plasma samples from the hyperoxia rats and controls. [score:3]
Related reports by Shen and Bai et al. revealed that alteration of miRNAs such as miR-126, miR-451, miR-199a, et al., contributed to the retinal neovascularization, which is consistent with our results [17, 18]. [score:1]
[1 to 20 of 2 sentences]
44
[+] score: 3
For example, it has been reported that miR-221 [15], miR-199a/b [16][17], miR-27b [18], miR-195 [11] and miR-34a/b/c [19] positively regulate cardiac hypertrophy, while miR-378 [9], miR-29 [20], miR-150 [11], miR-223 [21] and miR-1 [22] negatively regulate cardiac hypertrophy. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
MiRNA-21 (A), miRNA-199a (B), miRNA-130b (C), miRNA-138-1 (D), miRNA-9 (E), miRNA-27a (F), miRNA-125a (G), and miRNA-320 (H) expression was not validated at 3 days after treatment with BM-MSC. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
Overexpression of miR-34a, miR-146a, miR199a-5p or miR-29 in MIN6 cells negatively impacts on beta cell function [6]. [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
Other miRNAs from this paper: mmu-mir-199a-1, mmu-mir-199a-2
MiR-199a*, a BMP-2 responsive microRNA, acts as a novel mediator of chondrogenesis via direct targeting to Smad1. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
Other miRNAs from this paper: rno-mir-140, rno-mir-101b, rno-mir-27b, rno-mir-34a, rno-mir-101a
MicroRNA-199a* regulates the expression of cyclooxygenase-2 in human chondrocytes. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
MiR-214 is located in the miR-199a–214 cluster and targets PTEN to produce a protective effect in cardiac myocytes against H [2]O [2] -induced injury [47]. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
MiR-199a was down-regulated by hypoxia preconditioning in cardiomyocytes [17]. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
Moreover, miR-199a -dependent cross-talk between VEGF and hypoxia-inducible factor 1 α was validated in the diabetic retina [34], and miR-199a targeting could alleviate DR progression. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 2
It has been observed that many miRNAs regulate cell apoptosis, such as miR-1, miR-133, miR-199, miR-208, miR-320, miR-21, and miR-204, etc [18- 23]. [score:2]
[1 to 20 of 1 sentences]
53
[+] score: 2
Among the one feed-back loop and 8 feed-forward loops, mmu-miR-199a-5p played as an important miRNA regulator in concert with TFs in mouse ESC. [score:2]
[1 to 20 of 1 sentences]
54
[+] score: 2
At 24 hours, five miRNAs (rno-miR-214, rno-miR-99a, rno-miR-363*, rno-miR-100 and rno-miR-340–5p) and at 48 hrs 6 miRNAs (rno-miR-34b, rno-miR-500, rno-miR-24-1*, rno-miR-29b, rno-miR-199a-3p, rno-let-7a) showed the most prominent dysregulation (P < 0.001) (Fig.   7B). [score:2]
[1 to 20 of 1 sentences]
55
[+] score: 2
analysis confirmed the direction and amplitude of all miRNA changes with the exception of let-7d, miR-25*, miR-187, miR-291a-5p, miR-292-5p, miR-365, miR-431, miR-487b, miR-615-5p, miR-743a, miR-20b-3p, miR-199a-3p which remained unaltered or showed no statistical significance. [score:2]
[1 to 20 of 1 sentences]
56
[+] score: 2
miR-125b, miR-146, miR-150, miR-199a, miR-21, miR-129, miR-341 and miR-451 have been confirmed to play an important role in the different developmental stages of the cardiovascular system (4– 18). [score:2]
[1 to 20 of 1 sentences]
57
[+] score: 2
Regulation of miR-101/miR-199a-3p by the epithelial sodium channel during embryo implantation: involvement of CREB phosphorylation. [score:2]
[1 to 20 of 1 sentences]
58
[+] score: 1
Also, miR-199a-3p, miR-let-7i-5p and miR-423-3p are involved in maintaining renal function and response to renal injury [12]. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
As shown in Figure  3B and Additional file 2, levels of miR-199a-3p, miR-344b-2-3p, miR-465*, miR-504, and miR-877 showed selectively changed in CCA rats (p < 0.05 vs. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The probes used were: EAM119 (miR-29b), EAM125 (miR-138), EAM224 (miR-17-5p), EAM234 (miR-199a), EAM131 (miR-92), EAM109 (miR-7), EAM150 (miR-9) and EAM103 (miR-124a). [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
For instance, the human genome has 3 paralogous mir-199 genes. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Furthermore, several miRNAs, such as miR-199a and miR-214 [14], miR-494 [15], miR-499 [16], and miR-24 [17] are known to protect cells from hypoxia- or ischemia -induced damage. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
The eight circulating miRNAs, miR-29a, miR-34a, miR-375, miR-103, miR-107, miR-132, miR-142-3p and miR-144, and the two tissue-specific miRNAs, miR-199a-3p and miR-223, were identified to be significantly altered in T2D across a meta-analysis of controlled profiling studies [51]. [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
As a result, miR-16, miR-17-5p, miR-20a, miR-20b-5p, miR-21 and miR-199-5p were extracted as candidates. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
Therefore, ten miRNAs (miR-19b-3p, miR-21-5p, miR-25-3p, miR-30a-5p, miR-133b-3p, miR-140-5p, miR-150-5p, miR-199a-3p, miR-342-5p, miR-3473) were chosen as candidate reference genes. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
At about E13, when the first waves of neurons are produced from neural progenitor cells in rat cortex [25], we found that 4 miRNAs were particularly high at this stage, including rno-miR-199a-3p, rno-miR-494, rno-miR-182, and rno-miR-7a, suggesting important roles of these miRNAs in neurogenesis. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
As seen in the kidneys, two miRNAs, namely miR-135 and miR-199a-5p remained unaltered. [score:1]
[1 to 20 of 1 sentences]