sort by

40 publications mentioning osa-MIR395a

Open access articles that are associated with the species Oryza sativa and mention the gene name MIR395a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 71
Identification of miR395 target gene in tobaccoTo understand how the excess miR395 impacts tobacco sulfate homeostasis at the molecular level, we sought to identify putative new target genes of miR395 using two approaches 29. [score:5]
Sulfate regulates tobacco NtamiR395 and NtaSULTR2To confirm that NtaSULTR2 is the target of miR395 in tobacco, we investigated the expression level of both NtaSULTR2 and mature NtamiR395 under different sulfate concentrations. [score:4]
There are four mismatches and three mismatches between NtaSULTR2 target sequence and mature OsamiR395 and NtamiR395, separately (Fig. 7b), indicating that NtaSUTLR2 should be efficiently regulated by miR395 because of their near perfect complementary sequence. [score:4]
We speculate that the two sulfate transporter genes and miR395 may be differentially expressed in different leaf tissues and thus, OsaSULTR2;1 and OsaSULTR2 may not be subjected to miR395 regulation. [score:4]
Identification of miR395 target gene in tobacco. [score:3]
To understand how the excess miR395 impacts tobacco sulfate homeostasis at the molecular level, we sought to identify putative new target genes of miR395 using two approaches 29. [score:3]
Based on the results of real-time PCR and RML-RACE, we verified that NtaSULTR2 is the target gene of miR395 (Figs 8 and 9). [score:3]
To further confirm that NtaSULTR2 is the true target of miR395, we conducted RLM-RACE (T4 RNA Ligase Mediated Rapid Amplification of cDNA Ends) to verify that NtaSULTR2 transcripts are cleaved by miR395. [score:3]
By performing small molecule northern blotting, we observed high transcript level of miR395 in transgenic tobacco under normal condition, indicating that rice pri -OsamiR395h could be successfully expressed and processed into mature miR395h in tobacco (Fig. 4). [score:3]
MiR395 mediates the cleavage of NtaSULTR2 mRNATo further confirm that NtaSULTR2 is the true target of miR395, we conducted RLM-RACE (T4 RNA Ligase Mediated Rapid Amplification of cDNA Ends) to verify that NtaSULTR2 transcripts are cleaved by miR395. [score:3]
The RNA adapter has a length of 44 bp, and the reverse GSP is localized 545 bp downstream of the predicted miR395 target site in the NtaSULTR2 mRNA, so the product of the first round PCR should have a length of about 589 bp. [score:3]
We cloned the full-length cDNA sequence of NtaSULTR2 using RACE (Rapid Amplification of cDNA Ends) method, and identified the target site of miR395 that is located between 135 bp and 156 bp of its coding region. [score:3]
How to cite this article: Yuan, N. et al. Heterologous expression of a rice miR395 gene in Nicotiana tabacum impairs sulfate homeostasis. [score:3]
We used RNA from the miR395 -overexpressing transgenic tobacco plants to facilitate the detection of cleaved NtaSULTR2 mRNA. [score:3]
To confirm that NtaSULTR2 is the target of miR395 in tobacco, we investigated the expression level of both NtaSULTR2 and mature NtamiR395 under different sulfate concentrations. [score:3]
Previous studies on Arabidopsis miR395 have indicated its involvement in sulfate starvation response by repressing the expression of genes in sulfate transportation and assimilation pathways. [score:3]
NtaSULTR2 with a length of 1335 bp contains a sulfate transporter domain between 724 bp to 1332 bp, and a miR395 target site between 135 bp to 156 bp. [score:3]
Identification of a sulfate transporter gene, NtaSULTR2, the target of miR395 in tobacco. [score:3]
To reveal the molecular mechanism underlying miR395 -mediated plant sulfate metabolism, we studied genes impacted by excessive dose of miR395 in transgenic tobacco, and identified a novel sulfate transporter gene NtaSULTR2 belonging to the second group of sulfate transporter genes (Fig. 7). [score:1]
To investigate the expression levels of pri -OsamiR395h, mature miR395 and NtaSULTR2 in tobacco, tobacco seeds were surface sterilized and grown in MS medium under 16h light/8h dark at 22 °C 39. [score:1]
More specifically, Zhang et al. found that 9 miRNA families are highly conserved 33, 10 miRNA families are moderately conserved and 16 miRNA families including miR395 are lowly conserved across plant species. [score:1]
To prepare radiolabeled probe for detecting mature miR395, DNA oligonucleotide GAGTTCCCCCAAACACTTCAC was synthesized (http://www. [score:1]
Cloning and sequencing of the PCR product further confirmed the predicted miR395 cleavage site in the NtaSULTR2 mRNA. [score:1]
To verify miR395 cleavage site within NtaSULTR2, was conducted following a previously described method 45. [score:1]
At the same time, we also observed low level of endogenous mature miR395 in WT tobacco, confirming that tobacco mature miR395 is highly conserved with its rice homolog. [score:1]
This result indicated that the high-level of miR395 accumulation in transgenic plants impacts the uptake and transportation of sulfur and sulfate. [score:1]
MiR395 is highly conserved across species, which strongly suggests that its function in regulating plant response to nutrition, particularly sulfate supply could also be conserved during evolution. [score:1]
In a later work, miR395 family was identified in the common ancestor of all embryophytes 25. [score:1]
Confirmation of miR395 -mediated cleavage of NtSULTR2 mRNA. [score:1]
Red lines indicate miR395 cutting site. [score:1]
[1 to 20 of 30 sentences]
[+] score: 36
The results showed that miR168, miR395, miR398, miR399, and miR528 were all up-regulated in the NS3 -overexpressing rice line, but down-regulated or unchanged in the mNS3 -overexpressing rice line compared with the WT (See S1 Table for more details) (Fig 2B). [score:10]
Northern blot showed that the levels of miR168 and miR395 were up-regulated by RSV infection and NS3 overexpression in these Arabidopsis plants (S1A and S1B Fig). [score:6]
For instance, miR395 and miR399, which are involved in the regulation of sulfur assimilation [14, 15] and response to phosphorus starvation [16– 18], respectively, are up-regulated by RSV infection in rice [19]. [score:5]
As shown in Fig 2D, mRNA levels of OsAGO1a (miR168), OsSULTR2;1 (miR395), OsCDS1 (miR398), Os08g45000 (miR399) and OsRFPH2-10 (miR528) were all reduced in the NS3 overexpression lines compared with the mock-inoculated WT plants, whereas expression levels in the mNS3 overexpression lines were relatively unchanged compared to the WT. [score:5]
In contrast, overexpression of mNS3 had no influence on the growth or the levels of miR168 and miR395 in the Arabidopsis plants (S1B and S1D Fig). [score:3]
To test this hypothesis, we overexpressed AtHYL1, Δ D1-HYL1, a double-stranded RNA binding domain 1 deletion form of AtHYL, NS3-Δ D1D2-HYL1, a fusion protein of NS3 and ΔD1D2-HYL1 and NS3 (Fig 5C) in Arabidopsis hyl1-2 mutant background, the transgenes were all driven by a 35S promoter with the proteins tagged with a myc-epitope tag at the N-terminus, we found that the fusion protein NS3-ΔD1D2-AtHYL1 could ameliorated the phenotype (Fig 5D) and miRNA (miR156, miR164, miR168 and miR395) levels (Fig 5E) of hyl1-2 mutant as HYL1 did but NS3 or ΔD1-HYL1 could not (Fig 5D and 5E), we test these transgenic Arabidopsis plants by western blotting (Fig 5F), and this results indicated that NS3 could substitute for the dsRBD domain of AtHYL1 in miRNA processing. [score:3]
Several studies have demonstrated that RSV infection perturbs miRNA accumulation, for example, 38 miRNAs including miR167, miR168, miR395, miR399 etc. [score:1]
To determine whether RSV infection and NS3 overexpression increases the accumulation of these miRNAs through promoting primary miRNA (pri-miRNA) processing, we measured the primary transcript levels of miR168, miR395, miR398, miR399, and miR528 by RT-qPCR. [score:1]
As shown in Fig 1E, (top three panels), the levels of miR168 and miR395, measured by northern blot hybridizations, were strongly elevated by RSV infection and transgenic expression of NS3 (Fig 1E, lane 2 and 4), but not other RSV proteins. [score:1]
In a previous study, we found that RSV infection resulted in an increased accumulation of several rice miRNAs, including miR168, miR395, miR398, miR399 and miR528 (20-nt and 21-nt forms) [5, 9, 11, 19]. [score:1]
[1 to 20 of 10 sentences]
[+] score: 32
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR827, osa-MIR396f, bdi-MIR171a, bdi-MIR167a, bdi-MIR397a, bdi-MIR156a, bdi-MIR172d, bdi-MIR166a, bdi-MIR171c, bdi-MIR169b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, bdi-MIR169d, bdi-MIR169i, bdi-MIR395a, bdi-MIR169j, bdi-MIR166f, bdi-MIR171b, bdi-MIR390a, bdi-MIR160a, bdi-MIR528, bdi-MIR395b, bdi-MIR166d, bdi-MIR171d, bdi-MIR167b, bdi-MIR166b, bdi-MIR160b, bdi-MIR164b, bdi-MIR167c, bdi-MIR396d, bdi-MIR169k, bdi-MIR168, bdi-MIR160c, bdi-MIR396c, bdi-MIR167d, bdi-MIR156b, bdi-MIR169g, bdi-MIR160d, bdi-MIR160e, bdi-MIR396e, bdi-MIR156c, bdi-MIR172a, bdi-MIR396a, bdi-MIR166e, bdi-MIR166c, bdi-MIR169e, bdi-MIR394, bdi-MIR398a, bdi-MIR164a, bdi-MIR393a, bdi-MIR169a, bdi-MIR172b, bdi-MIR156d, bdi-MIR393b, bdi-MIR169h, bdi-MIR396b, bdi-MIR169c, bdi-MIR395c, bdi-MIR827, bdi-MIR166g, bdi-MIR319a, bdi-MIR395d, bdi-MIR398b, bdi-MIR164c, bdi-MIR169f, bdi-MIR162, bdi-MIR164e, bdi-MIR164f, bdi-MIR395m, bdi-MIR395e, bdi-MIR395f, bdi-MIR395g, bdi-MIR395h, bdi-MIR395j, bdi-MIR395k, bdi-MIR395l, bdi-MIR395n, bdi-MIR529, bdi-MIR319b, bdi-MIR397b, bdi-MIR156e, bdi-MIR156f, bdi-MIR156g, bdi-MIR156h, bdi-MIR156i, bdi-MIR166h, bdi-MIR166i, bdi-MIR167e, bdi-MIR395o, bdi-MIR395p, bdi-MIR156j, bdi-MIR160f, bdi-MIR166j, bdi-MIR167f, bdi-MIR167g, bdi-MIR169l, bdi-MIR169m, bdi-MIR169n, bdi-MIR171e, bdi-MIR171f, bdi-MIR395q
The miR160a, miR164d, miR169f, miR172a, miR172b, miR319, miR390, miR393, miR394, miR395a, miR397a, miR529 and miR827 were moderately expressed, and were represented by the number of sequences varying between 10 and 100. [score:3]
Click here for file Multiple sequence alignment of miR395 genes in Brachypodium and their homologs in rice. [score:1]
The genome organization of miR395 family in Brachypodium was quite different from that in rice. [score:1]
MiR395 belongs to conserved miRNAs that have been found across different plant species. [score:1]
Although up to now, all the miR395 gene family members in other eudicotyledonous and monocotyledonous plant genomes are clustered, the Brachypodium miR395d was not clustered with other paralogs (Figure 3). [score:1]
According to the miRBase, the miR395 family has multiple clustered members in both eudicotyledonous and monocotyledonous plants. [score:1]
Because miR395 only has one member in lower plant Physcomitrella, miR395d may be the ancient form of this family that is kept unchanged in Brachypodium, possibly under some kind of positive selection. [score:1]
The precursors of miR395a~c and miR395f~n show high sequence similarity, suggesting that they are derived from a series of gene duplication events. [score:1]
Multiple sequence alignment of miR395 genes in Brachypodium and their homologs in rice. [score:1]
These precursors exhibit different levels of sequence similarity to one another, implying that the duplication events happened at different time points during the evolution history of the miR395 family. [score:1]
The precursors of miR395a~c are clustered together and so were the precursors of miR395e~m. [score:1]
For miR395, its size in Brachypodium was approximately half of that in rice (Figure 3, Table 4). [score:1]
The location of miR395 genes are roughly in proportion to their real physical locations. [score:1]
According to the detected miRNA and miRNA* sequences as well as results of BLASTn search based on sequences similarity, 14 precursors with reasonable minimum free energy value were identified for miR395 in the draft Brachypodium genome (Figure 3). [score:1]
On the basis of size and sequence similarity, two types of miR395 precursors exist in Brachypodium. [score:1]
For all the miR395 precursors, the mature miRNAs are all located on the 3' arms. [score:1]
Asterisks denote miR395 genes whose miRNA* have been detected in our study. [score:1]
Small and big solid vertical bars represent type A and type B miR395 genes, respectively. [score:1]
Type A includes miR395a~c and miR395f~n, and type B includes miR395d and miR395e. [score:1]
Thus, an alternative explanation is that the unclustered miR395d may result from the loss of miR395 genes happened after duplication events during the evolution of this family. [score:1]
is a figure showing multiple sequence alignment of Brachypodium miR395 genes as well as their homologs in rice, performed with the ClustalW 1.83 program. [score:1]
Open vertical bars represent sequences showing similarity to miR395 genes, but containing no mature miR395 sequence. [score:1]
In Brachypodium, the miR395 family is encoded by 14 genome loci and two clusters are formed (Figure 3), suggesting that duplication evens in Brachypodium are not as active as that in rice. [score:1]
No miR395- precursor-like sequence was detected in its surrounding region. [score:1]
Both miR395 and miR395* could be detected in the NC library, although their reads were not high. [score:1]
They were named miR395a~miR395n according to the order of their genomic location. [score:1]
If this is the case, the loss of miR395 genes probably occurred after the divergence of Ehrhartoideae (rice) and Pooideae (Brachypodium), because there is no unclustered miR395 gene in rice. [score:1]
Figure 3Genomic organization of the miR395 family in Brachypodium. [score:1]
Among the conserved Brachypodium miRNA families, miR395 is distinguished because its members are clustered in several plant genomes. [score:1]
Interestingly, for almost all the conserved miRNA families (except miR395) with multiple members, their family sizes in Brachypodium are much smaller than those in rice and Populus, and most of them have sizes similar to those in Arabidopsis (Table 4). [score:1]
[1 to 20 of 30 sentences]
[+] score: 23
Third, although we identified several mutations in the functional regions (mature miRNA, miRNA precursor or promoter) of the candidate small RNA genes in domesticated rice, such as in the mature miR395a/b sequences and in tasi-ARF and the miR390 binding sites of TAS3 (Additional file 4 and 5), and found distinct expression levels of miR164e in the cultivated and wild rice (data not shown), it does not necessarily indicate a direct consequence of the domestication event. [score:5]
Expression of miR395 is greatly increased under sulfate starvation conditions [38]. [score:3]
miR395 targets ATP-sulfurylases that are involved in sulfate assimilation. [score:3]
Based on this criterion, our results thus suggest that MIR164e, MIR390, MIR395a/b and TAS3a2 are potential candidates of small RNA loci that have experienced direct selection during rice domestication. [score:2]
miR395 regulated sulfate metabolism might have been selected for high sulfate usage efficiency. [score:2]
Of the 20 loci selected, three (miR395a/b, TAS3a2 and MIR399d) had significant negative Tajima's D values and one (miR390) had extremely low divergence according to the above neutral test results (Additional file 3); the remaining loci were randomly chosen from the small RNA list shown in Additional file 1. As previously mentioned, the extent of nucleotide diversity of selected genes tends to be reduced. [score:1]
Of the 20 small RNA loci, four miRNA genes (MIR164e, MIR390, MIR395a/b and MIR399d) and two siRNA genes (TAS3a2 and AK120922) had signatures of positive selection in indica and/or japonica subgroup according to Tajima's D or HKA test (Table 1). [score:1]
At least one member each of four miRNA families (miR166, miR167, miR171 and miR395) were found to have experienced positive selection based on Tajima's D test in the natural Arabidopsis populations [16, 17]. [score:1]
Significantly negative values were found for several small RNAs, such as miR395a/b and TAS3a2 (Tajima's D value: -2.21 and -2.01) in the indica subgroup, suggesting that these small RNA loci could have experienced positive selection during rice evolution. [score:1]
In our study, significant signals of positive selection were also detected by Tajima's D test in at least one member of the miR166, miR167 and miR395 family in indica or japonica subgroup (Additional file 3), implying a potential conservation of adaptive evolution between rice and Arabidopsis for these miRNA families. [score:1]
For MIRNA loci, nucleotide diversities were separately estimated for the mature miRNAs, the pre-miRNAs, and the upstream and downstream regions of the mature miRNA (the miR395 family that is located at four clusters in which most members are less than 100 bp apart from each other was not included in this analysis). [score:1]
A common feature of these three families is that they have relatively large number of family members (e. g. 23 and 6 miR395 members in rice and Arabidopsis, respectively). [score:1]
Of the 20 loci selected, three (miR395a/b, TAS3a2 and MIR399d) had significant negative Tajima's D values and one (miR390) had extremely low divergence according to the above neutral test results (Additional file 3); the remaining loci were randomly chosen from the small RNA list shown in Additional file 1. As previously mentioned, the extent of nucleotide diversity of selected genes tends to be reduced. [score:1]
[1 to 20 of 13 sentences]
[+] score: 20
However, no NAC-related gene was discovered as a potential target mimic of miR395. [score:3]
Notably, based on the previous study, the expression of AT1G60710, a potential mimic of ath-miR395a/day/e, showed specific response to sulfur depletion treatment [36]. [score:3]
But, we suggest that the “target mimicry” relationship between NAC family gene transcript and miR395 identified in this subnetwork may not be a false positive. [score:3]
Thus, the target mimicry relationship between AT1G60710 and ath-miR395 could add a potential layer of miR395 -mediated sulfur signaling pathways. [score:3]
Thus, the regulatory cascade TCP—miR164—NAC—miR395 may be at the nexus of the auxin and the sulfur signaling pathways. [score:2]
Another novel finding was exploited from the miR159/319-, miR164- and miR395-involved subnetwork in rice (Figure 6). [score:1]
Another NAC—miR395 relationship was identified between LOC_Os10g33760.1 and most of the miR395 family members in rice (Figure 6 and Additional file 11: Table S4). [score:1]
Thus, whether the NAC—miR395 -mediated auxin—sulfur signal interaction is specifically existed in rice needs further interpretation. [score:1]
Figure 6 osa-miR159-, osa-miR319-, osa-miR164-, and osa-miR395-involved subnetworks. [score:1]
In Arabidopsis, a largely conserved subnetwork involving miR159/319, miR164 and miR395 was also extracted from the comprehensive network (Additional file 12: Figure S8). [score:1]
Ath-miR159/319-, ath-miR164-, and ath-miR395-involved subnetworks. [score:1]
[1 to 20 of 11 sentences]
[+] score: 19
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
The expression of miR395 is induced by long-term sulfate deficiency while expression of SULTR2;1 is repressed. [score:5]
The down-regulation of SULTR2;1 by sulfate deficiency is only detected in the shoots whereas its mRNA is greatly accumulated in the roots, suggesting that the degradation of SULTR2;1 by miR395 mainly occurs in the shoots (Takahashi et al., 1997, 2000). [score:4]
In addition to SULTR2;1, miR395 is also predicted to target several APS genes (APS1, APS2, APS3, and APS4), two (APS1 and APS4) of which were validated by 5′-RACE (Jones-Rhoades and Bartel, 2004; Allen et al., 2005). [score:3]
MiR395 is involved in regulating S assimilation by targeting the sulfate transporter gene SULTR2;1 and APS genes (Takahashi et al., 2000; Maruyama-Nakashita et al., 2003). [score:3]
Most of the sulfate is reduced in the plastid by APS, which indicates that miR395 is an important regulator of sulfate assimilation in plastids (Rotte and Leustek, 2000). [score:2]
Among the miRNAs response to nutrient starvation, miR395 and miR399 are two well documented miRNAs involved in S and P starvation responses, respectively (Takahashi et al., 2000; Maruyama-Nakashita et al., 2003; Fujii et al., 2005; Chiou et al., 2006). [score:1]
In rice, 14 miRNAs (miR159, miR169, miR171, miR319, miR395, miR474, miR845, miR851, miR854, miR896, miR901, miR903, miR1026, and miR1125) are significantly induced while 16 miRNAs are significantly repressed by drought (Zhao et al., 2007; Zhou et al., 2010). [score:1]
[1 to 20 of 7 sentences]
[+] score: 17
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR1876, osa-MIR395x, osa-MIR395y
Click here for file Figure S1: secondary structures of the rice osa- MIR395a-g and osa- MIR395h-l,y putative polycistronic homologous miRNA clusters. [score:1]
Specific miRNA clusters (such as those coding for miR395, miR169 and miR166) are highly conserved. [score:1]
In plant genomes, miR156, miR160, miR162, miR167, miR169, miR171 and miR395 families experienced large expansions via tandem or segmental duplication events and loss of family members ([29, 30, 52] and this study). [score:1]
Other miRNA clusters were specific to one plant genome analyzed (Figure 1d, e; the fourth rice miR395 cluster and the Ath- MIR166c, d locus). [score:1]
Osa- MIR156b-c, Osa- MIR166k-h, Osa- MIR169n-o, Osa- MIR172b-806a, Osa- MIR395a-g, Osa- MIR395h-l, and Osa- MIR395m-s clusters may contain only one promoter and be transcribed as polycistronic units. [score:1]
In the case of the rice cluster, a new miR395 locus (Osa- MIR395x) not yet present in miRBase (version 13.0) was annotated. [score:1]
Most miRNA clusters encode several copies of conserved miRNAs from the same family, that is, miR166, miR169, or miR395. [score:1]
Surprisingly, no miR395 syntenic locus could be retrieved in the poplar genome (Figure 1a-d). [score:1]
Furthermore, clustering of specific miRNAs (for example, miR395, miR169, miR166) is evolutionarily conserved. [score:1]
Folding analyses also revealed additional hairpins in the rice Osa- MIR395m-s and Osa- MIR395h-l clusters containing new miR395 loci not yet listed in miRBase (Osa- MIR395x [MiRBase:MI0013350] and Osa- MIR395y [MiRBase:MI0013351];). [score:1]
Homologous clusters were found for miR166, miR169 and miR395 families (based on the <10-kb threshold). [score:1]
Most of the few reported plant miRNA clusters contain several copies of the same conserved miRNA (miR156, miR166, miR169, miR395 or miR399), in contrast to animals where miRNAs with unrelated sequences are often included in the same clusters [18, 19, 25, 35]. [score:1]
Analysis of these miRNA clusters using VISTA Plot [36, 37] (Figure 1) revealed that some were syntenic between monocot and dicot plants (Figure 1a, b, f; two rice miR395 clusters and the Ath- MIR169i-n locus) or only within monocot plants (Figure 1c; a third rice miR395 cluster). [score:1]
VISTA plots [37, 70] shows the conservation of different clustered miRNAs in the three selected genomes (Table 1;): (a-d) the four rice miR395 clusters; (e) the Ath- MIR166c, d cluster; (f) the Ath- MIR169i-n cluster. [score:1]
Figure S1: secondary structures of the rice osa- MIR395a-g and osa- MIR395h-l,y putative polycistronic homologous miRNA clusters. [score:1]
Previous analyses of miR395 clusters in rice and M. truncatula, as well as a miR156 cluster in rice, maize, sugarcane, sorghum and even a dicot (Ipomea nil), have suggested conservation of homologous miRNA clusters in various plant genomes [16, 29, 30]. [score:1]
For example, homologous rice miR395 clusters show the highest number of miRNAs, each encoded in independent stem-loops that are probably generated by successive duplications of an ancestral hairpin (Figure 2a; Figure S1 in). [score:1]
[1 to 20 of 17 sentences]
[+] score: 17
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169j, osa-MIR169m, osa-MIR171d, osa-MIR171f, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, osa-MIR444a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820c, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1441, osa-MIR1846b, osa-MIR1882e, osa-MIR1883b, osa-MIR1846e, osa-MIR396f, osa-MIR2120, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2879, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR5158, osa-MIR5143b, osa-MIR5835, osa-MIR7693, osa-MIR7695
The osa-MIR395f and osa-MIR395a were the miRNAs in which expression was strongly up-regulated at 15 dpi (S5 Table). [score:6]
In addition, osa-MIR395 was frequently up-regulated upon environmental stresses [54]. [score:4]
On the contrary, the osa-MIR395a and osa-MIR2118n were the most down-regulated miRNAs, in which reads were decreased from 6 to 2 and 31 to 17, respectively, at 3 dpi (Fig 4B). [score:4]
For example, the well-known plant miRNAs such as osa-MIR166, osa-MIR167 and osa-MIR395 families are known to be involved in early rice developmental stages [18]. [score:2]
The read count for osa-MIR171f was increased from 21 to 42 reads between 3 dpi and 7 dpi whereas the read count for osa-MIR395a was increased from 168 to 2,367 between 7 dpi and 15 dpi (Fig 4A, S1 Table). [score:1]
[1 to 20 of 5 sentences]
[+] score: 14
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR390, osa-MIR444a, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR1432, zma-MIR390b, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, zma-MIR444a, osa-MIR6251
APS3 genes, i. e. GRMZM2G051270 and GRMZM2G149952 for maize and LOC_Os03g53230 for rice, were predicted to be binding targets of miR395 (Table  1). [score:3]
The similar regulation patterns of miR395 to APS3 genes between maize and rice indicated that this regulatory mechanism might have existed long before the speciation of maize and rice, i. e. although APS3 genes showed cell specific accumulation patterns in maize, which should not be direclty linked to C [4] photosynthesis. [score:3]
Our data showed that miR395 regulates sulfate adenylytransferase (APS3) in both maize (GRMZM2G051270, GRMZM2G149952) and rice (LOC_Os03g53230), suggesting that this regulatory mechanism is conserved between maize and rice. [score:3]
Liang G, Yu D. Reciprocal regulation among miR395, APS and SULTR2;1 in Arabidopsis thaliana. [score:2]
MiR395 has been reported to be crucial for sulfate homeostasis during growth and development in Arabidopsis [56]. [score:1]
More interestingly, miRNA families that form clusters in maize, such as miR2118, miR395 and miR159, tend to form clusters in rice as well, indicating that those miRNA families already existed in the last common ancestor of maize and rice. [score:1]
Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, et al. Molecular evolution of the rice miR395 gene family. [score:1]
[1 to 20 of 7 sentences]
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR437, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, tae-MIR159b, tae-MIR167a, tae-MIR399, tae-MIR408, tae-MIR444a, osa-MIR1432, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1848, osa-MIR1858a, osa-MIR1858b, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1871, osa-MIR1862d, osa-MIR1862e, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR166a, tae-MIR167b, hvu-MIR168, tae-MIR395a, tae-MIR395b, hvu-MIR397a, tae-MIR398, tae-MIR444b, hvu-MIR166b, hvu-MIR444a, osa-MIR1862f, osa-MIR1862g, hvu-MIR399, hvu-MIR444b, hvu-MIR166c, tae-MIR396, tae-MIR167c, tae-MIR397, hvu-MIR397b, hvu-MIR156b
Therefore, we infer that the fact that expression of miR395 is detected in Brachypodium, wheat and barley but not rice may be because of low expression levels and comparatively small datasets for rice (see Table 1). [score:5]
miR395 targets ATP sulfurylase and it is known that in Arabidopsis, at least, it is difficult to detect if sulfate levels are not limiting [19]. [score:3]
Another noteworthy feature of the data collated in Table 2 is that while miR395 is expressed in the wheat, Brachypodium and barley datasets, it does not appear in the three rice datasets reviewed in our study. [score:3]
This is the case even though the presence of the appropriate precursor to miR395 in the rice genome was used as evidence that it is among the 20 miRNA families conserved across monocots and dicots [2]. [score:1]
[1 to 20 of 4 sentences]
[+] score: 10
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR394a, ath-MIR394b, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ath-MIR827, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
Other conserved miRNA targets includes F-box protein (miRNA393, miRNA394), ATP sulfurylase (miRNA395), CCHC type zinc finger protein (miRNA482), NAD(P) -binding protein (miRNA827), and Poly(ADP-ribose) polymerase (miRNA1432), all of them are known to play roles in the expression control of genes involved in regulation of metabolic processes. [score:6]
Four known miRNA families, miR395, miR482, miR2118 and miR2275 were not successfully detected in our datasets suggesting that miRNAs expression maybe developmental and/or tissue-specific. [score:4]
[1 to 20 of 2 sentences]
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
The tandem duplication of miR395 detected in date palm was consistent with other the tandem duplication events detected in Arabidopsis, tomato, rice, Medicago and poplar [25], [34], [35]. [score:1]
In the miR164, miR172 and miR395 families, all miRNA members were involved in duplication events. [score:1]
In the miR395 family, three pairs of tandem duplications (MiR395d/e, miR395a/b and miR395f/g) were detected. [score:1]
miR396, miR166, miR172, miR169 and miR395 were also present at multiple loci in date palm, and these miRNAs had the highest average copy number in the other plant species. [score:1]
As indicated in Table 2, 19/21 replicated miRNAs (90%) were present in two copies, with two exceptions: miR166 (three copies) and miR395 (four copies). [score:1]
Contig PDK_30s6550926, which contained a tandem duplication of miR395, was found in orthologous segments in six plants, with a total of 13 copies. [score:1]
In addition to analysis of miRNA duplications between paralogous contigs, miRNA-containing tandem repeats were also detected in miR395 and miR396. [score:1]
However, no miR395 members existed in orthologous regions of the five plants. [score:1]
[1 to 20 of 8 sentences]
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR440, osa-MIR396e, osa-MIR528, osa-MIR529a, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR1428a, osa-MIR169r, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1866, osa-MIR1862d, osa-MIR1862e, osa-MIR1877, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR2275a, osa-MIR2275b, osa-MIR2871a, osa-MIR2871b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1862f, osa-MIR1862g, osa-MIR2863c, osa-MIR5159, osa-MIR5337a, osa-MIR5485, osa-MIR2275c, osa-MIR2275d, osa-MIR5337b
For example, a genome-wide study conducted across different developmental stages of rice revealed that 16 miRNAs, including miR156, miR159 and miR168, were downregulated by drought stress, while 14 miRNAs, such as miR169, miR319 and miR395, were upregulated [42]. [score:8]
[1 to 20 of 1 sentences]
[+] score: 8
The first direct evidence for the involvement of miRs in plant stress responses came from the work of Bartel’s group in Arabidopsis, where they identified several novel miRs, including miR395, which were up-regulated upon sulfate starvation (Jones-Rhoades and Bartel, 2004). [score:5]
Ath-miR395 targets a low-affinity sulfate transporter, AST68 and three ATP sulfurylases (APS1, APS3, and APS4) involved in sulfate assimilation. [score:3]
[1 to 20 of 2 sentences]
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Sulphur (S) starvation stimulated miR395, which targets plastidic ATP sulfurylase (APS), and the high-affinity sulfate transporter SULTR2;1 [6, 12, 14]. [score:3]
However, we did not detect miR157, miR393,miR395, or miR398 as previously reported. [score:1]
Past studies suggested that only miR399 and miR395 are transported from shoots to roots via phloem but not xylem vessels [12, 16]. [score:1]
Possible explanations are that (i) strict criteria were implemented in this study for identification of mature miRNAs; and (ii) the RNA samples were limited to low P-stressed leaves and roots, along with their control, so -S -induced miR395 and -Cu -induced miR398 were not likely to be detected. [score:1]
The levels of miR395, miR398 and miR399 were strongly augmented in response to S, Cu or Pi starvation in phloem. [score:1]
[1 to 20 of 5 sentences]
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR396f, osa-MIR395x, osa-MIR395y, osa-MIR3980a, osa-MIR3980b, osa-MIR5794
Sulphur starvation induces the expression of microRNA-395 and one of its target genes but in different cell types. [score:5]
Interplay of SLIM1 and miR395 in the regulation of sulfate assimilation in Arabidopsis. [score:2]
[1 to 20 of 2 sentences]
[+] score: 6
Other miRNAs from this paper: osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR398a, osa-MIR398b, osa-MIR160e, osa-MIR160f, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR167j, osa-MIR437, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, tae-MIR160, tae-MIR167a, tae-MIR1117, tae-MIR1118, tae-MIR1120a, tae-MIR1122a, tae-MIR1125, tae-MIR1127a, tae-MIR1128, tae-MIR1131, tae-MIR1133, tae-MIR1135, tae-MIR1136, tae-MIR1139, osa-MIR169r, osa-MIR1436, osa-MIR1439, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, bdi-MIR167a, bdi-MIR1139, bdi-MIR1122, bdi-MIR437, bdi-MIR169b, bdi-MIR1127, bdi-MIR1135, osa-MIR395x, osa-MIR395y, tae-MIR167b, tae-MIR169, tae-MIR395a, tae-MIR395b, tae-MIR398, tae-MIR5085, bdi-MIR5070, bdi-MIR169d, bdi-MIR169i, bdi-MIR395a, bdi-MIR169j, bdi-MIR160a, bdi-MIR395b, bdi-MIR167b, bdi-MIR160b, bdi-MIR167c, bdi-MIR169k, bdi-MIR160c, bdi-MIR167d, bdi-MIR169g, bdi-MIR160d, bdi-MIR160e, bdi-MIR169e, bdi-MIR398a, bdi-MIR169a, bdi-MIR169h, bdi-MIR169c, bdi-MIR395c, bdi-MIR5180b, bdi-MIR5175a, bdi-MIR5175b, bdi-MIR395d, bdi-MIR398b, bdi-MIR5180a, bdi-MIR169f, bdi-MIR395m, bdi-MIR395e, bdi-MIR395f, bdi-MIR395g, bdi-MIR395h, bdi-MIR395j, bdi-MIR395k, bdi-MIR395l, bdi-MIR395n, osa-MIR818f, bdi-MIR167e, bdi-MIR395o, bdi-MIR395p, bdi-MIR5049, bdi-MIR160f, bdi-MIR167f, bdi-MIR167g, bdi-MIR169l, bdi-MIR169m, bdi-MIR169n, bdi-MIR395q, bdi-MIR2118a, bdi-MIR2118b, tae-MIR1122b, tae-MIR1127b, tae-MIR1122c, tae-MIR167c, tae-MIR5175, tae-MIR1120b, tae-MIR1120c, tae-MIR6197, tae-MIR5049
miRNA Name Species of target was identified Experimentally conformed target miR167 ath/osa Auxin response factors miR395 ath/osa ATP sulphurylase miR160 ath/osa Auxin response factors ath-Arabidopsis thaliana; osa-Oryza sativa. [score:5]
Chr1 Chr2 Chr3 Chr4 Chr5 miR1127 * miR1128 * * * * * miR1133 * miR1135 * miR1139 * * * miR1439 * * * * * miR167 * miR395 * * miR5049 * * * * * miR5175 * * * miR5180 * * * miR5203 * * * * Bold miRNAs gave the best results that they were syntenic to Bd4. [score:1]
[1 to 20 of 2 sentences]
[+] score: 6
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR444a, osa-MIR528, osa-MIR530, osa-MIR531a, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR1429, osa-MIR1431, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR531b, osa-MIR1857, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR812f, osa-MIR1862d, osa-MIR1862e, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1883a, osa-MIR1883b, osa-MIR1320, osa-MIR827, osa-MIR1846e, osa-MIR2121a, osa-MIR2864, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR1862f, osa-MIR1862g, osa-MIR3979, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR5083, osa-MIR5143a, osa-MIR5156, osa-MIR5513, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR6248, osa-MIR6249a, osa-MIR531c
miRNAs such as miR398, which keeps the balance the mount of ROS productivity and modulates hormone signaling cascades, and miR395, which participates in modulating plant growth and development, were regulated in both rice lines at the late stage (Fig.   7) 59, 63. [score:3]
On the other hand, the 38 miRNAs differentially expressed only in PC represented eight families (miR166, miR395, miR812, miR827, miR1320, miR1862, miR3980 and miR6248) (Table  4). [score:3]
[1 to 20 of 2 sentences]
[+] score: 6
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166d, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR396e, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818b, osa-MIR169r, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
Several miRNAs have been reported to regulate drought-responsive genes [10, 15, 16], and it has been shown that rice miR159, miR169, miR395 and miR474 are drought-inducible, while the expression of miR156, miR168, miR170, miR172, miR396, miR397 and miR408 is suppressed by drought [13, 16]. [score:6]
[1 to 20 of 1 sentences]
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1427, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR5485, osa-MIR5486, osa-MIR5487, osa-MIR5488, osa-MIR5492, osa-MIR5497, osa-MIR5509, osa-MIR2275c, osa-MIR5517, osa-MIR2275d, osa-MIR5528, osa-MIR5791, osa-MIR5792, osa-MIR5793, osa-MIR5796, osa-MIR5797, osa-MIR5800, osa-MIR5806, osa-MIR5818, osa-MIR5179
The expression of 20 conserved miRNA families were detected in our rice inflorescence libraries except osa-miR395 (S1 Table). [score:3]
osa-miR395 is non-detectable in rice inflorescence. [score:1]
[1 to 20 of 2 sentences]
[+] score: 4
Zhang et al. (2013) reported that miR395 overexpressing rapeseed (Brassica napus) showed a lower degree of Cd -induced oxidative stress than wild-type plants, suggesting that miR395 would be involved in detoxification of Cd in B. napus. [score:3]
miR395 is involved in detoxification of cadmium in Brassica napus. [score:1]
[1 to 20 of 2 sentences]
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR414, osa-MIR419, osa-MIR435, osa-MIR390, osa-MIR396e, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1426, osa-MIR169r, osa-MIR1436, osa-MIR1440a, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ctr-MIR156, ctr-MIR166, ctr-MIR319, ctr-MIR164, ctr-MIR167, ctr-MIR171, osa-MIR395x, osa-MIR395y, osa-MIR1440b
We also found homologs of known miRNA target genes for several conserved C. trifoliata miRNAs, such as SBP for miR156, ATP synthase for miR159, ARF for miR160, NAC for miR164, HD-Zip for miR165 and miR166, Anthocyanidin synthase for miR169, GRAS for miR171, AP2 for miR172, TCP for miR319, TIR for miR393, F-box for miR394, Sulfate transporter 2.1 for miR395, IRX12 copper ion binding/oxidoreductase for miR397, ARGONAUTE 2 for miR403, Basic blue copper protein for miR408 and Zinc finger protein-related for miR414. [score:3]
Additionally, fifteen miRNA families namely miR156, miR159, miR160, miR162, miR164, miR166, miR167, miR168, miR169, miR171, miR172, miR390, miR394, miR403, and miR1446, were found to have some thousands to tens of thousands of redundancies while four families (miR395, miR396, miR397, miR414, and miR827), had more than one hundred redundancies. [score:1]
[1 to 20 of 2 sentences]
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR810a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR820a, osa-MIR1423, osa-MIR1425, osa-MIR1432, osa-MIR169r, osa-MIR810b, osa-MIR1436, osa-MIR1441, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR812f, osa-MIR1873, osa-MIR1862d, osa-MIR1862e, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR827, osa-MIR396f, osa-MIR2873a, osa-MIR2878, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR1862f, osa-MIR1862g, osa-MIR812n, osa-MIR812o, osa-MIR2873b, osa-MIR5071, osa-MIR5074, osa-MIR5075, osa-MIR5077, osa-MIR5080, osa-MIR5081, osa-MIR5144, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR5795, osa-MIR812s, osa-MIR5802, osa-MIR812t, osa-MIR812u, osa-MIR5805, osa-MIR812v, osa-MIR5807, osa-MIR2873c, osa-MIR6253, osa-MIR1861o
However, the low expression of osa-MIR395 [miRBase:MIPF0000016] and osa-MIR399 [miRBase:MIPF0000015] is in agreement with the findings of Mallory et al. [32] that reported these miRNAs as non detectable in plants grown under standard conditions, but were induced by low-sulphate and low-phosphate stresses respectively. [score:3]
as high [transcripts per million (TPM) > 10000/100000; osa-MIR168, osa-MIR156, osa-MIR166], moderate (TPM = 100–10000; osa-MIR167, osa-MIR397, osa-MIR408, osa-MIR159, osa-MIR164, osa-MIR172, osa-MIR396) and low (TPM < 100; osa-MIR160, osa-MIR162, osa-MIR169, osa-MIR171, osa-MIR390, osa-MIR393, osa-MIR394, osa-MIR395, osa-MIR398, osa-MIR399, osa-MIR827). [score:1]
[1 to 20 of 2 sentences]
[+] score: 3
We found for example that both the osa-miR820c and osa-miR395 family members can co-target the LOC_Os03g53230.1, a gene that encodes bifunctional 3-phosphoadenosine 5-phosphosulfate synthetase that is highly abundant in the roots of 7-day-old rice seedlings (GSE6893). [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1435, osa-MIR1849, osa-MIR1850, osa-MIR1856, osa-MIR1860, osa-MIR1861e, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1870, osa-MIR1874, osa-MIR1862d, osa-MIR1862e, osa-MIR2055, osa-MIR827, osa-MIR2098, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1862f, osa-MIR1862g
MiRNA families highly conserved across plant species, such as miR166, miR167, and miR168, were sequenced more than 10,000 times, whereas previously known stress -induced members, such as miR395 and miR399, were detected less than 10 times (Additional file 3A), indicating that tissue-specific expression patterns of miRNAs are related to their functions. [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
There were extremely low frequencies of miR395, miR399, miR2275, miRs12, and miRs19, possibly because these families are expressed in a tissue-specific manner. [score:3]
[1 to 20 of 1 sentences]
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR444a, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1423, osa-MIR1425, osa-MIR1427, osa-MIR1428a, osa-MIR1429, osa-MIR1430, osa-MIR1431, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR810b, osa-MIR1435, osa-MIR1436, osa-MIR1437a, osa-MIR1440a, osa-MIR1441, osa-MIR1442, osa-MIR1439, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1440b, osa-MIR818f, osa-MIR1437b
The lowest frequency was found in the case of miR394, miR395, 399 and 408, which were represented by only a few of reads in these libraries (Table 4). [score:1]
Thus far, miR395, a known conserved miRNA could be mapped to the 26 loci in rice (miRBase). [score:1]
[1 to 20 of 2 sentences]
[+] score: 2
It has been suggested that several small RNA loci, such as miRNA-triggered phasiRNAs loci including ta-siRNA locus TAS3a2, as well as the microRNA loci MIR164e, MIR390 and MIR395a/b, have experienced direct selection during Asian rice domestication (Liu et al. 2013; Wang et al. 2010; Wang et al. 2012). [score:2]
[1 to 20 of 1 sentences]
[+] score: 2
They also found that miR395 and miR399 have distinct expression patterns compared with other species, and this may be related to the wide adaptability of switchgrass growth. [score:2]
[1 to 20 of 1 sentences]
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR528, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR821a, osa-MIR821b, osa-MIR821c, osa-MIR1432, osa-MIR169r, osa-MIR1846d, osa-MIR1846a, osa-MIR1846b, osa-MIR1876, osa-MIR1846c, osa-MIR1846e, osa-MIR395x, osa-MIR395y
MiR395 and miR399 have been found to mend regulatory processes under sulphur and phosphorus limitations, respectively [25]– [29]. [score:2]
[1 to 20 of 1 sentences]
[+] score: 1
2,e ATPase, AAA-type, core domain GO:0005783 Os08g0482700 osa-MIR444 Conserved hypothetical protein GO:0003674 Os04g0459600 osa-MIR442 Mog1/PsbP, alpha/beta/alpha sandwich domain NA Os05g0414700 osa-MIR403 Brassinosteroid insensitive 1 receptor kinase 1 GO:0005102 Os05g0557700 osa-MIR399j Conserved hypothetical protein GO:0005575 Os01g0850700 osa-MIR397b′ Cupredoxin domain containing protein GO:0009056 Os01g0121600 osa-MIR396c-3p Conserved hypothetical protein GO:0006810 Os01g0180800 osa-MIR396c Heat shock protein Hsp70 family protein GO:0005634 Os03g0225500 osa-MIR395f ′ Nucleoporin, Nup133/Nup155- GO:0005515 Os05g0574500 osa-MIR395c′o′ GTP -binding nuclear protein Ran1B GO:0005515 Os03g0195300 osa-MIR395 Low affinity sulfate transporter 3 GO:0016020 Os03g0559700 osa-MIR393ab′ Conserved hypothetical protein NA Os03g0388900 osa-MIR319a. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, zma-MIR156l, zma-MIR166n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR482, zma-MIR1432, osa-MIR395x, osa-MIR395y
Except for zma-miR393, zma-miR1432, zma-miR408, zma-miR482 and zma-miR395, 23 of 28 known maize miRNA families had members detected in at least one of the four sequenced libraries. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Genomic fragments of 650–850-bp containing the binding sites of the miRNAs (miR156::Os08g39890, miR159::Os01g59600, miR390::Os02g10100, miR395::Os03g09930, miR408::Os03g15340 and miR820a::Os03g02010) were amplified and sequenced (Accession nos. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
In addition, we detected 20 conserved kn-miR families in these libraries, and 16 of the families, apart from miR394, miR395, miR398 and miR408, were sequenced in developing rice pollen (Additional files 1 and 2). [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR418, osa-MIR396e, osa-MIR531a, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR531b, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR531c
of loci miR156 ND d 1 miR159 MYB and TCP TFs e b 2 miR160 ND d 1 miR162 DICER-LIKE 1 b 1 miR164 ND a 1 miR166 HD-Zip TFs f, h, k h, k, n h, n c 9 miR167 Auxin response factors TFs a, d, f j d a 6 miR168 ARGONAUTE b 1 miR169 CCAAT binding factor and HAP2-like TFs n, p c 3 miR171 SCARECROW-like TFs c, e, f c c, d a 7 miR319 ND a 1 miR395 ATP sulphurylases i, j, k 3 miR396 GRF TFs, rhodenase-like, and kinesin-like protein B b 1 miR397 Laccases and beta-6 tubulin a a 2 miR399 Phosphatase TFs e b, e 3 miR418 ND x x 2 miR420 ND x x x 3 miR441 ND b a, b, c c 5 miR442 ND x x x 3 miR446 ND x x x 3 miR531 ND x x 2 miR535 ND x x x x 4 Total no. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
In Oryza and Populus, we find no new miSquare families, but three new members of known miRBase families (oza-MIR399, ptc-MIR166, and ptc-MIR395; see Table 2). [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, osa-MIR444a, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1425, osa-MIR1428a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1874, osa-MIR2055, osa-MIR827, osa-MIR1428f, osa-MIR1428g, zma-MIR396d, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR827, osa-MIR395x, osa-MIR395y, zma-MIR444a, zma-MIR444b
These correspond to miR156 and miR395 in rice and maize [37- 39] and miR166 in Medicago truncatula [40]. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR444a, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
Induction of miR395 and miR399 was observed in response to sulfate and phosphate deprivation, respectively [10, 11]. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR528, osa-MIR531a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR814b, osa-MIR1425, osa-MIR1432, osa-MIR444d, osa-MIR444f, osa-MIR531b, osa-MIR1847, osa-MIR1849, osa-MIR1850, osa-MIR1852, osa-MIR1846a, osa-MIR1846b, osa-MIR1868, osa-MIR812f, osa-MIR1875, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1883a, osa-MIR1846e, osa-MIR2093, osa-MIR2865, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR2873b, osa-MIR5074, osa-MIR2863c, osa-MIR5150, osa-MIR5485, osa-MIR5486, osa-MIR5487, osa-MIR5490, osa-MIR5491, osa-MIR5497, osa-MIR5499, osa-MIR5504, osa-MIR5505, osa-MIR5506, osa-MIR5516a, osa-MIR5519, osa-MIR5521, osa-MIR5528, osa-MIR5538, osa-MIR812p, osa-MIR812q, osa-MIR5791, osa-MIR5792, osa-MIR5793, osa-MIR812r, osa-MIR5797, osa-MIR812s, osa-MIR5800, osa-MIR812t, osa-MIR812u, osa-MIR5806, osa-MIR812v, osa-MIR5815, osa-MIR5817, osa-MIR5818, osa-MIR1319b, osa-MIR5179, osa-MIR5834, osa-MIR5836, osa-MIR5516b, osa-MIR6250, osa-MIR6253, osa-MIR531c
The most abundant three families of miRNA were miR812, miR166, and miR395. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
This was observed in a previous study on tandem duplicated paralogs of miR395 in rice and miR168 in Brassicaceae [34], [35]. [score:1]
[1 to 20 of 1 sentences]