sort by

84 publications mentioning osa-MIR159a

Open access articles that are associated with the species Oryza sativa and mention the gene name MIR159a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 233
In the light of the above studies, it is possible that change in the expression of miR159 targets, OsGAMYB and OsGAMYBL1, in STTM159 transgenic rice plants, could affect the development of agronomic traits of rice such as plant height, grain size and others, which are not seen in plants overexpressing cleavage resistant targets of miR159. [score:10]
In this study, expression of mature miR159 was successfully suppressed by STTM which resulted in the increased expressions of its two targets genes, OsGAMYB and OsGAMYBL1 (GAMYB-LIKE 1). [score:9]
Similarly, overexpressing cleavage-resistant targets such as in the case of OsGAMYB or TaGAMYB1 in rice, may not lead to the similar phenotype as obtained by downregulating miR159. [score:8]
For functional studies of miR159 in rice, we suppressed the expression of miR159 through STTM (Short Tandem Target Mimic, denoted as STTM159), which is an effective tool to block endogenous mature miRNA activity in plant [29]. [score:7]
In general, their expression levels were negatively correlated with the expression level of miR159 except in spikelet (Fig.   1b), suggesting toward a complex relationship between miR159 and its target genes in rice. [score:7]
Recent reports found that plant miR159 mimic could even inhibit breast cancer cell growth by targeting TCF7, a putative mammalian target for miR159 [25]. [score:7]
This could possibly be due to combined higher expression of two miR159 targets as opposed to just one in case of TaGAMYB1 overexpressing lines. [score:7]
These results strongly suggest that reduced expression of miR159 suppressed the expression of these genes to restrain cell proliferation to form smaller organs in STTM159 plants. [score:7]
The phenotype of miR159 overexpressing plants was severe compared to that of the gamyb mutant, indicating toward the phenotypic contributions of other GAMYB-like genes, suppressed in miR159 overexpressing plants [28]. [score:6]
Furthermore, phenotype such as shortened internodes and panicles brought out by suppression of miR159 observed in STTM159, was also observed in the gamyb mutant [33], suggesting that other targets regulated by miR159 might also be responsible for the changed agronomic traits. [score:6]
Considering that miR159 regulates an important agronomic trait of grain size, manipulation of the expression of miR159 or its target genes can help achieve higher rice yield on account of increased grain size. [score:6]
The significant increase in mRNA levels of the target genes in STTM159 plants suggested toward the regulation of targets transcripts by miR159 -mediated cleavage. [score:6]
Together with the smaller organs in STTM159 transgenic plants, all these evidences indicate that higher expression level of OsGAMYB, because of the suppression of miR159, may contribute to the reduced cell division by activating PCD process in STTM159 transgenic plants. [score:5]
To determine the expression patterns of miR159, we analyzed the expression of miR159a by stem-loop qRT-PCR. [score:5]
The interplay of miR159 and its target MYB genes is involved in the regulation of vegetative growth, flowering time, anther development and seed size in Arabidopsis [20– 22]. [score:5]
a Suppressed expression of miR159 in root, leaf, stem, panicle, spikelet and seeds in STTM159 plants. [score:5]
In tomato, a non MYB gene (Solyc12g014120.1) was found to be a target of miR159, and whose overexpression in tomato reduced the size of leaves and induced formation of abnormal and sterile flowers [32]. [score:5]
Till date, reports about miR159 in rice were mostly focused upon genome-wide expression analyses about responses to different nitrogen forms [26] and abiotic stress [27] or upon phenotypic studies by overexpressing its precursor [28]. [score:5]
Expression profiles of miR159 and its target genes in rice. [score:5]
In rice, studies on miR159 were either based upon genome-wide expression analyses focused upon responses to different nitrogen forms and abiotic stress or upon phenotypic studies of transgenic plants overexpressing its precursor. [score:5]
Fig. 5Suppressed expression of miR159 reduces the size of spikelet hulls. [score:5]
Fig. 1Tissue-specific expression analysis of miR159a and its targets. [score:5]
b Expression patterns of miR159a,b and its two targets during rice growth in various tissues. [score:5]
Scale bars, 500 μm; e-f Statistical data of outer layer vascular bundle in stem (e) and small veins between two large veins (f) in wild type and STTM159 plants (n = 20) To further explore the mechanism of osa-miR159 on plant growth and development at genetic level, RNA-sequencing analysis was done using six DAF grains from wild type and STTM159 transgenic plants to compare the global transcriptional profiles of differentially expressed genes between two genotypes. [score:4]
As expected, compared with wild type, expressions of mature miR159 were suppressed effectively in root, leaf, stem, panicle, spikelet, and seeds of transgenic rice STTM159 line 3 and 4 (denoted as STTM159–3 and STTM159–4, respectively) (Fig.   2a). [score:4]
Deregulation of miR159 might be linked with leaf curl disease in tomato [24]. [score:4]
Arabidopsis plants overexpressing miR159a/b do not affect leaf development [19], while mir159ab double mutants form abnormal leaves that are curled upward [20]. [score:4]
To confirm whether miR159 was down regulated in these transgenic lines, the expression levels of mature miR159 were detected by stem-loop qRT-PCR. [score:4]
This phenotype may result from aberrant cell-cycle due to reduced expressions of cell division, and hormone biosynthesis and signaling genes controlled by miR159-regulated gene networks. [score:4]
Further studies are required to explore the underlying pathways governed by OsGAMYB, OsGAMYBL1 and other possible miR159-target genes regulating agronomic traits in rice. [score:4]
Further analysis from the RNA-seq data showed that the decreased cell divisions in STTM159 transgenic plants may result, at least partly from the lower expression of the genes involved in cell cycle and hormone homeostasis, which provides new insights of rice miR159-specific functions. [score:3]
In rice, miR159 was predicted to target several genes, such as MYBs, and other genes (Additional file  2). [score:3]
It also suggests that a complex cross-talk between rice miR159 and its downstream targets may exist, whose details should be studied further. [score:3]
Functional studies of loss-of-function mutants of miR159 were done in Arabidopsis or other plants through genetic mutants or artificial target mimics. [score:3]
Consistent with that, transcripts levels of the two miR159 targets, OsGAMYB and OsGAMYBL1, were much higher in STTM159 than those in wild type according to our RNA-seq data and results of qRT-PCR (Additional file  2, Fig.   2b-c). [score:3]
In contrast, rice plants overexpressing miR159, showed a severe defect in elongation of the top internode and the panicles developed malformed flowers within the leaf sheaths. [score:3]
miR159 targets MYB transcription factors in Arabidopsis thaliana [19], predominantly AtMYB33 and AtMYB65 [20]. [score:3]
Consistent with this, over expression of wheat miR159 in rice induced male sterility and reduced seed setting rate [31]. [score:3]
In addition, other obvious changes resulting from suppression of miR159 were the grain size and weight (Fig.   4a, b). [score:3]
Overall, these results suggest that suppression of rice miR159 affected multiple agronomic traits, significantly. [score:3]
It will be interesting to see if manipulation of other miR159-targets could affect agronomic traits as well. [score:3]
Thirdly, some unknown miR159 target genes might contribute to the phenotype of STTM159 plants. [score:3]
Our study first describes altered agronomic traits of rice under decreased expression of miR159 achieved by STTM technology. [score:3]
Expression of miR159 is abundant and widespread in all plant parts. [score:3]
miR159 was suppressed effectively in STTM transgenic plants. [score:3]
The present study indicates that miR159 positively regulates organ size, including stem, leaf, and grain size in rice by promoting cell division. [score:2]
Rice miR159 Agronomic traits Cell cycle Plant hormone Plant microRNAs (miRNAs) are 20–24 nucleotides (nt) long and wi dely exist as gene regulators. [score:2]
Therefore, specific roles of miR159 in rice could be explored by down regulating miR159 through STTM. [score:2]
Our data suggests that in rice, miR159 positively regulates organ size, including stem, leaf, and grain size due to the promotion of cell division. [score:2]
The miR159 family is one of the most ancient and conserved miRNA families among monocot and dicot plants. [score:1]
All the experiments were performed taking three biological replicates and values are the means ± SD miR159 is a conserved miRNA among plant species. [score:1]
It has been reported that miR159a might be the dominant locus for the production of miR159 [28]. [score:1]
Studies on miR159 are mostly done on mo del plant, Arabidopsis thaliana. [score:1]
In miRBase, Osa-miR159 is a conserved miRNA family, and shared conserved 18 nucleotides, from 2 to 19, in rice (Fig.   1a). [score:1]
The miR159– MYB101 network in Arabidopsis thaliana may be important for the modulation of vegetative growth [23]. [score:1]
mir159a,b double mutant has pleiotropic morphological defects, including altered growth habits, curled leaves, small siliques and seeds; and these phenotypes could be reversed if MYB33 was also mutated in the miR159a,b double mutant background. [score:1]
All the experiments were performed taking three biological replicates and values are the means ± SD In miRBase, Osa-miR159 is a conserved miRNA family, and shared conserved 18 nucleotides, from 2 to 19, in rice (Fig.   1a). [score:1]
Rice genome has at least six putative transcriptional units for miR159 precursors according to miRBase 21 (http://www. [score:1]
Our results indicate that down regulation of miR159 results in reduced stature, shorter leaf, panicle length and smaller seeds compared to wild type. [score:1]
miR159 is a conserved miRNA among different plant species and has various functions in plants. [score:1]
[1 to 20 of 60 sentences]
2
[+] score: 168
In our previous study, we found that miR159 was downregulated in wheat seedling leaves after heat stress for 2 hrs and that the expression pattern of its putative target TaGAMYB was negatively related to the accumulation of miR159, suggesting that miR159 and its putative targets may be involved in response to heat stress [31]. [score:10]
The results revealed that Ubi::TamiR159 transgenic lines were heat sensitive, indicating that overexpression of miR159, combined with downregulation of GAMYB expression leads to a loss of heat tolerance. [score:8]
In this study, we found three homeologous genes of the miR159 to be upregulated after high temperature treatment for 2 hrs, this upregulation was more dramatically induced in the heat-tolerant variety than in the heat-sensitive one. [score:7]
In cereals and Arabidopsis, GAMYB genes are predominantly expressed in the anthers and seeds, where miR159 is less accumulated [21], [22], this negative correlation in expression pattern provides evidence for miR159-directed GAMYB regulation. [score:7]
Overexpression of miR159 and TaGAMYB1 in Rice Leads to an Abnormal PhenotypeTo further elucidate the biological function of TamiR159 and its target TaGAMYB1, we generated transgenic rice that overexpresses the wheat miR159 precursor, TaGAMYB1 and mTaGAMYB1 (with a miR159 cleavage-resistant site) under the control of the strong and constitutive ubiquitin promoter. [score:7]
Transgenic Arabidopsis overexpressing miR159 show pleiotropic morphological defects, such as anther defects due to the de-regulation of AtMYB33 and AtMYB65, including those related to the anthers, male sterility, delayed flowering, reduced apical dominance and small siliques, which are suppressed in the mir159abmyb33myb65 quadruple mutant [20], [29]. [score:6]
The target gene of miR159, GAMYB, was first identified as a downstream GA signaling target in aleurone cells of barley (Hordeum vulgare L. ) [23]. [score:5]
However, the relationship between the altered accumulation of miR159 and expression of its target, GAMYB genes in abiotic stress response has yet to be elucidated. [score:5]
To further elucidate the biological function of TamiR159 and its target TaGAMYB1, we generated transgenic rice that overexpresses the wheat miR159 precursor, TaGAMYB1 and mTaGAMYB1 (with a miR159 cleavage-resistant site) under the control of the strong and constitutive ubiquitin promoter. [score:5]
In this study, we identified two full-length GAMYB genes putatively regulated by miR159 in wheat and confirmed using 5′-RACE and a transient expression system that TamiR159 directs the cleavage of two TaGAMYB transcripts. [score:5]
We previously reported a diverse set of wheat miRNAs responsive to heat stress, among which miR159 was downregulated after high temperature treatment for 2 hrs [31]. [score:4]
MiR159 is a conserved miRNA found in the dicots and monocots, and negatively regulates the expression of GAMYB genes at the posttranscriptional level [19]. [score:4]
Although the abundance of miR159 is below detection levels in anthers and seeds, the unequal expression levels of these three homeologous genes suggest that the involvement of either a homeologous-specific cis-element in the promoter region or epigenetic regulation. [score:4]
In Ubi::TamiR159 lines, mature miR159 was highly expressed, and OsGAMYB transcripts were almost undetectable, suggesting that miR159 derived from a wheat precursor has the capability to direct cleavage of the rice endogenous OsGAMYB in vivo (Figure 4A). [score:4]
In addition to defective anther development, the delayed heading time of both Ubi::TamiR159 and Ubi::mTaGAMYB1 transgenic plants is consistent with Arabidopsis studies in which miR159 or mAtMYB33 (miRNA binding site-disrupted) overexpression results in late flowering. [score:4]
The arrow indicates the cleavage site, and the sequence of the mutated miR159 target site is illustrated (bottom). [score:3]
Overexpression of miR159 in rice results in decreased levels of OsGAMYB during inflorescence and flower malformation [21]. [score:3]
Among these genes, miR159 -guided cleavage of AtMYB33 and AtMYB65 was detected using 5′-RACE and transient expression in Nicotiana benthamiana [20]. [score:3]
Here, we identified two full-length GAMYB genes TaGAMYB1 and TaGAMYB2, which were putatively regulated by miR159 in wheat and experimentally confirmed that TamiR159 directs the cleavage of two TaGAMYB transcripts. [score:3]
Taken together, our data provided further evidence for the biogenesis of miR159 and its cleavage of target genes being conserved among different plant species. [score:3]
One possible explanation is that other putative targets of miR159 might also contribute to the failure of pollen production. [score:3]
For example, miR159-regulated GAMYB-like family transcription factors function in flower development and gibberellin (GA) signaling in cereal aleurone cells. [score:3]
Overexpression of miR159 and TaGAMYB1 in Rice Leads to an Abnormal Phenotype. [score:3]
Furthermore, due to inability to bind with miR159, tissues co -expressing 35S::TamiR159 and 35S::mTaGAMYB1 (miR159 cleavage-resistant) did not exhibit obvious transcript changes relative to those transformed with the 35S::mTaGAMYB1 construct alone (Figure 2B). [score:3]
Due to the negative correlation between miR159 accumulation and TaGAMYB1 expression during heat stress, we further tested the heat tolerance of transgenic rice containing Ubi::TamiR159, Ubi::TaGAMYB1 and Ubi::mTaGAMYB1 constructs. [score:3]
Moreover, we generated rice transgenic lines with wheat miR159 precursor overexpression, in which an increase mature miR159 and decrease in endogenous OsGAMYB were detected. [score:3]
There were also reported differences between reported rice miR159 overexpression lines and Ubi::TamiR159 transgenic lines. [score:3]
For example, miR159 was almost absent in spikes at the booting stage and in developing endosperms in wheat [21], [34], whereas TaGAMYB showed high expression levels in anthers and seeds, similar to previous reports in Arabidopsis and rice [21], [22]. [score:3]
In addition, miR159 and TaGAMYB1 expression levels were negatively correlated. [score:3]
Together, these results indicate that miR159 is part of a homeostatic mechanism to direct GAMYB transcript degradation in plants. [score:2]
There was no sequence variation in the miR159 binding site among these three homeologous genes, meaning that they shared the same miR159-directed cleavage machinery. [score:2]
For example, Reyes and Chua [30] reported that ABA -induced accumulation of miR159 is a homeostatic mechanism to desensitize hormone signaling during seedling stress response, directing AtMYB33 and AtMYB101 transcript degradation [30]. [score:2]
It was previously reported that miR159 negatively regulates GAMYB at the post-transcriptional level in both rice and Arabidopsis. [score:2]
MiR159- GAMYB Pathway Might Contribute to Heat Stress ResponseConsidering that miR159 and TaGAMYB1 mRNA are heat-inducible, we examined the performance of plants overexpressing miR159 and TaGAMYB1 under heat stress when compared to the wild type. [score:2]
These results suggest that miR159-directed cleavage of OsGAMYB may participate in the heat stress response in Ubi::TamiR159. [score:2]
The length of the first internode of miR159 overexpression plants and gamyb mutants was shorter than that of wild type [21], but Ubi::TamiR159 plants did not exhibit this difference, nor did they differ in plant height compared with wild type. [score:2]
Considering that miR159 and TaGAMYB1 mRNA are heat-inducible, we examined the performance of plants overexpressing miR159 and TaGAMYB1 under heat stress when compared to the wild type. [score:2]
MiR159-directed Cleavage of TaGAMYB1 and TaGAMYB2, Putative HvGAMYB OrthologsWe previously reported two ESTs containing the reverse complementary binding site for miR159 [31]. [score:2]
This common phenotype suggests that the miR159- GAMYB system is critical for the transition from vegetative stage to reproductive stage and is conserved between monocots and dicots. [score:1]
Numbers in italics indicate the proportion of clones analyzed that mapped to the miR159 cleavage position. [score:1]
The transgenic lines were designated Ubi::TamiR159, Ubi::TaGAMYB1 and Ubi::mTaGAMYB1, respectively, and the expression levels of miR159, TaGAMYB1 and endogenous OsGAMYB were measured (Figure 4). [score:1]
The complementary sequences between miR159 and GAMYB genes are shown in grey. [score:1]
A similar procedure was performed using TaGAMYB2, the results of which suggested that the miR159 acts to cleave the two TaGAMYB transcripts efficiently (Figure 2C). [score:1]
In tissues lacking the 35S::TamiR159 construct, basal levels of endogenous miR159 were hardly detected, while increased levels of miR159 were detected, indicating mature formation of miR159 in N. benthamiana leaves inoculated with the 35S::TamiR159 construct. [score:1]
We previously reported two ESTs containing the reverse complementary binding site for miR159 [31]. [score:1]
Collectively, we speculate that the underlying male sterility mechanism triggered by wheat miR159 is different from that of rice and Arabidopsis. [score:1]
MiR159 directs the cleavage of TaGAMYB and the cleavage site. [score:1]
Ubi::miR159 plants showed dramatic morphological changes, including a significantly (P<0.05) increased number of tillers (two times more than Zhonghua11) and delayed flowering (20 days delay) (Figure 5A, E). [score:1]
In Arabidopsis, seven GAMYB- like genes share a conserved putative miR159 binding site. [score:1]
MiR159-directed Cleavage of TaGAMYB1 and TaGAMYB2, Putative HvGAMYB Orthologs. [score:1]
In Ubi::TaGAMYB1 lines, TaGAMYB1 transcripts increased less than 2-fold due to the cleavage of endogenous rice miR159 (Figure 4B). [score:1]
The precursor of miR159 was also cloned into the Sma I /Sac I sites of pCAMBIASuper1300 (35S::TamiR159). [score:1]
Arabidopsis myb33myb65 double mutant seedlings grew slower and weaker after being exposed to 44°C for 4 hr, indicating that Arabidopsis myb33myb65 double mutants, similar to Ubi::miR159 transgenic rice, are heat sensitive (Figure 7A). [score:1]
Our observations indicated that TaGAMYB mRNAs were cleaved at the miR159 complementary site in wheat leaves. [score:1]
DNA oligonucleotides complementary to miR159 were end-labeled with γ-32P-ATP using T4 polynucleotide kinase (TaKaRa, Dalian, China). [score:1]
AtMYB33 is transcribed broadly in mAtMYB33 transgenic lines carrying an miR159-resistant binding site under the control of its endogenous promoter, indicating that miR159 restricts AtMYB33 in specific tissues in wild-type plants [22]. [score:1]
Several recent studies have indicated that the miR159- GAMYB pathway might also be involved in the abiotic stress response. [score:1]
To further investigate the role of TamiR159 and TaGAMYB1, transgenic rice lines overexpressing miR159, TaGAMYB1, and m TaGAMYB1 (impaired in the miR159 binding site) were generated. [score:1]
The results demonstrated that 5 out of 10 clones showed the predominant cleavage site in TaGAMYB1 at position 11 from the 5′ end of the miR159- TaGAMYB1 complementary region. [score:1]
To confirm TaGAMYB mRNA cleavage by miR159 in vivo, cleavage products were detected using a modified 5′-RACE procedure. [score:1]
We found reverse complementary binding sites for miR159 located between BOX2 and BOX3 domains in two TaGAMYB genes. [score:1]
[1 to 20 of 61 sentences]
3
[+] score: 120
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, osa-MIR444a, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1425, osa-MIR1428a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1874, osa-MIR2055, osa-MIR827, osa-MIR1428f, osa-MIR1428g, zma-MIR396d, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR827, osa-MIR395x, osa-MIR395y, zma-MIR444a, zma-MIR444b
Our results suggest a possible significance of co-regulation of TCP and/or MYB genes and GT2-like factors that are targeted by osa-miR159a. [score:4]
C) Expression of pre-osa-miR159a. [score:3]
Indeed the expression level of osa-miR159a. [score:3]
We confirmed cleavage of predicted targets at the miRNA complementary sites for osa-miR1425, osa-miR827a and osa-miR159a. [score:3]
Finally, the transient expression of the osa-miR159a. [score:3]
To this aim Nicotiana benthamiana leaves were transfected with a construct expressing a 446 nucleotide genomic sequence encompassing the stem-loop encoding both osa-miR159a. [score:3]
A control for expression of conserved osa-miR159a was also included. [score:3]
These observations, coupled to the observation that its predicted target is cleaved in vivo (Figure 9) strongly support our hypothesis that osa-miR159a. [score:3]
1. Interestingly, the second target predicted for osa-miR159a. [score:3]
Finally we show that the predicted mRNA target of osa-miR159a. [score:3]
C) Validation of targets for osa-miR159a. [score:3]
2 has the same pattern of expression as osa-miR159a. [score:3]
2 sequences from Oryza coartacta and Oryza ridleyi were directly identified by BLASTN using osa-MIR159 stem-loop sequence from Nipponbare cultivar against the BAC ends sequences from 12 Oryza available from OMAP project species. [score:2]
The osa-miR159a. [score:1]
Finally, as expected for miRNAs, osa-miR159a. [score:1]
To further support that osa-miR159a. [score:1]
2, osa-miR159a. [score:1]
1 stem-loop clearly indicated production of osa-miR159a. [score:1]
The structure of the putative maize pre-miR159-osa-miR159a. [score:1]
osa-miR159a. [score:1]
1. This gene produces a 1653 mRNA (AK100209), probably corresponding to the primary pri-miR159a. [score:1]
In contrast to frequent cases of small RNAs derived from the same precursor encoding the canonical miRNAs that are usually interpreted as slippage of imperfect DCL1 processing [7- 11], osa-miR159a. [score:1]
2 and osa-miR159a, indicated by bars. [score:1]
A) Alignment of Oryza sativa and Zea mays sequences flanking the conserved miR159a. [score:1]
We also detected cleavage of osa-miR159a. [score:1]
2 with 2 mismatches in maize located 21 nucleotides upstream from the predicted maize miR159 (Figure 8A). [score:1]
The third case corresponds to osa-miR159a. [score:1]
2-osa-miR159a. [score:1]
1 precursor to produce osa-miR159a. [score:1]
Because complete genomic sequences for these Oryza species are not available, we aligned by BLASTN the osa-miR159a. [score:1]
Osa-miR159a. [score:1]
Next we confirmed that the stem-loop region including osa-miR159a. [score:1]
2 is conserved in all Oryza species and in maize, being produced by processing of the osa-miR159a. [score:1]
This also supports the hypothesis that osa-miR159a. [score:1]
The position of osa-miR159a. [score:1]
2 produced from osa-miR159a. [score:1]
2. Northern blot analysis with a miR159a. [score:1]
1, osa-miR159a. [score:1]
Here we present potential primary precursors for osa-miR1425, osa-miR1428e, osa-miR2055 and osa-miR159a. [score:1]
1 in control leaves is probably due to cross-hybridisation of the probe with endogenous Nicotiana miR159 which is conserved in plants. [score:1]
Northern blot analysis reveals that osa-miR159a. [score:1]
Detection of osa-miR159a. [score:1]
A) Genomic organisation of the osa-miR159a. [score:1]
The maize orthologue sequence to miR159-osa-miR159a. [score:1]
2 sequence has perfect match only with the osa-miR159a. [score:1]
A) Alignment of genomic sequences corresponding to stem-loop osa-miR159a. [score:1]
Figure 8 osa-miR159a. [score:1]
Genomic fragments containing the pre-osa-miR159a. [score:1]
B) Comparison of osa-miR159a. [score:1]
The existence of a functional osa-miR159a. [score:1]
2 is 21 nucleotides from osa-miR159a. [score:1]
2 (Table 1), a novel miRNA derived from the same precursor encoding osa-miR159a. [score:1]
Altogether these results indicate that osa-miR159a. [score:1]
Altogether we identified six novel miRNA candidates in rice that we named osa-miR1425 to osa-miR159a. [score:1]
2* and miR159a. [score:1]
2 and miR159a. [score:1]
The diagonals reveal conserved sequences between maize and rice cDNAs corresponding to mir159a. [score:1]
In rice the conserved osa-miR159a. [score:1]
2, a novel miRNA produced from the same stem-loop structure encoding the conserved osa-miR159a. [score:1]
Cloning of osa-miR159a. [score:1]
2, produced from the same stem-loop structure encoding osa-miR159a. [score:1]
The results clearly show that, as for Oryza sativa, that has an AA genome, all have retained a perfect osa-miR159a. [score:1]
The other miRNAs, with the exception of osa-miR159a. [score:1]
2 from rice was identified by BLAST search of the NCBI maize EST collections (dbEST database) with a fragment of the osa-miR159a. [score:1]
2 sequence maps to a single locus in gene Os01g0506700 encoding the conserved osa-miR159a. [score:1]
2 is found in the stem-loop region encoding osa-miR159a. [score:1]
1. The osa-miR159a. [score:1]
2 sequence just upstream from the conserved osa-miR159a. [score:1]
Therefore, this is a very important result that strongly supports a functional role for osa-miR159a. [score:1]
1 and osa-miR159a. [score:1]
The maize sequence folds perfectly into a predicted stem-loop, similar to the rice osa-miR159a. [score:1]
We focus on one of them encoding osa-miR159a. [score:1]
Considering that this 24 nucleotide RNA is normally not detected in rice plants (Figure 1A) this could suggest that processing of the osa-miR159a. [score:1]
2 produced from the osa-miR159a. [score:1]
C) Stem-loop structure predicted for the Zea mays osa-miR159a. [score:1]
An additional signal of 24 nucleotides was also detected with this probe that was not detected using the osa-miR159a. [score:1]
The positive signal detected for osa-miR159a. [score:1]
2, which is produced from the same stem-loop encoding osa-miR159a. [score:1]
1 gene hairpin locus and can be distinguished from all other osa-miR159 genes by two or three nucleotide differences (not shown). [score:1]
Alignment shows that the osa-miR159a. [score:1]
These results indicate that rice osa-miR159a. [score:1]
Osa-miR1425, osa-miR2055, osa-miR827a and osa-miR159a. [score:1]
Detection of a miR159 signal in mock transfected leaves is due to endogenous miR159 from Nicotiana benthamiana. [score:1]
Figure 7 osa-miR159a. [score:1]
Although miRNA precursor sequences show high divergence except for miRNAs and miRNAs* regions, we found a predicted homolog for osa-miR159a. [score:1]
2-mir159a. [score:1]
2 has a functional importance for rice we searched for osa-miR159a. [score:1]
1 B) Stem-loop predicted structure encoding osa-miR159a. [score:1]
1. We show that this dual osa-miR159a. [score:1]
1 precursor is further strengthened by the perfect phylogenetic conservation of the osa-miR159a. [score:1]
1 could be processed to produce osa-miR159a. [score:1]
Figure 6 osa-miR159a. [score:1]
We looked for osa-miR159a. [score:1]
2-miR159a. [score:1]
[1 to 20 of 94 sentences]
4
[+] score: 59
RPA2C (LOC_Os06g47830 predicted by osa-miR167h-3p) and RPA2B (LOC_Os02g42230 predicted by osa-MIR159a-p5, which found to be up-regulated in male meiosis but down-regulated in female meiosis) encoded replication proteins, A2C and A2B, and showed interaction with LOC_Os06g11500, which further interacted with CYCA1;3. OsTKPR1 (LOC_Os09g32020 encoded ubiquitin fusion degradation protein), which was another target predicted by osa-MIR159a-p5, interacted with the mov34 family protein (LOC_Os05g46490 predicted by osa-miR1436_L +3_1ss5CT), Sel1 repeat domain containing protein (LOC_Os03g15350 predicted by osa-miR1436_L +3_1ss5CT) and DnaK family protein genes (LOC_Os12g14070, predicted by osa-miR3979-5p_R + 1, which showed up-regulation in male meiosis, and LOC_Os02g53420 and LOC_Os03g02260, predicted by osa-miR164e_R-3, which displayed down-regulation in female meiosis). [score:15]
Earlier studies have shown that overexpression of miR159 inhibited mRNA levels of MYB family transcription factors leading to male sterility in Arabidopsis [20], and impairing the anthers development in rice [54]. [score:6]
In addition, osa-MIR159a-p5, another member of osa-miR159, targets LOC_Os09g32020 (ubiquitin fusion degradation protein, OsTKPR1), which displayed significant up-regulation in MA of autotetraploid rice. [score:6]
The miR159, acts as the posttranscriptional factor, targeted the GAMYB-like genes (MYB33 and MYB65) and restricted the expression of these genes during anther development in Arabidopsis [20]. [score:6]
Highly-expressed osa-MIR159a-p5 in MA may partially repressed the expression of LOC_Os09g32020 and cause meiosis abnormalities in 02428-4x. [score:5]
The increased expression of osa-miR159 during pollen development was consistent with a previous study on pollen sterile line [17]. [score:4]
Two meiosis-related genes (i. e. LOC_Os02g48010 predicted by osa-MIR5083-p3 that encoded nuclear matrix constituent protein 1-like and LOC_Os02g42230 predicted by osa-MIR159a-p5 that encoded RPA2B - Putative single-stranded DNA binding complex subunit 2), and three meiosis specific genes that showed down-regulation in autotetraploid compared to the diploid rice during meiosis, including LOC_Os09g32020 (predicted by osa-MIR159a-p5), LOC_Os06g40550 (predicted by osa-miR5504_R-3), and LOC_Os04g21590 (predicted by osa-miR5504_R-3), which annotated as ubiquitin fusion degradation protein, ABC-2 type transporter domain containing protein and PB1 domain containing protein, respectively. [score:3]
Palatnik JF Wollmann H Schommer C Schwab R Boisbouvier J Rodriguez RSequence and expression differences underlie functional specialization of Arabidopsis microRNAs miR159 and miR319Dev. [score:3]
We supposed that overexpression of osa-miR159a. [score:3]
Some novel miRNAs have been reported to regulate the pollen and spikelet fertility, such as miR159, miR172, miR319 and miR397 [20– 23]. [score:2]
1 and osa-MIR159a-p5 were related with the male meiosis. [score:1]
Another important gene, LOC_Os01g59660 (OsGAMYB, predicted by osa-miR159a. [score:1]
Some important genes, such as LOC_Os07g36940 predicted by the osa-miR5836, and LOC_Os01g47530 predicted by the osa-miR159a. [score:1]
OsGAMYB encoded by LOC_Os01g59660 (predicted by osa-miR159a. [score:1]
Of these DEM, osa-miR1436_L + 3_1ss5CT and osa-miR167h-3p were associated with the female meiosis, while osa-miR159a. [score:1]
In our study, osa-miR159a. [score:1]
[1 to 20 of 16 sentences]
5
[+] score: 55
Accordingly, we did a phylogenetic analysis for all the miRNA -targeted peach MYB genes and found that of the four miR159 -targeted MYBs, one was in MYB subgroup 18 - anther and pollen development; another co -targeted by miR858 in subgroup 13 - lignin deposition, mucilage production and stomatal aperture [39], and the remaining two were ungrouped. [score:8]
While we were only able to detect miR828 expression during fruit development (Figure 2b), we cannot rule out the potential roles of miR858 and miR159 since they could be highly cell- or tissue-, or stage-specific during fruit development, and their expression window period might be missed in this study. [score:7]
Further analysis revealed that miR828 and miR858 target sites were separated by 12 nucleotides and co-located in the conserved region of the third exon while the miR159 target site was located in the divergent region of the co -targeted MYBs (Figure 5b). [score:7]
The finding that miR858 shares five MYB targets with miR828 and two with miR159, respectively, and three miR828 -targeted MYBs undergo siRNA biogenesis supports the notion of the evolution of a miRNA- and siRNA -mediated silencing reinforcement regulatory mechanism in peach. [score:6]
Therefore, we performed in silico target prediction and identified an additional three, nine and 24 MYB genes for miR159, miR828 and miR858, respectively, with an align score of less than 5. Thus, a total of 49 MYB target genes were found, four for miR159, 12 for miR828 and 40 for miR858. [score:5]
In addition, we found that miR159, miR828 and miR858 collectively target 49 MYBs, 19 of which are known to regulate phenylpropanoid metabolism, a key pathway involved in stone hardening and fruit color development. [score:5]
All the peach MYB targets for miR828, miR858, and miR159 were predicted by Targetfinder 1.6 with an align-score of no more than 5. Amino acid sequences of MYB factors in Arabidopsis were retrieved from TAIR (http://www. [score:5]
Still, the potential regulatory roles of miR858, miR159 and miR828 in lignin, cell wall and flavonoid metabolism and synthesis pathways provides evidence for a significant role of sRNA in coordinating fruit development. [score:3]
In peach, at least 49 MYBs can be potentially targeted by miR159, miR828 and miR858 (Figure 5a). [score:3]
MiR858 shared five targeted MYBs with miR828 and two with miR159 (Figure 5a). [score:3]
In Arabidopsis, miR159, miR828 and miR858 target at least 13 MYB genes [39]. [score:3]
[1 to 20 of 11 sentences]
6
[+] score: 38
The expression levels of osa-miR159 and its target, GAMYB transcription factor (LOC_Os01g59660), were confirmed by qPCR, which showed that these miRNAs and their targets were negatively correlated (Figure 5B). [score:7]
Moreover, in Arabidopsis, miR167 overexpression has been reported to lead to male fertility defects (Sire et al., 2009), whereas miR159a overexpression results in decreased expression of MYB33, leading to male sterility and flowering time delays in Arabidopsis (Achard et al., 2004). [score:7]
Moreover, the interactions of miRNA444, miRNA159 and miRNA164 with their corresponding target genes (PPR, GAMYB, and NAC) modulate the expression of developmental genes, GA/ABA-related genes, and auxin-responsive genes to promote the transmission of signals that enhance developmental processes and maintain energy supply. [score:7]
In rice, mutations in OsGAMYB have resulted in defects in anther and pollen development, and overexpression of osa-miR159 leads to male sterility (Kaneko et al., 2004; Tsuji et al., 2006). [score:5]
Therefore, it is highly likely that osa-miR159 silenced the expression of MYB proteins, which affect anther development in WXS (S). [score:4]
In this study, three members of osa-miR159 (osa-miR159c/d/e) were found to be up-regulated in WXS (S) (SP2 and SP3). [score:4]
The conserved targets of miR159 are MYB transcription factors, which have been reported to be involved in flower development and are essential for fertility (Jones et al., 2006; Tsuji et al., 2006). [score:4]
[1 to 20 of 7 sentences]
7
[+] score: 36
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-124-1, hsa-mir-124-2, mmu-mir-34a, osa-MIR169a, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, cel-mir-354, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, mtr-MIR169a, mtr-MIR319a, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR168a, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, hsa-mir-519b, ppt-MIR319a, ppt-MIR319b, ppt-MIR319c, ppt-MIR319d, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR169f, mtr-MIR319b, mtr-MIR168a, mtr-MIR169g, mtr-MIR169h, mtr-MIR169b, ppt-MIR319e, osa-MIR169r, mtr-MIR159a, mtr-MIR169k, mtr-MIR169j, mtr-MIR159b, ptc-MIR169ag, mtr-MIR169i, mtr-MIR319c, mtr-MIR319d, mtr-MIR169l
With an alignment-score cutoff of 4.5 and a P-value threshold of 0.2, we found small RNA cleavage products of seven mRNA genes targeted by six miRNA-like RNAs that we identified (miR159a. [score:3]
We also examined the target conservation of the miRNA-like RNAs on miR159a and miR319b precursors across Arabidopsis, a dicotyledonous plant, and rice, a monocotyledonous plant. [score:3]
miR159 and miR319 belong to the same MIR family based on their evolutionary origin [30, 44], playing important roles in plant development [47]. [score:2]
3 and miR159a. [score:1]
Importantly, a close inspection showed that many individual miRNA-like RNAs on the miR159 and miR319 precursors are also highly conserved at the sequence level. [score:1]
miRNA-like RNAs appeared in miR319 precursors in all of these five plants, and miRNA-like RNAs occurred in miR159 precursors in all of five bar moss. [score:1]
3 TAAAAAAGGATTTGGTTATA 6 miR159a. [score:1]
For example, the three miRNA-like RNAs on the miR159a precursor that passed our selection criteria are labeled as miR159a. [score:1]
This is consistent with the recent discovery that the DCL cleavage that produces mature miR159 and miR319 starts from the loop ends of their fold-back structures [45, 46]. [score:1]
2-5p is paired with miR159a. [score:1]
2, miR159a. [score:1]
Furthermore, four of these six miRNA-like RNAs (miR159a. [score:1]
Some of these miRNA-like RNAs from conserved miRNA families, that is, miR159 and miR319 in plants, are conserved at the sequence level (Figure 7), which adds another layer of evidence that these miRNA-like RNAs are potentially functionally important in plants. [score:1]
Examples include MIR159a, MIR319a and MIR319b in Figures 1a,c,d, respectively. [score:1]
Figures 1, 2, 3, and 4 show this type of phasing pattern on the precursors of miR159a, miR169 m, miR319a/b, miR447, miR822 and miR839. [score:1]
1/miR159a. [score:1]
1* GAGCTCCTTAAAGTTCAAACA 9 miR159a. [score:1]
2-5p AGCTGCTAAGCTATGGATCCC 36 2,7 miR159a. [score:1]
Following miRNA nomenclature [17, 18], we name these miRNA-like RNAs miR n. k, where integer n specifies a particular miRNA family and precursor (for example, 159a for miR159a) and integer k denotes a specific miRNA or miRNA-like RNA. [score:1]
Note that miRNA-miRNA* duplexes for miRNA-like RNAs, with approximately two-nucleotide 3'-end overhangs, appear on the miR159, miR169m and miR319b precursors. [score:1]
Both ath-miR159a. [score:1]
In the five plant species we studied, miRNA-like RNAs appeared in two well-conserved miRNA families, that is, miR159 and miR319 (Table 2). [score:1]
1* (that is, miR159a/miR159a*) in four plants, A. thaliana (ath), O. sativa (osa), P. patens (ppt) and M. truncatula (mtr). [score:1]
2-3p and miR159a. [score:1]
2-5p/miR159a. [score:1]
2-3p and osa-miR159a. [score:1]
2-3p ATTGCATATCTCAGGAGCTTT 9 1,2,7 At5g24620 miR159a. [score:1]
Figure 6a displays the miR159a precursors in Arabidopsis, rice, Medicago and Populus and Figure 6b shows the miR319b precursors in Arabidopsis, rice, moss and Medicago. [score:1]
2-5p, miR159a. [score:1]
2-5p, and miR159a. [score:1]
For example, miR159a. [score:1]
[1 to 20 of 31 sentences]
8
[+] score: 34
Therefore, down-regulation of miR159 might induce ABA signaling under drought stress and drought signaling conditions, but conversely, its up-regulation in the presence of wet signaling might reduce ABA signaling. [score:7]
According to our results, down-regulation of miR159a/b could increase MYB expression followed by growth reduction under conditions of drought and drought signaling. [score:6]
Likewise, miR159a/b are down-regulated miRNAs involved in the regulation of cell death. [score:5]
It should be noted that some of the miRNAs that contribute to ABA signaling, including miR159, miR160 and miR167 [6], showed similar expression patterns under drought stress and drought signaling conditions, which could be due to the presence of the same phytohormone signal in both conditions. [score:3]
Since an increase of MYB has a negative role in growth regulation and leads to growth reduction, the role of miR159 in regulating MYB categorizes this miRNA as one of the important miRNAs involved in growth [81]. [score:3]
The results of qRT-PCR indicated that the expression pattern of these miRNAs were similar to the deep sequencing results like miR156l, miR159a,b (for WD and SpWD), miR169a, miR396d-f, miR529b, miR535 and miR3979. [score:3]
We observed several miRNAs with prominent roles, such as miR160, mir159, miR528 and miR172, which can regulate important transcription factors and genes under different conditions (Fig 5). [score:2]
Among them regulation of ARF (miR160 and miR167), MYB (miR159), AP2 (miR172), HD-Zip III (miR166) and NAC (miR164) were confirmed experimentally [38, 39, 40, 41, 42]. [score:2]
MYB and DWD are regulated by miR159a/b and miR1876, respectively. [score:2]
MiR159a/b is one of these miRNAs and it has been shown to be involved in ABA signaling [6]. [score:1]
[1 to 20 of 10 sentences]
9
[+] score: 32
Of the 21 common targets, most were conserved transcription factors for ancient miRNAs, including SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPLs) protein coding genes targeted by miR156/miR529, ARFs targeted by miR160, TCPs targeted by miR319, and MYBs targeted by miR159. [score:11]
In Arabidopsis seeds, exogenous ABA results in the accumulation of miR159 that participates in the regulation of seed germination by targeting MYB33 and MYB101, two positive regulators of ABA response [53]. [score:5]
The expression level of miR159 is found to be very low in the embryo of non-dormant maize seeds [55]. [score:3]
It is of interest to reveal the distinctive expression patterns of osa-miR159 and the role of osa-miR159 mediated crosstalk between ABA and GA in the embryo of germinating rice seed in future studies. [score:3]
In rice, expression of miR159 was detected in various organs except in seeds. [score:3]
Unexpectedly, in this study, we identified abundant miR159, especially miR159f, in the embryos of germinating rice seeds. [score:1]
ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. [score:1]
RT-PCR results showed that both miR159 and GAMYBs were insensitive to ABA and GA in rice embryos. [score:1]
RNA ligase -mediated 5ʹ-RACE indicated that OsGAMYBL1 and OsGAMYB produced PCR products with canonical cleavage sites of miR159 (Fig 7B). [score:1]
In particular, miR319, miR168, miR156, miR166, and miR159 were mapped with more than 10,000 reads (S1 Fig). [score:1]
RACE analysis verified that OsGAMYBL1 and OsGAMYB were both cleaved by miR159 at the canonical positions. [score:1]
Thus, the plentiful miR159 in rice embryo cannot be induced by ABA as it is in Arabidopsis. [score:1]
[1 to 20 of 12 sentences]
10
[+] score: 29
Real-time RT-PCR experiments showed reduced accumulations of the predicted target mRNAs for these phased miRNAs (i. e., miR159.2 families, miR159.3 and miR394.2), indicating that the induced phased miRNAs have regulatory functions. [score:4]
Os12g03530 and Os02g47000, the predicted targets of miR159a. [score:3]
The target of miR159a. [score:3]
Os03g02240 was previously validated as a target of miR159.2. [score:3]
Os12g03530 and Os02g4700 are predicted targets of miR159a. [score:3]
Northern blots confirmed the expression of miR159.2/miR159.2*, miR159.3 and miR394.2 (Figure 3F). [score:3]
The resolution of northern blots did not permit distinction between family members, so that each band could contain multiple members of a family of miRNAs/miRNA*s. Using clustalW [60], we analyzed the conservation of precursor sequences of miR159, miR319, and miR394 in different plants (Figure S3). [score:1]
These included miR159a. [score:1]
Some of these belong to the miR159 family, whose precursors are approximately 200 nt in length with a stem structure of 80–90 nt (Figure 3). [score:1]
1*, miR159a. [score:1]
These include miRNA*s for some members of the miR160 family (miR160a–f), miR166 family (miR166a–e, g–l and n), miR167 family (miR167a, c–e, h and i), miR171 family (miR171c–f and miR171i), miR396 family (miR396a–c, e and f) and miRNA* of miR1318, miR1425, miR159a, miR168, miR172d, miR390, miR444b. [score:1]
1/miR159a. [score:1]
The resolution of northern blots did not permit distinction between family members, so that each band could contain multiple members of a family of miRNAs/miRNA*s. Using clustalW [60], we analyzed the conservation of precursor sequences of miR159, miR319, and miR394 in different plants (Figure S3). [score:1]
As shown in Figure 3A–D (see also Supplemental Table S3 for all sequence data), besides the reported miRNA/miRNA* pair for each precursor of the family (i. e., miR159a. [score:1]
3/miR159a. [score:1]
2/miR159a. [score:1]
[1 to 20 of 16 sentences]
11
[+] score: 27
Most of the targets, such as the F-box protein and zinc finger CCCH domain proteins, G3BP and F-box family protein member, homeobox-leucine zipper protein and scarecrow transcription factor protein, were downregulated in response to the NaCl application (Fig.   7) in agreement of the NaCl -induced upregulation of the miRNAs sma-miR159a, sma-miR157a, sma-miR166a and sma-miR171b targeting them, respectively (Fig.   3). [score:11]
The only target of common function in S. maritima and the mangrove plants was an F-box protein targeted by sma-miR159a. [score:5]
However, most of the miRNAs, such as sma-miR159a, sma-miR171b and sma-miR169a, were upregulated in the Northern blot analyses in response to the NaCl treatment (Fig.   3), which is similar to the results of the abundance analysis (Fig.   2) except for that of the miRNA sma-miR396b, which did not present changes in its levels. [score:4]
The homologous miRNAs of sma-miR165a*, sma-miR165a**, sma-miR166e [+], sma-miR166e [++], sma-miR159a [#] and sma-miR159a [##] are ath-miR165a, aly-miR165a, bdi-miR166e, osa-miR166e, pta-miR159a and ath-miR159a respectively The expression of several conserved miRNAs in S. maritima, particularly those showing high abundance in the deep sequencing results, was confirmed by identifying precursors capable of forming hairpins (Additional file 5) in the ESTs of the species (available at Bionivid, Bangalore) and by Northern blot hybridization (Fig.   3). [score:3]
A paired t-test revealed the significant influence of NaCl on the expression of all of the miRNAs assessed by the TaqMan assay except for sma-miR159a (Fig.   5). [score:2]
The maximum miRNA representation at up to 21 was observed in the miR166 family, and it was followed by 12 miRNAs in the miR396 family, 11 miRNAs each in the miR159 and miR319 miRNA families, and ten miRNAs in the miR156/157 family. [score:1]
The reverse was true for other miRNAs, such as miR156a, miR159a, miR159c, miR168a, miR169a, miR169b, miR171b, miR172c, miR319a and miR398a (Fig.   2a, b) [58]. [score:1]
[1 to 20 of 7 sentences]
12
[+] score: 21
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, ath-MIR167d, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR396a, ath-MIR396b, ath-MIR398a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR437, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR531a, osa-MIR1425, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR531b, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1873, osa-MIR1862d, osa-MIR1862e, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR1862f, osa-MIR1862g, ath-MIR5021, osa-MIR5072, osa-MIR5077, ath-MIR156i, ath-MIR156j, osa-MIR531c
In tomato, miR159 regulates leaf and flower development by targeting the SGN-U567133 [58]. [score:5]
miR159 family members were reported to regulate ABA stress response and seed germination in plants by regulating the level of MYB transcription factor in A. thaliana [56, 57]. [score:3]
As the sample was collected during the active plant growth period, high abundance of miR159 suggests its active regulation of leaf and root development. [score:3]
Out of all, on the basis of bioinformatic analysis maximum expression was observed for miR159 family i. e. 315,441 reads followed by miR166 and miR167 family with 56,445 and 25,592 reads respectively and 17 miRNA families were reported to have less than 10 reads. [score:3]
On the basis of data analysis, it can be predicted that miR159 and miR166 have maximum expression in leaf during the period of its active growth. [score:3]
5, miR894.6, miR9662a-3p, miR159.12, miR172c, miR167g-5p, miR167g. [score:1]
miR166 family with 56 member followed by miR159 (52 members) family were found to have maximum number of members in the library, although 14 miRNA families such as miR393, miR444, miR473, miR531, miR1425, miR1862, miR1873, miR3623, miR3634, miR5072, miR5077, miR7486, miR9662, and miR9674 were found to have only one member. [score:1]
miR159 represents one of the most ancient miRNAs in the plant kingdom [52]. [score:1]
3, miR528.7, miR159.10, miR319e. [score:1]
[1 to 20 of 9 sentences]
13
[+] score: 19
Another interesting finding is that different from rice, in which miR159 and miR319 regulate distinct sets of target genes separately (MYB and TCP genes, respectively), miR159 and miR319 in Arabidopsis share an overlapping set of targets. [score:6]
Based on the TAIR annotations, five mimic genes, AT1G55860 regulating ath-miR159a, AT2G29070 regulating ath-miR172, AT1G77870 modulating ath-miR775, and AT4G02950 and AT4G03360 modulating ath-miR862-3p, were implicated in post-translational protein modification through a ubiquitin-related pathway (Figure 3A and Additional file 3: Table S3). [score:5]
Previous study indicates that although the sequences of miR159 and miR319 show high identity with each other, these two miRNA species possess specialized functions by regulating distinct sets of targets, i. e. MYB and TCP genes, separately [32]. [score:4]
Ath-miR159/319-, ath-miR164-, and ath-miR395-involved subnetworks. [score:1]
Figure 6 osa-miR159-, osa-miR319-, osa-miR164-, and osa-miR395-involved subnetworks. [score:1]
In Arabidopsis, a largely conserved subnetwork involving miR159/319, miR164 and miR395 was also extracted from the comprehensive network (Additional file 12: Figure S8). [score:1]
Another novel finding was exploited from the miR159/319-, miR164- and miR395-involved subnetwork in rice (Figure 6). [score:1]
[1 to 20 of 7 sentences]
14
[+] score: 18
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR164f, osa-MIR390, osa-MIR439a, osa-MIR439b, osa-MIR439c, osa-MIR439d, osa-MIR439e, osa-MIR439f, osa-MIR439g, osa-MIR439h, osa-MIR439i, osa-MIR396e, osa-MIR444a, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR171a, tae-MIR399, tae-MIR408, tae-MIR444a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, tae-MIR156, tae-MIR319, tae-MIR167b, tae-MIR169, tae-MIR444b, tae-MIR171b, tae-MIR396, tae-MIR167c, tae-MIR397
MiR159 was found to be strongly expressed in all tissues examined except in spikes, in which the expression levels were low. [score:4]
In contrast, rice miRNA159 is highly expressed in floral organs [52]. [score:3]
The expression patterns of miR156, miR159, miR164, and miR171, which are conserved miRNAs, were examined by (Figure 5). [score:3]
Twelve conserved miRNA families (miR156/157, miR159/319, miR160, miR164, miR165/166, miR167, miR169, miR170/171, miR172 and miR444) have been predicted to target 24 transcription factors, including squamosa promoter binding proteins, MYB, NAC1, homeodomain-leucine zipper protein, auxin response factor, CCAAT -binding protein, scarecrow-like protein, APETELA2 protein and MADS box protein (Additional data file 2). [score:3]
This analysis revealed perfect matching of nine miRNA families, miR159, miR160, miR164, miR167, miR169, miR170, miR399, miR408 and miR444, to 14 ESTs. [score:1]
Furthermore, our analysis revealed that the library included all known members of several miRNA families: miR156, miR159, miR167, miR169, miR168, miR171 and miR172. [score:1]
Many miRNA families are evolutionarily conserved across all major lineages of plants, including mosses, gymnosperms, monocots and dicots; for example, AthmiR166, miR159 and miR390 are conserved in all lineages of land plants, including bryophytes, lycopods, ferns and monocots and dicots [26- 28]. [score:1]
These include miRNA156/157, miR159, miR160, miR164, miR165/166, miR167, miR168, miR169, miR170/171, miR172, miR319, miR390, miR393, miR396, miR397, miR399 and miR408, which are conserved in diverse plant species (Table 2). [score:1]
MiR169 was represented by five members, miR156, miR165/166, miR167, miR170/171 and miR172 were represented by three members each, and miR159, miR319 and miR168 were represented by two members each in the library. [score:1]
[1 to 20 of 9 sentences]
15
[+] score: 17
Other miRNAs from this paper: ath-MIR159a, ath-MIR162a, ath-MIR162b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR162a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR390a, ath-MIR390b, ath-MIR396a, ath-MIR396b, ath-MIR398a, ath-MIR398b, ath-MIR398c, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR159c, ath-MIR319c, osa-MIR156k, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR390, osa-MIR396e, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR162a, ptc-MIR162b, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR398b, ptc-MIR398c, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR408, ptc-MIR482a, ptc-MIR171k, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1448, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR169ag, ptc-MIR482b, ptc-MIR482c, pde-MIR159, pde-MIR162, pde-MIR166a, pde-MIR166b, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR482a, pde-MIR482b, pde-MIR482c, pde-MIR482d, pde-MIR946, pde-MIR947, pde-MIR949a, pde-MIR950, pde-MIR951, pde-MIR952a, pde-MIR952b, pde-MIR952c, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR3701, pde-MIR3704a, pde-MIR3704b, pde-MIR3712
In order to obtain solid evidence to support the existence and expression of conserved miRNAs in P. densata, we examined the expression profiles of 10 mature miRNAs (pde-miR159a, pde-miR166a, pde-miR171a, pde-miR390a, pde-miR396a, pde-miR946, pde-miR950, pde-miR1311, pde-miR1313 and pde-miR1314b) in needles and stems of two-month-old seedlings, using real-time RT-PCR (Figure 4). [score:5]
The expression levels of 7 miRNAs, including pde-miR159a, pde-miR166a, pde-miR390a, pde-miR946, pde-miR1311, pde-miR1313 and pde-miR1314b, were more than 2-fold higher in needles than in stems, Intriguingly, miR166a, an important miRNA known for the functions in establishment of adaxial/abaxial (dorsoventral) leaf polarity, was expressed more than 9 times higher in needles than in stems [40]. [score:5]
In our study, pde-miR159 and pde-miR166a were found highly expressed in P. densata needles. [score:3]
It includes pde-miR159a, pde-miR169a, pde-miR396a, pde-miR482c, pde-miR482d, pde-miR949a, pde-miR950a, pde-miR952a, pde-miR952b, pde-miR952c, pde-miR1313, pde-miR1314a, pde-miR1448, pde-miR2118a, pde-miR2118b, pde-miR3701, pde-miR3704a, pde-miR3704b and pde-miR3712 (Table 1), of which 17 miRNAs were further validated by subcloning and sequencing except pde-miR396a and pde-miR482c. [score:1]
For example, the pde-MIR482 family has 4 members, whereas only one exists in 19 miRNA families (pde-MIR159, pde-MIR162, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR783, pde-MIR946, pde-MIR947, pde-MIR950, pde-MIR951, pde-MIR1310, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR1448, pde-MIR3701 and pde-MIR3712). [score:1]
The accumulation of miR159 was observed to increase with the days post inoculation (dpi) of tomato leaf curl New Delhi virus (ToLCNDV) agroinfection in tomato cv Pusa Ruby [49]. [score:1]
It includes pde-MIR159, pde-MIR162, pde-MIR166, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396 and pde-MIR399. [score:1]
[1 to 20 of 7 sentences]
16
[+] score: 16
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
Interestingly, some target transcripts were regulated by pairs of miRNAs: both miR156 and miR529 targeted five members of the same SBP family, and the miR159/319 pair regulated three MYB domain transcription factors. [score:7]
Although most miRNA families appear to target a single class of targets, the miR159/319 family regulates both MYB and TCP transcription factors, which may control petal morphogenesis as previously reported [59]. [score:6]
The six most abundantly expressed miRNA families were miR166, miR168, miR167, miR156, miR159, and miRs6. [score:3]
[1 to 20 of 3 sentences]
17
[+] score: 16
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1435, osa-MIR1849, osa-MIR1850, osa-MIR1856, osa-MIR1860, osa-MIR1861e, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1870, osa-MIR1874, osa-MIR1862d, osa-MIR1862e, osa-MIR2055, osa-MIR827, osa-MIR2098, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1862f, osa-MIR1862g
Several, such as miR156, miR159, miR164, miR166, miR167 and miR396, were expressed at high levels, indicating that, as they are highly expressed in other tissues such as leaf and root, these conserved miRNAs are possibly important regulators for rice plant development. [score:7]
Some miRNA genes, such as miR159 and miR399, displayed continually high expression levels throughout grain filling. [score:3]
The expression of miR1862 and miR1874 increased from G1 to G2, but remained largely unchanged from G2 to G3, whereas miR159, miR164 and miR1850 underwent rapid increases from G2 to G3. [score:3]
For example, miR159 regulates a MYB gene, which is considered a positive regulator of the GA response during grain maturation [36]. [score:2]
For example, the abundance of the miR159 family varied from 9 (miR159c) to 7,113 (miR159a. [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 15
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
In Arabidopsis, miR156, miR158, miR159, miR165, miR167, miR168, miR169, miR171, miR319, miR393, miR394, miR396, and miR397 are up-regulated by salt stress while the expression of miR398 is down-regulated (Liu et al., 2008). [score:9]
The expression of miR156, miR159, miR160, miR166, miR168, miR169, miR393, and miR827 is increased, while miR172 is significantly repressed under heat stress in wheat (Xin et al., 2010). [score:3]
A great number of miRNAs, for example, miR396, miR168, miR167, miR165, miR319, miR159, miR394, miR156, miR393, miR171, miR158, and miR169 have been identified to be regulated by drought in Arabidopsis (Liu et al., 2008). [score:2]
In rice, 14 miRNAs (miR159, miR169, miR171, miR319, miR395, miR474, miR845, miR851, miR854, miR896, miR901, miR903, miR1026, and miR1125) are significantly induced while 16 miRNAs are significantly repressed by drought (Zhao et al., 2007; Zhou et al., 2010). [score:1]
[1 to 20 of 4 sentences]
19
[+] score: 15
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1427, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR5485, osa-MIR5486, osa-MIR5487, osa-MIR5488, osa-MIR5492, osa-MIR5497, osa-MIR5509, osa-MIR2275c, osa-MIR5517, osa-MIR2275d, osa-MIR5528, osa-MIR5791, osa-MIR5792, osa-MIR5793, osa-MIR5796, osa-MIR5797, osa-MIR5800, osa-MIR5806, osa-MIR5818, osa-MIR5179
However, our results show that a majority of the conserved miRNAs are expressed at lower levels in rice inflorescence than in leaf and stem tissues as indicated by their lower normalized TPM values in Fig 2. For example, osa-miR159, osa-miR397 and osa-miR408, which were classified under the moderately expressed group in the vegetative tissues, are instead classified under lowly expressed group in the inflorescence tissue. [score:7]
Note: osa-miR167 is moderately expressed while osa-miR159, osa-miR397, osa-miR408 and osa-miR827 are lowly expressed in rice inflorescence. [score:5]
For conserved miRNA families, 7 out of 9 of the miRNA families show differential expression in the IR87705-7-15-B except mature miRNAs from osa-MIR159 and osa-MIR399 which were specifically induced in the IR77298-14-1-2-10. [score:3]
[1 to 20 of 3 sentences]
20
[+] score: 15
In addition, many other targets, such as WRKY transcription factor 54, Vacuolar-sorting receptor 6, subtilisin, myb and scarecrow-like protein, targeted by osa-miR1851, PC-3p-35500_181, osa-miR5809, osa-miR319, osa-miR159 and osa-miR171, were reported to be involved in senescence [59]- [62] and were identified in the present study (Table 3, Table S5). [score:5]
In the leaves at early, middle and late stages of grain-filling, the expression of osa-miR159b, osa-miR159a. [score:3]
In the present study, several members of zinc finger transcription factor, targeted by osa-miR1848, osa-miR159b, osa-miR159a. [score:3]
MiR159 has been indicated to determine leaf structure by targeting MYB in ToLCNDV infected tomato plants [38]. [score:2]
In conclusion, we found six miRNA families, osa-miR159, osa-miR160, osa-miR164, osa-miR167, osa-miR172 and osa-miR1848, were involved in the leaf senescence through phytohormone signaling pathway in rice. [score:1]
This may be one of the mechanisms of osa-miR159, osa-miR167 and osa-miR172 mediated senescence-resistance through ABA -dependent pathway. [score:1]
[1 to 20 of 6 sentences]
21
[+] score: 15
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR528, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR821a, osa-MIR821b, osa-MIR821c, osa-MIR1432, osa-MIR169r, osa-MIR1846d, osa-MIR1846a, osa-MIR1846b, osa-MIR1876, osa-MIR1846c, osa-MIR1846e, osa-MIR395x, osa-MIR395y
Expression levels are given on a logarithmic scale expressed as 40- ΔC [T], where ΔC [T] is the difference in qRT-PCR threshold cycle number of the respective miRNA and the reference miRNA159; therefore, 40 equals the expression level of miR159 (the number 40 was chosen because the PCR run stops after 40 cycles). [score:7]
0050261.g004 Figure 4The expression levels of miRNAs were normalized to the level of miR159 (doesn’t vary significantly between two genotype at jugged condition). [score:3]
The expression levels of miRNAs were normalized to the level of miR159 (doesn’t vary significantly between two genotype at jugged condition). [score:3]
MiR159 was used as internal control for miRNA (since among the other analysed miRNAs the Ct change between root and leaves of the both the genotypes ≤0.5) and actin gene was as internal control used for mRNA. [score:1]
ΔΔC [T] = (ΔC [T –VIVEKDHAN-](Δ C [T- IC-547557] ) & ΔC [T] = C [TmiR] -C [T]miR159. [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 13
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166d, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR396e, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818b, osa-MIR169r, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
Similarly, some members of the miR156, miR159, miR167 and miR169 families (pre-miR156b/i, pre-miR159b/f, pre-miR166a/b/c, pre-miR167b/g, pre-miR169f/p) were up-regulated while others (pre-miR156d/f/g/j, pre-miR159a, pre-miR166d, pre-miR167d/e, pre-miR169a/b/h/l/m/q) were down-regulated by drought stress. [score:7]
Several miRNAs have been reported to regulate drought-responsive genes [10, 15, 16], and it has been shown that rice miR159, miR169, miR395 and miR474 are drought-inducible, while the expression of miR156, miR168, miR170, miR172, miR396, miR397 and miR408 is suppressed by drought [13, 16]. [score:6]
[1 to 20 of 2 sentences]
23
[+] score: 13
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169f, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319b, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169f, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, osa-MIR529a, tae-MIR159a, tae-MIR159b, tae-MIR171a, tae-MIR1120a, osa-MIR1430, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR166n, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR397a, zma-MIR397b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, hvu-MIR168, hvu-MIR171, hvu-MIR397a, tae-MIR171b, hvu-MIR1120, hvu-MIR166b, osa-MIR3981, hvu-MIR166c, tae-MIR1120b, tae-MIR397, tae-MIR1120c, hvu-MIR397b, hvu-MIR156b
Our observations show that the level of mature miR159 fluctuates in various developmental stages with the lowest expression level detected in 1-week-old plants, which is in agreement with the real-time PCR results for pri-miR159b (Figure 2D, upper graph). [score:4]
We observed high expression levels of mature miR159 using Northern hybridization, however, we failed to detect pre-miR159b, which was most likely a result of rapid processing of the pre-miRNA (Figure 2E). [score:3]
It has to be noted that Northern analysis shows the expression of all putative mature miR159 family members. [score:3]
Our studies, together with recent results of Lv et al. and miRBase, reveal that the miR159 family in barley consists of at least four members. [score:1]
In Arabidopsis, three members of the miR159 family were annotated - miR159a, b and c [3, 55] - while for monocotyledonous species such as rice and maize, eight and fourteen members of the miR159 family have been described, respectively [4, 43, 56, 57]. [score:1]
Lv et al. [49] described three barley miR159 species with different nucleotide sequences. [score:1]
[1 to 20 of 6 sentences]
24
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR440, osa-MIR396e, osa-MIR528, osa-MIR529a, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR1428a, osa-MIR169r, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1866, osa-MIR1862d, osa-MIR1862e, osa-MIR1877, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR2275a, osa-MIR2275b, osa-MIR2871a, osa-MIR2871b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1862f, osa-MIR1862g, osa-MIR2863c, osa-MIR5159, osa-MIR5337a, osa-MIR5485, osa-MIR2275c, osa-MIR2275d, osa-MIR5337b
For example, a genome-wide study conducted across different developmental stages of rice revealed that 16 miRNAs, including miR156, miR159 and miR168, were downregulated by drought stress, while 14 miRNAs, such as miR169, miR319 and miR395, were upregulated [42]. [score:8]
For example, miR167, miR393, miR396, miR529 have been shown to be regulated by drought stress [25, 42, 59], miR393 and miR396 were shown to be regulated by cold stress [25, 42, 59], and miR159, miR160, miR319, miR394, miR528, and miR530 were shown to be regulated by salt stress [25, 29, 59- 61]. [score:4]
[1 to 20 of 2 sentences]
25
[+] score: 12
A total of 223 miRNAs were co-expressed in diploid and autotetraploid rice, some of them, such as miR159, miR166, miR396, miR2118 and miR2275 were highly expressed in both types of rice, indicating their conserved and essential roles in pollen development. [score:6]
The miR159 regulated the GAMYB-like targets (MYB33 and MYB65) during Arabidopsis anther development [45]. [score:5]
osa-miR159a. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 11
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR394a, ath-MIR394b, ath-MIR396a, ath-MIR396b, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, ath-MIR403, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR396e, ath-MIR856, ath-MIR858a, osa-MIR169r, osa-MIR396f, ath-MIR2111a, ath-MIR2111b, osa-MIR396g, osa-MIR396h, osa-MIR396d, ath-MIR858b, ath-MIR156i, ath-MIR156j
Further mir159 and mir394 with highest abundance in stevia were among the moderately expressed miRNAs in Arachis hypogea[29] and among the lowly expressed miRNAs in C. trifoliate[30]. [score:5]
Among the 34 miRNA families, miR159 proved to be largest one with highest number of sequences. [score:1]
For example, the abundance of miR159 family varied from 6 reads to 11,759 reads in the deep sequencing. [score:1]
Most of the miRNA families were found to be conserved in a variety of plant species e. g. using a comparative genomics based strategy homologs of miR319, miR156/157, miR169, miR165/166, miR394 and miR159 were found in 51,45,41,40,40 and 30 diverse plant species respectively [38]. [score:1]
miR156, miR159, miR167, miR319, miR396 and miR172 possessed 5, 8, 10, 8, 7 and 6 members respectively whereas other miRNA families such as miR157, miR160, miR169, miR858, miR894, miR2111 etc. [score:1]
For e. g. - as miR159a showed 11,759 sequenced clones i. e. more than 10,000 times. [score:1]
Among the 34 miRNA families mir159 showed the largest number of sequenced clones which are in agreement as miR159 is also the most abundant family in Arabidopsis[16]. [score:1]
[1 to 20 of 7 sentences]
27
[+] score: 11
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR396f, osa-MIR395x, osa-MIR395y, osa-MIR3980a, osa-MIR3980b, osa-MIR5794
For example, many miRNAs, such as miR156, miR159, miR160, and miR166, were up-regulated by heat stress in wheat (Xin et al., 2010), whereas these miRNAs were down-regulated in our study. [score:7]
In contrast, the expression of miR159a. [score:3]
The eight miRNAs (miR159a. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 11
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR166c, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160f, osa-MIR164d, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR419, osa-MIR390, osa-MIR444a, osa-MIR528, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR529b, osa-MIR1425, osa-MIR1429, osa-MIR1431, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR1441, osa-MIR531b, osa-MIR1846d, osa-MIR1848, osa-MIR1850, osa-MIR1853, osa-MIR1860, osa-MIR812f, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1319a, osa-MIR2096, osa-MIR2864, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3979, osa-MIR812n, osa-MIR812o, osa-MIR5161, osa-MIR5338, osa-MIR5512a, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1319b, osa-MIR5512b, osa-MIR818f
MiR159 degrades its target MYB33 in the process of gibberellin -induced flowering in Arabidopsis, resulting in non -expression of LFY, delayed flowering in short days and male sterility [19]– [21]. [score:4]
1, which is expressed at a higher level than miR159a. [score:3]
However, over -expression of miR319, a sequence highly similar to miR159, decreases the levels of TCP transcription factors, then delays flowering in long days, stamen morphogenesis, and causes abortive stamens [22]. [score:3]
For example, pre-miR159a generated two different mature miRNAs sequences, miR159a. [score:1]
[1 to 20 of 4 sentences]
29
[+] score: 10
In stem-loop qRT-PCR, the levels of miRNA were normalized by mature miR159 expression level. [score:3]
Expression values are relative to O. glaberrima stage 4 and the ACTIN gene or miR159 miRNA used as reference is indicated. [score:3]
Interestingly, the miR159/319 families contributed to 64 % of mature miRNA expressed in young panicles of both African species (Additional file 6), in contrast to previous studies of panicle-derived miRNAs in O. sativa (Jeong et al. 2011; Peng et al. 2011). [score:3]
miR159a probe was used as a loading control. [score:1]
[1 to 20 of 4 sentences]
30
[+] score: 10
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR1520h, gma-MIR1520i, gma-MIR1520j, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR4406, gma-MIR169d, gma-MIR1520q, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR167k, gma-MIR167l, gma-MIR169w
MYB family members in rice, which are targeted by miR159, appear to play an important role in response to the presence of abscisic acid (ABA) during plant embryonic development, suggesting their roles in seed development [37, 38]. [score:5]
In this study, we detected a number of MYB family transcription factors regulated by gma-miR159 (Additional file 1. The gma-miRNA156 family members target sites in numerous proteins containing the Squamosa Promoter Binding (SBP) domain. [score:4]
In each of the four Glyma mo dels, a clear peak for the absolute number of tags is found at the predicted cleavage site for gma-miR159, gma-miR4406, gma-miR167, or gma-miR164. [score:1]
[1 to 20 of 3 sentences]
31
[+] score: 9
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR528, osa-MIR529a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR815c, osa-MIR818d, osa-MIR529b, osa-MIR1425, osa-MIR1428a, osa-MIR169r, osa-MIR1436, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1858a, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR812f, osa-MIR1862d, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1428f, osa-MIR1428g, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR812n, osa-MIR812o, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1861o
In addition, it has been reported that MYB and ACC, targeted by miR159 and miR819, regulates the phytohormone steady-state of ABA and ethylene in plants, respectively [21], [54]. [score:4]
MiR159, miR319, miR812, and miR819 target gene transcripts coding MYB family transcription factor (MYB), TCP family transcription factor (TCP), 1-aminocyclopropane-1-carboxylate oxidase protein (ACC), and BRASSINOSTEROID INSENSITIVE 1 -associated receptor kinase 1 precursor (BAK1), which are involved in the regulation of ABA, jasmonic acid, ethylene, and brassinosteroid homeostasis, respectively [21], [54], [60]. [score:4]
For instance, miR159a. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 9
For example, overexpression of miR159 repressed mRNA levels of MYB33 and MYB65 and induced male sterility as well as delayed flowering under short days [54, 55]; expression of miR167-resistant ARF6 leads to arrested ovule development and indehiscent anthers [56]; NAC1-miR164 pair mediates auxin signaling in lateral root emergence [57]; TIR1, encoding an auxin receptor, and related F-box genes are regulated by miR393 [58]. [score:7]
Impressively, among 20 miRNA families now recognized to be conserved in diverse plant species [48, 49], 16 were identified in developing pollen and sporophytic tissues in this study, and 6 (miR156, miR159, miR164, miR166, miR167 and miR396) were accumulated highly throughout all examined samples (clusters 4, 5 and 9 in Figure 2a), which implies that these conserved miRNAs are conserved among species and among sporophytes and pollen, and among developmental stages of pollen. [score:2]
[1 to 20 of 2 sentences]
33
[+] score: 9
Heatmap shows the expressional levels [log2(normalized miRNA expression)] of different miRNA family members including miR156, miR159, miR164, miR167, miR397, miR1861, and miR1867 families in superior (S, on left part of the map) and inferior (I, on right part of the map) spikelets at different rice grain filling stages. [score:5]
Although both superior and inferior spikelets contained a good amount of miR159, this miRNA was expressed higher in inferior spikelets than in superior spikelets in our study (Figure  5, Additional file 2 and Additional file 3). [score:3]
MiR159, another individual miRNA, induced by ABA, has a role in controlling transcript levels of two MYB factors during Arabidopsis seed germination [47]. [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 8
For instance, GA [3] modulates the expression of miR159, while miR159 regulates the development of Arabidopsis anthers and seeds by cleaving the GAMYB gene, during Arabidopsis anther development [28] and seed germination [29]. [score:6]
In strawberry, miR159 interacts with GAMYB during the course of receptacle development, and both of them act in a joint fashion to respond, in part, to changes in endogenous GA [3] levels [30]. [score:2]
[1 to 20 of 2 sentences]
35
[+] score: 8
It was reported that miR396, miR168, miR167, miR165, miR319, miR159, miR394, miR156, miR393, miR171, miR158, and miR169 were up-regulated in salt stress in Arabidopsis (Liu et al., 2008), while Ath-miR398 was down-regulated under salt stress (Jagadeeswaran et al., 2009). [score:7]
Likewise, in Phaseolus vulgaris, increased accumulation of miRS1 and miR159.2 was observed in response to NaCl addition (Arenas-Huertero et al., 2009). [score:1]
[1 to 20 of 2 sentences]
36
[+] score: 8
As miR159f belongs to MIR159 family, wherein all mature sequence show sequence similarity and target common transcripts, we checked the expression of its other members. [score:5]
Among MIR159 family, three members i. e. miR159f, miR159a. [score:1]
2 and miR159a. [score:1]
Interestingly, a cluster of 11 miRNAs (miR159a. [score:1]
[1 to 20 of 4 sentences]
37
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR810a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR820a, osa-MIR1423, osa-MIR1425, osa-MIR1432, osa-MIR169r, osa-MIR810b, osa-MIR1436, osa-MIR1441, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR812f, osa-MIR1873, osa-MIR1862d, osa-MIR1862e, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR827, osa-MIR396f, osa-MIR2873a, osa-MIR2878, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR1862f, osa-MIR1862g, osa-MIR812n, osa-MIR812o, osa-MIR2873b, osa-MIR5071, osa-MIR5074, osa-MIR5075, osa-MIR5077, osa-MIR5080, osa-MIR5081, osa-MIR5144, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR5795, osa-MIR812s, osa-MIR5802, osa-MIR812t, osa-MIR812u, osa-MIR5805, osa-MIR812v, osa-MIR5807, osa-MIR2873c, osa-MIR6253, osa-MIR1861o
Among the 21 highly conserved miRNA families in rice, mature miRNAs of over 15 and 16 families were found to be differentially expressed in leaf and stem respectively with 11 families having at least a common mature miRNA member that was differentially expressed between both tissues such as osa-MIR159, osa-MIR160, osa-MIR166, osa-MIR169, osa-MIR171, osa-MIR390, osa-MIR394, osa-MIR397, osa-MIR398, osa-MIR399 and osa-MIR408 (refer to Additional file 8 for their functional information). [score:5]
as high [transcripts per million (TPM) > 10000/100000; osa-MIR168, osa-MIR156, osa-MIR166], moderate (TPM = 100–10000; osa-MIR167, osa-MIR397, osa-MIR408, osa-MIR159, osa-MIR164, osa-MIR172, osa-MIR396) and low (TPM < 100; osa-MIR160, osa-MIR162, osa-MIR169, osa-MIR171, osa-MIR390, osa-MIR393, osa-MIR394, osa-MIR395, osa-MIR398, osa-MIR399, osa-MIR827). [score:1]
Of these, 7 miRNA families, namely miR156/157, miR160, miR159, miR319, miR165/166, miR390 and miR408 were found in primitive land plants such as Physcomitrella and Selaginella suggesting that they are highly conserved over wide evolutionary distance [14]. [score:1]
However when the results of both these studies were compared, only 5 miRNAs (miR156, miR159, miR169, miR172 and miR408) were found to be commonly regulated by drought stress. [score:1]
[1 to 20 of 4 sentences]
38
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5083, ppe-MIR171f, ppe-MIR394a, ppe-MIR828, ppe-MIR171h, ppe-MIR171a, ppe-MIR171e, ppe-MIR169e, ppe-MIR319a, ppe-MIR319b, ppe-MIR171g, ppe-MIR171b, ppe-MIR171c, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR159, ppe-MIR160a, ppe-MIR160b, ppe-MIR162, ppe-MIR164a, ppe-MIR164b, ppe-MIR164c, ppe-MIR164d, ppe-MIR166a, ppe-MIR166b, ppe-MIR166c, ppe-MIR166d, ppe-MIR166e, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR168, ppe-MIR169a, ppe-MIR169b, ppe-MIR169c, ppe-MIR169d, ppe-MIR169f, ppe-MIR169g, ppe-MIR169h, ppe-MIR169i, ppe-MIR169j, ppe-MIR169k, ppe-MIR169l, ppe-MIR171d, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR390, ppe-MIR393a, ppe-MIR393b, ppe-MIR394b, ppe-MIR396a, ppe-MIR396b, ppe-MIR397, ppe-MIR399a, ppe-MIR399b, ppe-MIR399c, ppe-MIR399d, ppe-MIR399e, ppe-MIR399f, ppe-MIR399g, ppe-MIR399h, ppe-MIR399i, ppe-MIR399j, ppe-MIR399k, ppe-MIR399l, ppe-MIR399m, ppe-MIR399n, ppe-MIR403, ppe-MIR827, ppe-MIR858
In this study, miR159 not only targeted MYB transcription factors but also regulated the expression of genes encoding ENTH/VHS family proteins, cytokinin oxidase/dehydrogenase, and transferases. [score:6]
Among the miRNA families in peach, miR156, miR159, miR160, miR166, miR171, miR319, miR390 and miR396 showed a high conservation in plants, indicating that these 12 peach miRNA families are ancient. [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR444a, osa-MIR528, osa-MIR530, osa-MIR531a, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR1429, osa-MIR1431, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR531b, osa-MIR1857, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR812f, osa-MIR1862d, osa-MIR1862e, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1883a, osa-MIR1883b, osa-MIR1320, osa-MIR827, osa-MIR1846e, osa-MIR2121a, osa-MIR2864, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR1862f, osa-MIR1862g, osa-MIR3979, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR5083, osa-MIR5143a, osa-MIR5156, osa-MIR5513, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR6248, osa-MIR6249a, osa-MIR531c
The target genes of miR156, miR159, miR169, and miR172 are categorized into different transcription factor families – SBP, MYB, CBF, bZIP – which further regulate gene expression and signal transduction and probably play roles in stress responses [35]. [score:6]
In P15, we found miR156b-3p/c-3p/f-3p/g-3p/h-3p/l-3p, miR159a. [score:1]
[1 to 20 of 2 sentences]
40
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR393a, osa-MIR395d, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR414, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1846d, osa-MIR1853, osa-MIR1860, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5072, osa-MIR5078, osa-MIR5826
It was reported that over-expressed miR159 resulted in a delayed flowering state concomitant with a repression of its target gene, GAMYB in gloxinia [86]. [score:5]
Further, miR159-regulated MYBs were also considered to modulate plant growth and development especially flowering under salinity stress. [score:2]
[1 to 20 of 2 sentences]
41
[+] score: 6
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR390, osa-MIR444a, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR1432, zma-MIR390b, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, zma-MIR444a, osa-MIR6251
Similarly, expression levels of miR159 family, regulators of myeloblastosis (MYB) genes [41], and miR166 family, regulators of Homeodomain-Leucine zipper (HD- ZIP) transcription factor families [42], were also lower than control sample during de-etiolation process in maize, but higher than control sample in rice (Additional file 8). [score:5]
More interestingly, miRNA families that form clusters in maize, such as miR2118, miR395 and miR159, tend to form clusters in rice as well, indicating that those miRNA families already existed in the last common ancestor of maize and rice. [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 5
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR394a, ath-MIR394b, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ath-MIR827, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
In Arobidopsis, MiRNA159 has been shown to be involved in the regulation of seed dormancy and germination by targeting MYB33 and MYB101, two positive regulators of ABA responses during germination. [score:4]
For example, miR156/157, miR159/319, miR166, miR169, and miR394 have been found in 51, 45, 41, 40 and 40 plant species, respectively [36- 38]. [score:1]
[1 to 20 of 2 sentences]
43
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR444a, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1423, osa-MIR1425, osa-MIR1427, osa-MIR1428a, osa-MIR1429, osa-MIR1430, osa-MIR1431, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR810b, osa-MIR1435, osa-MIR1436, osa-MIR1437a, osa-MIR1440a, osa-MIR1441, osa-MIR1442, osa-MIR1439, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1440b, osa-MIR818f, osa-MIR1437b
The 3 miR159 members are represented by 12 different loci in the rice genome, and all 3 members were found to be expressed. [score:3]
Of these, 7 miRNA families, i. e., miR156/157, miR160, miR159, miR319, miR165/166, miR390 and miR408 have been also found in primitive land plants such as Physcometrella and Selaginella suggesting that these are deeply conserved [18- 21]. [score:1]
For example, miR159 is represented by 3 family members and can be mapped to 6 loci in rice. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 5
Interestingly, a very recent study in Arabidopsis revealed that loss of miR159 increases miR156 level and the repression of miR156 by miR159 is largely mediated by MYB33, an R2R3 MYB domain transcription factor targeted by miR159 (Guo et al., 2017). [score:3]
Repression of miR156 by miR159 regulates the timing of the juvenile-to-adult transition in arabidopsis. [score:2]
[1 to 20 of 2 sentences]
45
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR393a, gma-MIR482a, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ahy-MIR156a, ahy-MIR156b, ahy-MIR156c, ahy-MIR159, ahy-MIR167, ahy-MIR394, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR394c, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR393b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR394e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR167k, gma-MIR167l, gma-MIR169w
Expression levels of two members of the ahy-miR159 family (ahy-miR159a and ahy-miR159b) were similar and were detected 66 and 41 times, respectively (Table 1). [score:3]
In addition to miRS1 and miR2118, we also found the third small RNA with 137 reads in our dataset that had only one mismatch with Phaseolus vugaris miR159.2. [score:1]
For example, miR156/157, miR159/319, miR166, miR169, and miR394 have been found in 51, 45, 41, 40, and 40 plant species, respectively [34, 38, 41]. [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 5
Among the known rice miRNAs (miRBase version21), five miRNA families (miR156, miR159, miR166, miR167 and miR168) were highly expressed as detected by the sequencing based small RNA profiling. [score:3]
These results suggested that GAMYB-like genes in rice might be actively involved in the defense of fungal infection via the regulation of miR159 in rice. [score:2]
[1 to 20 of 2 sentences]
47
[+] score: 5
Other miRNAs from this paper: osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f
Recent studies have shown that the MYB genes are post-transcriptionally regulated by microRNAs; for instance, AtMYB33, AtMYB35, AtMYB65 and AtMYB101 genes involved in anther or pollen development are targeted by miR159 family [29, 30]. [score:5]
[1 to 20 of 1 sentences]
48
[+] score: 5
MiR159 was implicated in floral and anther development by targeting the expression of MYB33 and MYB55 [45]. [score:5]
[1 to 20 of 1 sentences]
49
[+] score: 5
Four miRNAs (miR159, miR165/166, miR319) participate in regulation of various developmental processes by targeting the GAMYB, Homeodomain Leucine Zipper (HD-ZIP) and TCP transcription factors in Arabidopsis, respectively (Millar and Waterhouse, 2005; Jones-Rhoades et al., 2006; Mallory and Vaucheret, 2006; Jung et al., 2009; Rubio-Somoza and Weigel, 2011). [score:5]
[1 to 20 of 1 sentences]
50
[+] score: 4
Similarly, miR159 which is found to target MYB and ERF TFs in the present study, wi dely modulates various abiotic stresses including salinity stress by integrating responses of environmental stimuli [49]. [score:3]
Besides, miR396c [40], miR398 [41], miR159 [42], are also found to be salt responsive miRNAs of rice. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR414, osa-MIR419, osa-MIR435, osa-MIR390, osa-MIR396e, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1426, osa-MIR169r, osa-MIR1436, osa-MIR1440a, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ctr-MIR156, ctr-MIR166, ctr-MIR319, ctr-MIR164, ctr-MIR167, ctr-MIR171, osa-MIR395x, osa-MIR395y, osa-MIR1440b
We also found homologs of known miRNA target genes for several conserved C. trifoliata miRNAs, such as SBP for miR156, ATP synthase for miR159, ARF for miR160, NAC for miR164, HD-Zip for miR165 and miR166, Anthocyanidin synthase for miR169, GRAS for miR171, AP2 for miR172, TCP for miR319, TIR for miR393, F-box for miR394, Sulfate transporter 2.1 for miR395, IRX12 copper ion binding/oxidoreductase for miR397, ARGONAUTE 2 for miR403, Basic blue copper protein for miR408 and Zinc finger protein-related for miR414. [score:3]
Additionally, fifteen miRNA families namely miR156, miR159, miR160, miR162, miR164, miR166, miR167, miR168, miR169, miR171, miR172, miR390, miR394, miR403, and miR1446, were found to have some thousands to tens of thousands of redundancies while four families (miR395, miR396, miR397, miR414, and miR827), had more than one hundred redundancies. [score:1]
[1 to 20 of 2 sentences]
52
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
However, miRNA156, miRNA159 and miR172 targeted more than one gene family. [score:3]
These thirteen conserved pre-miRNAs belonged to the miR156 (6), miR159 (4), miR160 (2) and miR170 (1) families. [score:1]
[1 to 20 of 2 sentences]
53
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
It was reported that five conserved miRNAs (miR159, miR162, miR166, miR390, and miR399) presented similar expression levels in root apexes and nodules, but miR169, miR171, miR393, and miR396 enriched in root tips [41]. [score:3]
MicroRNA chip experiments showed that eight miRNAs (miR156/157, miR167, miR168, miR319, miR159, miR894, miR1507, and miR1509) were induced by Pi starvation in soybean leaves, and seven miRNAs (miR159, miR894, miR1507, miR1509, miR396, miR474, and miR482) were induced in soybean roots by low P [31]. [score:1]
[1 to 20 of 2 sentences]
54
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, osa-MIR414, osa-MIR437, osa-MIR390, osa-MIR440, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR531a, osa-MIR529b, osa-MIR1425, osa-MIR1427, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR1439, osa-MIR531b, osa-MIR1846d, osa-MIR1848, osa-MIR1850, osa-MIR1846a, osa-MIR1846b, osa-MIR1859, osa-MIR1860, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1863a, osa-MIR1864, osa-MIR1865, osa-MIR1871, osa-MIR1874, osa-MIR1862d, osa-MIR1876, osa-MIR1862e, osa-MIR1878, osa-MIR1879, osa-MIR1319a, osa-MIR1846c, osa-MIR2055, osa-MIR1846e, osa-MIR2096, osa-MIR396f, osa-MIR2106, osa-MIR2120, osa-MIR2275a, osa-MIR2275b, osa-MIR2863a, osa-MIR2863b, osa-MIR2872, osa-MIR2875, osa-MIR2876, osa-MIR2877, osa-MIR2878, osa-MIR1863c, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR1863b, osa-MIR1862f, osa-MIR1862g, osa-MIR3979, osa-MIR3981, osa-MIR5072, osa-MIR5073, osa-MIR5076, osa-MIR5079a, osa-MIR5082, osa-MIR5083, osa-MIR2863c, osa-MIR5150, osa-MIR5151, osa-MIR5155, osa-MIR5160, osa-MIR5161, osa-MIR5162, osa-MIR5484, osa-MIR5504, osa-MIR5505, osa-MIR5513, osa-MIR2275c, osa-MIR2275d, osa-MIR5788, osa-MIR5792, osa-MIR5809, osa-MIR5812, osa-MIR1319b, osa-MIR6246, osa-MIR6250, osa-MIR6253, osa-MIR5079b, osa-MIR531c
Significantly down-regulated miRNAs were osa-miR169a, osa-miR1863, osa-miR2878, osa-miR1425, osa-miR1876, osa-miR171, osa-miR1874, and osa-miR159. [score:4]
[1 to 20 of 1 sentences]
55
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR435, osa-MIR390, osa-MIR396e, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR162a, ptc-MIR162b, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR393a, ptc-MIR393b, ptc-MIR393c, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR397a, ptc-MIR397b, ptc-MIR397c, ptc-MIR403a, ptc-MIR403b, ptc-MIR408, ptc-MIR477e, ptc-MIR477f, ptc-MIR474a, ptc-MIR474b, ptc-MIR474c, ptc-MIR475a, ptc-MIR475b, ptc-MIR475c, ptc-MIR475d, ptc-MIR476a, ptc-MIR476b, ptc-MIR477a, ptc-MIR477b, ptc-MIR478a, ptc-MIR478b, ptc-MIR478c, ptc-MIR478d, ptc-MIR478e, ptc-MIR478f, ptc-MIR478h, ptc-MIR478i, ptc-MIR478j, ptc-MIR478k, ptc-MIR478l, ptc-MIR478m, ptc-MIR478o, ptc-MIR478p, ptc-MIR478q, ptc-MIR478r, ptc-MIR478s, ptc-MIR478n, ptc-MIR481a, ptc-MIR481b, ptc-MIR481c, ptc-MIR481d, ptc-MIR482a, ptc-MIR171k, ptc-MIR403c, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR477c, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR477d, ptc-MIR482c, ptc-MIR828a, ptc-MIR828b, ptc-MIR403d
miR156/157, miR159 and miR319 are represented by 22 and 38 members respectively and three other families (miR169, miR170/171, miR165/166) are represented by more than 20 members. [score:1]
Several Arabidopsis and rice families such as miR156/157, miR159/319, miR162, miR172, miR396, miR397, miR473, and miR475 are nearly double in size in Populus. [score:1]
For families miR156/157, miR159, miR319, miR162, miR172, miR396, miR397, miR473, miR475 and miR482, the number of members identified in this study was at least twice that reported previously [3, 26] (Fig. 2). [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR160f, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR1127a, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2275a, osa-MIR2275b, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, tae-MIR167b, hvu-MIR168, hvu-MIR169, tae-MIR169, hvu-MIR397a, tae-MIR398, tae-MIR171b, hvu-MIR166b, hvu-MIR166c, osa-MIR2275c, osa-MIR2275d, tae-MIR1122b, tae-MIR9653a, tae-MIR9654a, tae-MIR9656, tae-MIR9657a, tae-MIR9659, tae-MIR9660, tae-MIR1127b, tae-MIR9661, tae-MIR396, tae-MIR9665, tae-MIR2275, tae-MIR9667, tae-MIR167c, tae-MIR1120b, tae-MIR397, tae-MIR1130b, tae-MIR5384, tae-MIR9675, tae-MIR1120c, tae-MIR9679, tae-MIR9657b, hvu-MIR397b, hvu-MIR156b, tae-MIR9653b
Of the 15 known miRNA families, 8 (miR396, miR168, miR156, miR172, miR159, miR398, miR1318 and miR167) showed different levels of preferential expression in wheat flag leaves, with the logarithm of the fold changes ranged from 0.5 to 5.2 as well as more than those in the developing seeds (Figure  3a, Table  2). [score:3]
[1 to 20 of 1 sentences]
57
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR169a, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR169a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR391, ath-MIR156g, ath-MIR156h, ath-MIR159c, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR156a, gma-MIR156b, gma-MIR169a, osa-MIR535, ath-MIR781a, ath-MIR782, ath-MIR847, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, osa-MIR1846d, osa-MIR1857, osa-MIR1846a, osa-MIR1846b, osa-MIR1846c, osa-MIR1846e, ath-MIR2112, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, gma-MIR391, gma-MIR156f, gma-MIR169d, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR169f, gma-MIR169g, gma-MIR2118a, gma-MIR2118b, gma-MIR169h, gma-MIR169i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, ath-MIR781b, ath-MIR156i, ath-MIR156j, gma-MIR156p, gma-MIR156q, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR156t, gma-MIR169t, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR169v, gma-MIR169w
Although only a few cleavage targets of the highly accumulated RC-miRNAs were detected, several RC-miRNAs were shown to possess great potential to guide DNA methylation in both Arabidopsis (RC_ath-miR2112, RC_ath-miR391, RC_ath-miR781, RC_ath-miR782, and RC_ath-miR847) and rice (RC_osa-miR156, RC_osa-miR159, RC_osa-miR169, RC_osa-miR1846, RC_osa-miR2118, and RC_osa-miR535) (Figure 4 and Table S6). [score:3]
[1 to 20 of 1 sentences]
58
[+] score: 3
The MicroRNA159-Regulated GAMYB-like genes inhibit growth and promote programmed Cell Death in Arabidopsis. [score:3]
[1 to 20 of 1 sentences]
59
[+] score: 3
Note that an extended exposure time was needed to detect expression of most miRNAs (indicated by a number in days in parentheses in Figure 2), suggesting that their abundance is significantly lower than that of other known miRNAs (that is, miR158 and miR159a in Figure 2c, and data not shown). [score:3]
[1 to 20 of 1 sentences]
60
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1514a, gma-MIR1514b, gma-MIR1536, gma-MIR1530, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR398d, gma-MIR167k, gma-MIR167l, gma-MIR169w
A series of targets for known miRNAs, including gma-miR156, gma-miR159, gma-miR160, gma-miR164, gma-miR167, gma-miR169, gma-miR396, gma-miR398 and gma-miR1514, belong to this class (Tables 3, 4). [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR810a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR529b, osa-MIR1425, osa-MIR1430, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR810b, osa-MIR1440a, osa-MIR531b, osa-MIR1847, osa-MIR1848, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR1865, osa-MIR812f, osa-MIR1874, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1320, osa-MIR827, osa-MIR2090, osa-MIR396f, osa-MIR2118c, osa-MIR2863a, osa-MIR2863b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3979, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR3981, osa-MIR5082, osa-MIR2863c, osa-MIR5337a, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1440b, osa-MIR818f, osa-MIR1861o
Under conditions of Cadmium(Cd) stress, 141 known miRNAs and 39 miRNAs express in the root and shoot, including miR156, miR159, miR168, miR169, miR171, miR369, miR529, miR1433, miR1440, etc. [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 3
Three Sit-miRs namely Sit-miR5568.58, Sit-miR2118d and Sit-miR159a were evidenced to target SiMYB026, SiMYB028, SiMYB029, SiMYB130 and SiMYB190 (Table 1). [score:3]
[1 to 20 of 1 sentences]
63
[+] score: 3
Previous results showed that overexpression of miR164, miR159a, and miR319 affected members of the NAC, MYB, and TCP families of transcription factor genes, respectively [58– 60]. [score:3]
[1 to 20 of 1 sentences]
64
[+] score: 3
Sequence and expression differences underlie functional specialization of Arabidopsis microRNAs miR159 and miR319. [score:3]
[1 to 20 of 1 sentences]
65
[+] score: 3
While auxin signalling pathway is regulated by miR160, miR167, miR390 and miR393, the JA biosynthetic pathway is under the control of miR319 and miR159, and miR159 regulate the ABA signalling pathway (Curaba et al. 2014). [score:3]
[1 to 20 of 1 sentences]
66
[+] score: 3
Reyes and Chua (2007) described a homeostatic mechanism of ABA -induced accumulation of miR159 to direct the transcript degradation of two positive regulators of ABA responses (MYB33 and MYB101), which desensitizes hormone signalling during the stress response. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 2
Our network analysis further showed that osa-miR1861 regulated many genes or TFs in the superior spikelets and had cross-talk with the verified yield -associated osa-miR159a. [score:2]
[1 to 20 of 1 sentences]
68
[+] score: 2
For example, the known osa-miR419 has 14 mismatched bases; osa-miR415 has 10 mismatched bases; osa-miR416 has 7 mismatched bases; osa-miR414 has 7 mismatched bases; osa-miR159a. [score:1]
Some miRNA families have functions that are conserved across the plant kingdom and thus their sequences are similarly conserved (e. g. miR156, miR159, miR160 and miR165). [score:1]
[1 to 20 of 2 sentences]
69
[+] score: 2
Arabidopsis miR172, miR159, miR156 and miR171 regulate flowering time and floral patterning [2], [7], [8]. [score:2]
[1 to 20 of 1 sentences]
70
[+] score: 2
U6 and miR159 were probed as controls. [score:1]
The miR167, miR159, U6 and LNA were probed with end-labeled oligonucleotides by T4 polynucleotide kinase (NEB). [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 2
Other miRNAs, such as miR159 and miR164, are also reported to be involved in rice floral development (Tsuji et al., 2006; Adam et al., 2011). [score:2]
[1 to 20 of 1 sentences]
72
[+] score: 1
On the other hand, the patterns of sequence diversity at some pre-miRNA loci showed a clear-cut departure from the neutrality owing to the highly positive but non-significant values for both the tests (e. g. pre-miR156k, pre-miR159a, pre-miR529b and pre-miR2093). [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
For example, XLOC_015015 was annotated as miR159, suggesting that some of the novel nTUs are functional as non-coding RNAs. [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
We constructed a 35S promoter -driven artificial primary miR528 (apri-miR528) and mutant artificial primary miR528 (mapri-miR528) with three additional C/G pairs at the end of the miRNA/miRNA* duplex using an Arabidopsis primary miR159a backbone (Fig 3A). [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
Six miRNA families, osa-miR159, osa-miR160, osamiR164, osa-miR167, osa-miR172, and osa-miR1848, were shown to be associated with the rice leaf senescence processes through hormone signaling pathways. [score:1]
[1 to 20 of 1 sentences]
76
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR418, osa-MIR396e, osa-MIR531a, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR531b, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR531c
of loci miR156 ND d 1 miR159 MYB and TCP TFs e b 2 miR160 ND d 1 miR162 DICER-LIKE 1 b 1 miR164 ND a 1 miR166 HD-Zip TFs f, h, k h, k, n h, n c 9 miR167 Auxin response factors TFs a, d, f j d a 6 miR168 ARGONAUTE b 1 miR169 CCAAT binding factor and HAP2-like TFs n, p c 3 miR171 SCARECROW-like TFs c, e, f c c, d a 7 miR319 ND a 1 miR395 ATP sulphurylases i, j, k 3 miR396 GRF TFs, rhodenase-like, and kinesin-like protein B b 1 miR397 Laccases and beta-6 tubulin a a 2 miR399 Phosphatase TFs e b, e 3 miR418 ND x x 2 miR420 ND x x x 3 miR441 ND b a, b, c c 5 miR442 ND x x x 3 miR446 ND x x x 3 miR531 ND x x 2 miR535 ND x x x x 4 Total no. [score:1]
[1 to 20 of 1 sentences]
77
[+] score: 1
It is interesting to note that those MIRNA genes (e. g. miR158, miR159/319, miR164, miR167, miR168, miR172) whose transcripts accumulate in post-transcriptional processing mutants [80], [114], [116] also produce abundant smRNAs (Datafile S2) [14]. [score:1]
[1 to 20 of 1 sentences]
78
[+] score: 1
Of these miRNA families, the miR159 family was only identified in bread wheat, miR1125 and miR437 were only found in durum wheat, while miR7530 and miR818 were specific to loci on the wild emmer wheat 3B chromosome. [score:1]
[1 to 20 of 1 sentences]
79
[+] score: 1
In Arabidopsis, the miRNA families miR159, miR167, miR172, miR173, and miR394 are iron deficiency responsive (Waters et al., 2012). [score:1]
[1 to 20 of 1 sentences]
80
[+] score: 1
Genomic fragments of 650–850-bp containing the binding sites of the miRNAs (miR156::Os08g39890, miR159::Os01g59600, miR390::Os02g10100, miR395::Os03g09930, miR408::Os03g15340 and miR820a::Os03g02010) were amplified and sequenced (Accession nos. [score:1]
[1 to 20 of 1 sentences]
81
[+] score: 1
1 LOC_Os10g04730 Cysteine-rich receptor-like protein kinase 5 LOC_Os11g40970 Probable LRR receptor-like serine/threonine-protein kinase osa-miR159a. [score:1]
[1 to 20 of 1 sentences]
82
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169j, osa-MIR169m, osa-MIR171d, osa-MIR171f, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, osa-MIR444a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820c, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1441, osa-MIR1846b, osa-MIR1882e, osa-MIR1883b, osa-MIR1846e, osa-MIR396f, osa-MIR2120, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2879, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR5158, osa-MIR5143b, osa-MIR5835, osa-MIR7693, osa-MIR7695
The read counts for many miRNAs were increased via time-course such as osa-MIR395y and osa-MIR171f in mock rice samples and osa-MIR7693 and osa-MIR159a in RSV infected samples (Fig 4A, S1 Table). [score:1]
[1 to 20 of 1 sentences]
83
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
In Arabidopsis, only the miR171 family is divided in two families, and the following miRBase families are pairwise grouped together: MIR319–MIR159, MIR156–MIR157, MIR165–MIR166, and MIR170–MIR171. [score:1]
[1 to 20 of 1 sentences]
84
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR528, osa-MIR531a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR814b, osa-MIR1425, osa-MIR1432, osa-MIR444d, osa-MIR444f, osa-MIR531b, osa-MIR1847, osa-MIR1849, osa-MIR1850, osa-MIR1852, osa-MIR1846a, osa-MIR1846b, osa-MIR1868, osa-MIR812f, osa-MIR1875, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1883a, osa-MIR1846e, osa-MIR2093, osa-MIR2865, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR2873b, osa-MIR5074, osa-MIR2863c, osa-MIR5150, osa-MIR5485, osa-MIR5486, osa-MIR5487, osa-MIR5490, osa-MIR5491, osa-MIR5497, osa-MIR5499, osa-MIR5504, osa-MIR5505, osa-MIR5506, osa-MIR5516a, osa-MIR5519, osa-MIR5521, osa-MIR5528, osa-MIR5538, osa-MIR812p, osa-MIR812q, osa-MIR5791, osa-MIR5792, osa-MIR5793, osa-MIR812r, osa-MIR5797, osa-MIR812s, osa-MIR5800, osa-MIR812t, osa-MIR812u, osa-MIR5806, osa-MIR812v, osa-MIR5815, osa-MIR5817, osa-MIR5818, osa-MIR1319b, osa-MIR5179, osa-MIR5834, osa-MIR5836, osa-MIR5516b, osa-MIR6250, osa-MIR6253, osa-MIR531c
B2 osa-miR159a. [score:1]
[1 to 20 of 1 sentences]