sort by

51 publications mentioning osa-MIR319b

Open access articles that are associated with the species Oryza sativa and mention the gene name MIR319b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 396
Up-regulated Osa-miR319b and down-regulated OsPCF6 and OsTCP21 can increase the account of CBF (Fig. 4, 9A), but Zat12 down-regulated CBF transcript expression, ROS up-regulated Zat12 transcript expression suggesting that decrease amount of ROS improve cold resistance. [score:17]
Furthermore, cold stress osa-miR319b expression was down-regulated while the expression of miR319 -targeted genes was up-regulated. [score:13]
Under cold stress Osa-miR319b is down-regulated, leading to the repression of its targets and possibly the up-regulation of ROS (arrow with dashed line), which in turn inhibits cold tolerance. [score:11]
0091357.g011 Figure 11Under cold stress Osa-miR319b is down-regulated, leading to the repression of its targets and possibly the up-regulation of ROS (arrow with dashed line), which in turn inhibits cold tolerance. [score:11]
The overexpression of Osa-miR319b and RNAi of OsPCF6 and OsTCP21 led to a greater accumulation of osmolytes, such as free proline, and DREB1/CBF proteins in rice, and suppressed the accumulation of ROS under conditions of cold stress through down -regulating OsPCF6 and OsTCP21, the targets of Osa-miR319b. [score:8]
Exposure of rice to cold induces decreased Osa-miR319b expression, which regulates the expression of the proposed target genes OsPCF6 and OsTCP21. [score:8]
However, in the Osa-miR319b OE lines, the cold induction of OsPCF6 and OsTCP21 was obviously inhibited (P<0.05, by Student's t-test), which indicated that Osa-miR319b overexpression repressed the induced expression of OsPCF6 and OsTCP21 under cold stress. [score:7]
In addition to the Osa-miR319b OE plants can accumulation of free proline content, we also found that overexpression of Osa-miR319b led to higher expression levels of cold stress related genes, such as Hsieh showed that transgenic expression of the transcriptional activator, CRT/DRE -binding factor 1 (CBF1), enhanced the cold tolerance of tomato plants(Fig. 4). [score:7]
Diverse plant species endure cold stress to varying degrees, and miR319 was up-regulated in two varieties of sugarcane [32] and down-regulated in the two major subspecies of rice [13] exposed to cold stress. [score:7]
This result suggested that up-regulated Osa-miR319b and down-regulated OsPCF6 and OsTCP21 enhanced cold tolerance possibly through decreased levels of ROS. [score:7]
Overexpression of Osa-miR319b in O. sativa enhance plant tolerance to cold stressTo test whether Osa-miR319b overexpression affects plant tolerance to cold stress, the WT and overexpression (OE) seedlings were hydroponically cultured in Yoshida solution until three leaves appeared. [score:7]
Thus, we analyzed the expression profiles of OsPCF6 and OsTCP21 in WT and Osa-miR319b OE lines in response to cold stress, to verify whether their expression was affected by Osa-miR319b overexpression. [score:7]
Overexpression of Osa-miR319b in rice results in increased leaf widthThe most conspicuous feature of Osa-miR319b -overexpressing transgenic plants (OE) is delayed development and wider leaves. [score:6]
In our study, OsCPT displayed down-regulated expression in Osa-miR319b OE plants under cold stress. [score:6]
The study by Yang observed that down -regulating the expression of either of the two miR319 -targeted genes, OsPCF5 and OsPCF6, in RNAi plants also resulted in enhanced cold tolerance. [score:6]
In rice, expression of Osa-miR319 was down-regulated by cold stress [13]. [score:6]
For example, down-regulation of either OsPCF5 or OsPCF8 significantly improved the cold tolerance of transgenic seedlings cold tolerance [19], in sugarcane PCF6, which was identified as miR319b target gene by 5′RACE was induced by cold tolerance [32]. [score:6]
Moreover, the miR319 -targeted genes were up-regulated by low temperature treatments, the inverse-correlated with Osa-miR319b. [score:6]
Based on this study, a hypothetical mechanistic mo del of the regulation by Osa-miR319b and its targets in rice has been proposed (Fig. 11), but how Osa-miR319b and its targets participate in cold stress remains to be determined. [score:6]
As shown in Figure 4, cold stress obviously induced expression of all the above genes, and Osa-miR319b OE lines exhibited significantly higher expression levels than WT, except OsCPT (P<0.05, by Student's t-test). [score:5]
0091357.g005 Figure 5qRT-PCR analysis of OsPCF6 and OsTCP21 expression patterns under 4°C in wild-type and Osa-miR319b -overexpressing plants. [score:5]
The expression of Osa-miR319b in japonica rice was reduced beginning at 3 h after exposed to cold, and there was almost no expression at 24 h [13]. [score:5]
Expression levels of some cold-responsive genes in wild-type plants and overexpressing Osa-miR319b plants. [score:5]
To test whether Osa-miR319b overexpression affects plant tolerance to cold stress, the WT and overexpression (OE) seedlings were hydroponically cultured in Yoshida solution until three leaves appeared. [score:5]
Osa-miR319b was not inversely correlated with the OsPCF6 and OsTCP21 in spatio-temporal expression specificity, suggesting that there exists a complex relationship between Osa-miR319b and its above target genes in rice. [score:5]
The cold stress phenotype of OsPCF6 and OsTCP21 OE plants counters the phenotype of the Osa-miR319b -overexpressing plants, while the RNAi plant's phenotypes are in keeping with those of the Osa-miR319b -overexpressing plants (compare Fig. 3A and 7). [score:5]
Overexpression of Osa-miR319b increases the transcript levels of cold stress responsive genesTo explore the role of Osa-miR319b in the cold stress response, the expression of the well-known cold stress responsive marker genes was analyzed in both WT and OE plants. [score:5]
The up-regulation of Osa-miR319b or RNAi of OsPCF6 and OsTCP21 may allow rice plants to effectively osmoregulate by accumulating free proline and to minimize oxidative damage in plants under abiotic stress. [score:5]
0091357.g004 Figure 4Expression levels of some cold-responsive genes in wild-type plants and overexpressing Osa-miR319b plants. [score:5]
qRT-PCR analysis of OsPCF6 and OsTCP21 expression patterns under 4°C in wild-type and Osa-miR319b -overexpressing plants. [score:5]
Previous studies showed higher expression of Osa-miR319b in the young panicle and culm, and lower expression in root, mature panicle, and leaf. [score:5]
Yang et al. (2013) observed that overexpression of Osa-miR319b and repression of its targets, OsPCF5 and OsPCF8 led to enhanced cold tolerance (4°C) after chilling acclimation (12°C). [score:5]
Expression patterns of the OsPCF6 and OsTCP21 genes under 4°C in rice seedlings at 0, 1, 3, 6, 9, 12, 24 h after cold stress onset in WT and Osa-miR319b -overexpressing lines. [score:5]
0091357.g002 Figure 2 Osa-miR319b overexpressing plants showed delayed development and widen leaf. [score:4]
However, little is known about the regulatory relationship between miR319 and its targets, OsPCF6 and OsTCP21, under cold stress. [score:4]
To elucidate the regulatory relationship between OsmiR319 and OsPCF6/ OsTCP21, we evaluated the effect of Osa-miR319 overexpression on OsPCF6 and OsTCP21 expression under cold stress. [score:4]
Microarray data of the shoot apical meristem of miR319 transgenic plants, compared to wild-type (WT), showed that expression of all miR319 -targeted TCP genes decreased up to 30-fold, which strongly indicated that TCP genes were degraded by miR319 activity [20], [28], [24]. [score:4]
In the current study, we focused on the Osa-miR319b gene, which was obviously down-regulated under cold stress. [score:4]
Osa-miR319b overexpressing plants showed delayed development and widen leaf. [score:4]
The most conspicuous feature of Osa-miR319b -overexpressing transgenic plants (OE) is delayed development and wider leaves. [score:4]
These results indicated that overexpression of Osa-miR319b possibly conferred plants developments. [score:4]
Collectively, the results suggested that, as Osa-miR319 targets, OsPCF6 and OsTCP21 negatively regulated plant cold tolerance. [score:4]
MiR319 was supposed to participate in plant cold tolerance by regulating its target genes or functioning together with other miRNAs [27]. [score:4]
In our study, we observed that overexpressing Osa-miR319b could result in wider leaf and delayed development in seeding stage of rice (Fig. 2). [score:4]
The PCR products were then cloned into the binary vector pCAMBIA330035sU to create the Osa-miR319b overexpression construct driven by the CaMV35s promoter [60]. [score:3]
These results indicated that overexpression of Osa-miR319b conferred increased cold tolerance, perhaps through promoting the free proline accumulation under cold stress. [score:3]
In this study, we focused on another two targets of Osa-miR319b, OsPCF6 and OsTCP21. [score:3]
One important finding was that Osa-miR319b -overexpressing plants exhibited higher survival rate than WT plants when exposed to cold stress (Fig. 3B). [score:3]
Semi-quantitative RT-PCR analysis showed relatively higher expression levels of Osa-miR319b in all three lines (Fig. 1C). [score:3]
To explore the potentiality of manipulating Osa-miR319b expression in annual species for enhancing plant resistance to cold stress, we prepared a chimeric construct, p35S- Osa-miR319b/p35S- Bar, under the control of the CaMV 35S promoter (Fig. 1A). [score:3]
However, it is possible that Osa-miR319b induces the expression of DREB1/CBF (arrow with dashed line and question mark). [score:3]
Expression levels of the mature- Osa-miR319b in transgenic lines were further confirmed by quantitative real-time PCR analysis (Fig. 1D). [score:3]
The cold induction of OsPCF6 and OsTCP21 is obviously repressed in Osa-miR319b OE linesIn previous studies, PCF6 gene was identified as one of the miR319b targets by using 5′RACE analysis in sugarcane [32]. [score:3]
However, in indica rice, the expression of Osa-miR319b increased between 12 and 24 h after exposed to cold [19]. [score:3]
It has been reported that miR319 targeted TEOSINTE BRANCHED/CYCLOIDEA/PCF (TCP) genes, the plant-specific transcription factors containing bHLH motifs that allow DNA binding and protein-protein interaction [22], [23], [24], [25], [26], [27]. [score:3]
We found that OsPCF6 and OsTCP21 expression was largely greatly by cold stress, and the degree of induction was obviously repressed in Osa-miR319b transgenic lines. [score:3]
More importantly, overexpression of Osa-miR319b and the OE and RNAi of OsPCF6 and OsTCP21 in rice seedlings did not affect their phenotypes under control conditions. [score:3]
Previous studies showed that miR319-TCPs regulated leaf developmental processes, including leaf senescence, cell proliferation, and cell differentiation [20], [29], [30]. [score:3]
Previous studies suggested that miR319b responded to cold stress and that TCP transcription factors were the predicted targets of miR319b [13], [25], [19]. [score:3]
In rice, miR319 was predicted to target five TCP genes, OsPCF5, OsPCF6, OsPCF7, OsPCF8, and OsTCP21. [score:3]
These results suggested that OsPCF6 and OsTCP21 were indeed target genes of Osa-miR319b, and were possibly involved in plant response to cold stress. [score:3]
Overexpression of Osa-miR319b in O. sativa enhance plant tolerance to cold stress. [score:3]
Overexpression of Osa-miR319b increases the transcript levels of cold stress responsive genes. [score:3]
To explore the role of Osa-miR319b in the cold stress response, the expression of the well-known cold stress responsive marker genes was analyzed in both WT and OE plants. [score:3]
In previous studies, PCF6 gene was identified as one of the miR319b targets by using 5′RACE analysis in sugarcane [32]. [score:3]
In sugarcane, changes in miR319 expression under cold stress were observed in both roots and shoots [31]. [score:3]
Yang (2013) showed that wider leaves of overexpressing Osa-miR319b plants are not due to change in their cell size but to their increase cell number reflected mainly by increased leaf small veins. [score:3]
This result is generally similar to the larger leaves phenotype observed in transgenic dicotyledonous plants with miR319 overexpression [18], [20], [22]. [score:3]
In previous study, ectopic expression of miR319 induced larger leaf blades and continuous growth of leaf margins in snapdragon, Arabidopsis, tomato and other species though each with its distinct leaf form [20], [22]. [score:3]
Therefore, Osa-miR319b possibly participates in and responds to cold stress, and over -expression of Osa-miR319b enhances plant tolerance to cold stress. [score:3]
Overexpression of Osa-miR319b in rice results in increased leaf width. [score:3]
These results demonstrated that Osa-miR319b overexpression enhanced plant cold tolerance at the seedling stage. [score:3]
OsPCF6 and OsTCP21 proteins are located in the nuclei and the spatial-temporal expression profiles of Osa-miR319b and OsPCF6 and OsTCP21 As transcription factors, OsPCF6 and OsTCP21 are supposed to be located in the nuclei. [score:3]
Expression of TCPs, lacking the miR319 recognition site were not affected. [score:3]
Both our and Yang study demonstrated that overexpressing Osa-miR319b led to enhanced cold tolerance (4°C) in transgenic rice seeding. [score:3]
In previous studies, we constructed a rice miRNA expression profile under cold stress based on the microarray data, and identified a total of 18 cold stress responsive miRNAs, including Osa-miR319. [score:3]
OsPCF6 and OsTCP21 proteins are located in the nuclei and the spatial-temporal expression profiles of Osa-miR319b and OsPCF6 and OsTCP21. [score:3]
In summary, this study indicates that Osa-miR319b functions as a positive regulator to mediate the tolerance of rice seedlings to cold stress. [score:2]
The phenotypic analysis indicated that both OsPCF6 and OsTCP21 were involved in cold responses, and that they may be regulated by Osa-miR319b. [score:2]
These results demonstrated that Osa-miR319b played an important role in cold tolerance by regulating a number of cold stress related genes. [score:2]
Thus, Osa-miR319b may confer increased cold tolerance through up -regulating cold stress responsive genes, including DREB1/CBF, DREB2A, and TPP1/2. [score:2]
These results suggest that differences in the intensity of the regulation of Osa-miR319b could be tested as a marker for selecting cold-tolerant rice cultivars. [score:2]
However, how affected the leaf width and delayed development of Osa-miR319b in our further study. [score:2]
The result show differences in Osa-miR319b regulation among different rice genotypes contrasting in tolerance to cold. [score:2]
Transcription factors up-regulated by cold stress contained the TCP-domain families [36], leading us to conduct further experiments to characterize the function of miR319b and TCP in plant cold stress response. [score:2]
The cold induction of OsPCF6 and OsTCP21 is obviously repressed in Osa-miR319b OE lines. [score:1]
To elucidate the potential mechanisms for the enhanced cold tolerance of Osa-miR319b OE plants, an analysis of the proline content was conducted to monitor changes in physiological processes associated with plant cold stress tolerance. [score:1]
To test whether these genes were responsible for enhanced the cold tolerance of Osa-miR319b OE plants, quantitative real-time PCR was performed to evaluate the expression levels. [score:1]
0091357.g001 Figure 1Generation and molecular analysis of Osa-miR319b transgenic lines. [score:1]
Stress tolerance of Osa-miR319b transgenic rice and wild-type rice subjected to cold stress treatment. [score:1]
To evaluate the role of Osa-miR319b in plant tolerance to cold stress, in this study, we generated transgenic plants over -expressing Osa-miR319b by Agrobacterium -mediated transformation (Fig. 1B, C). [score:1]
Therefore, Osa-miR319b, OsPCF6 and OsTCP21 provide a promising tool for improving the tolerance of rice to abiotic stress in general and to cold stress in particular. [score:1]
The miR319 family is one of the most ancient and conserved miRNA families, and has been found in a large number of plant species, from Physcomitrella to flowering plants [14], [15], [16], [17], [18], [19]. [score:1]
MiR319, previously known as ‘miR-JAW’, was firstly described in Arabidopsis because of its role in controlling leaf morphogenesis [20], [21]. [score:1]
Southern blotting results showed that Osa-miR319b was integrated into the rice genome of three independent transgenic lines (Fig. 1B). [score:1]
In this study, we further characterized the biological function of Osa-miR319 in response to cold stress by using overexpression transgenic lines. [score:1]
This study found a greater accumulation of free proline in the Osa-miR319b OE plants, which may partially account for the higher tolerance of Osa-miR319b OE plants to cold stress (Fig. 3C). [score:1]
In addition, several researchers have suggested the involvement of miR319 in the cold stress response. [score:1]
Generation and molecular analysis of Osa-miR319b transgenic lines. [score:1]
0091357.g003 Figure 3Stress tolerance of Osa-miR319b transgenic rice and wild-type rice subjected to cold stress treatment. [score:1]
[1 to 20 of 100 sentences]
2
[+] score: 66
High levels of miR319 or downregulation of its target genes leads to a broader leaf phenotype in arabidopsis (Palatnik et al., 2003), and similar results were found in snapdragons, tomatoes, rice, and other plants (Ori et al., 2007; Yang et al., 2013). [score:6]
The recent studies showed that overexpression of miR319 led to abnormal development and tolerance to stress in several transgenic plants (Yang et al., 2013; Zhou et al., 2013; Wang et al., 2014; He et al., 2014; Zhou and Luo, 2014; Li et al., 2016). [score:4]
It has been reported that miR319 -targeted TCPs are involved in leaf development in eudicot species, such as arabidopsis and tomato (Nag et al., 2009; Martín-Trillo and Cubas, 2010). [score:4]
Overexpression of Switchgrass Pvi-MIR319a Results in Pleiotropic Phenotype Changes in Transgenic Rice PlantsAs a highly conserved ancient miRNA, miR319 plays important roles in plant development (Jones-Rhoades et al., 2006; Yang et al., 2013; Zhou et al., 2013; Zhou and Luo, 2014). [score:4]
Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. [score:4]
MicroRNA319 positively regulates cold tolerance by targeting OsPCF6 and OsTCP21 in rice (Oryza sativa L. ). [score:3]
Crinkled leaves appear in transgenic dicotyledonous plants ectopically expressing miR319 but not in transgenic monocotyledonous plants. [score:3]
This is similar to the case in rice, where the expression level of miR319 was high only in young panicles, low in other tissues, and lowest in mature leaves and mature panicles (Yang et al., 2013). [score:3]
Control of jasmonate biosynthesis and senescence by miR319 targets. [score:3]
We noticed that the similar report was appear in Arabidopsis thaliana, overexpression miR319 (jaw-D mutants) lead the late flowering in Arabidopsis thaliana (Schommer et al., 2008). [score:3]
Very similar leaf phenotypes were observed in transgenic rice/bentgrass overexpressing osa-miR319 (Yang et al., 2013; Zhou et al., 2013; Zhou and Luo, 2014). [score:3]
Sequence and expression differences underlie functional specialization of Arabidopsis microRNAs miR159 and miR319. [score:3]
Regulation of LANCEOLATE by miR319 is required for compound-leaf development in tomato. [score:3]
Overexpression of microRNA319 impacts leaf morphogenesis and leads to enhanced cold tolerance in rice (Oryza sativa L. ). [score:2]
As a highly conserved ancient miRNA, miR319 plays important roles in plant development (Jones-Rhoades et al., 2006; Yang et al., 2013; Zhou et al., 2013; Zhou and Luo, 2014). [score:2]
Pvi-MIR319a -overexpressing transgenic rice lines were used to investigate the role of miR319 in plant morphological development. [score:2]
Those results suggest that the function of miR319 in flowering may conservative, and it deserves study deeper in the future. [score:1]
Although the role of miR319 in leaf morphogenesis is highly conserved, there are several differences in leaf phenotype between dicotyledonous and monocotyledonous plants. [score:1]
Furthermore, other researchers suggested that osa-miR319b may play a role in the response to cold stress via control of OsPCF6 and OsTCP21 (Wang et al., 2014). [score:1]
Based on the miRNA database [6], two members (Osa-miR319a and Osa-miR319b) of the rice miR319 family have common mature miRNA sequences (Yang et al., 2013). [score:1]
FIGURE S1 | The information of Pvi-MIR319 sequence. [score:1]
We could use the known information of the rice miR319 to identify and clone its homologs in switchgrass. [score:1]
Using the stem-loop sequences of the rice miR319 precursor genes as a reference, we found an EST (ID: FL985594) with a length of 748 bp from switchgrass (P. virgatum) by BLAST search [7] (Supplementary Figure S1). [score:1]
These results suggest that the function of miR319 in leaf morphogenesis is high conversed in grass family (Poaceae). [score:1]
Almost all TCP family members with miR319 -binding sites belong to the CIN subgroup, including OsPCF5 (Yang et al., 2013). [score:1]
Based on the highly conserved roles of miR319, we hypothesize that Pvi-MIR319a may play a similar role in leaf morphogenesis and lead to similar leaf phenotypes in monocotyledonous plants (Yang et al., 2013; Zhou et al., 2013). [score:1]
High levels of Osa-miR319 in transgenic rice led to wider leaf blades and significantly enhanced cold tolerance in acclimated transgenic plants (Yang et al., 2013). [score:1]
However, few studies have examined the roles played by several important microRNAs, such as miR319, in switchgrass. [score:1]
The miR319 sequences from rice and switchgrass showed that the two mature regions were in complete agreement (Supplementary Figure S2). [score:1]
In plants, microRNA319 (miR319) is one of the most conserved and ancient microRNA families, which was found in diverse plant species from moss to flowering plants (Palatnik et al., 2003, 2007; Pandey and Baldwin, 2007; Cuperus et al., 2011). [score:1]
[1 to 20 of 30 sentences]
3
[+] score: 38
Overexpression of miR319 in Chinese cabbage not only led to altered leaf development, also the cabbage heads were rounder than in cabbage with low miR319 expression and higher expression of its target gene BrpTCP4-1 (Mao et al., 2014). [score:10]
Overexpression of miR319 in the monocot Agrostis stolonifera (creeping bentgrass) leads to downregulation of class II TCPs and to the formation of wider and thicker leaves that are different from the wild type (Zhou et al., 2013). [score:6]
Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. [score:4]
Regulation of LANCEOLATE by miR319 is required for compound-leaf development in tomato. [score:3]
Also, miR319 overexpressing tomato leaves grow 3 months longer than wild type leaves and show the marks of late differentiation, which is a behavior that is identical to Arabidopsis jaw-D plants (Ori et al., 2007; Efroni et al., 2008). [score:3]
Overexpression of the tomato miR319 led to flowering with fewer leaves than in wild type tomato and it was shown that LA binds to the promoters of the tomato APETALA1 and FRUITFUL orthologs (Burko et al., 2013). [score:3]
La mutants exhibit simple leaves, whereas overexpression of miR319 without LA insensitivity to the microRNA leads to increased partitioning of the compound leaves. [score:3]
Control of jasmonate biosynthesis and senescence by miR319 targets. [score:3]
Nag et al. (2009) showed that this depends on miR319 regulation of TCP4. [score:2]
An ortholog of the Arabidopsis miR319-sensitive TCPs in tomato is LA and it is under the control of the tomato miR319 (Ori et al., 2007). [score:1]
[1 to 20 of 10 sentences]
4
[+] score: 30
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-124-1, hsa-mir-124-2, mmu-mir-34a, osa-MIR169a, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, cel-mir-354, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, mtr-MIR169a, mtr-MIR319a, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR168a, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, hsa-mir-519b, ppt-MIR319a, ppt-MIR319b, ppt-MIR319c, ppt-MIR319d, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR169f, mtr-MIR319b, mtr-MIR168a, mtr-MIR169g, mtr-MIR169h, mtr-MIR169b, ppt-MIR319e, osa-MIR169r, mtr-MIR159a, mtr-MIR169k, mtr-MIR169j, mtr-MIR159b, ptc-MIR169ag, mtr-MIR169i, mtr-MIR319c, mtr-MIR319d, mtr-MIR169l
We also examined the target conservation of the miRNA-like RNAs on miR159a and miR319b precursors across Arabidopsis, a dicotyledonous plant, and rice, a monocotyledonous plant. [score:3]
As shown, several miRNA-like RNAs, particularly those expressed at a relatively abundant level, are more conserved than their flanking sequences except their cognate miRNAs or miRNA*s. For example, the sequences of miR319b. [score:3]
miR159 and miR319 belong to the same MIR family based on their evolutionary origin [30, 44], playing important roles in plant development [47]. [score:2]
2* and miR319.1/miR319b. [score:1]
1*); specifically, miR319a, miR319a*, miR319b. [score:1]
2 AATGAATGATGCGAGAGACAA 491 1,2 miR319b. [score:1]
Figure 6a displays the miR159a precursors in Arabidopsis, rice, Medicago and Populus and Figure 6b shows the miR319b precursors in Arabidopsis, rice, moss and Medicago. [score:1]
2* have a comparable level of conservation to miR319b* (that is, miR319b. [score:1]
2 and miR319b. [score:1]
Importantly, a close inspection showed that many individual miRNA-like RNAs on the miR159 and miR319 precursors are also highly conserved at the sequence level. [score:1]
For example, miR319b. [score:1]
This is consistent with the recent discovery that the DCL cleavage that produces mature miR159 and miR319 starts from the loop ends of their fold-back structures [45, 46]. [score:1]
Note that miRNA-miRNA* duplexes for miRNA-like RNAs, with approximately two-nucleotide 3'-end overhangs, appear on the miR159, miR169m and miR319b precursors. [score:1]
In the five plant species we studied, miRNA-like RNAs appeared in two well-conserved miRNA families, that is, miR159 and miR319 (Table 2). [score:1]
1* GAGCTTTCTTCGGTCCACTC 28 miR319b. [score:1]
2 has 491 reads while miR319b (that is, miR319b. [score:1]
Furthermore, most of these miRNA-like RNAs, including miR319b. [score:1]
miRNA-like RNAs appeared in miR319 precursors in all of these five plants, and miRNA-like RNAs occurred in miR159 precursors in all of five bar moss. [score:1]
Examples include MIR159a, MIR319a and MIR319b in Figures 1a,c,d, respectively. [score:1]
Another interesting observation is that not every slot in the phasing pattern of a precursor was filled by sequencing reads, as shown in MIR319b and MIR839 (Figures 1d and 4a). [score:1]
Some of these miRNA-like RNAs from conserved miRNA families, that is, miR159 and miR319 in plants, are conserved at the sequence level (Figure 7), which adds another layer of evidence that these miRNA-like RNAs are potentially functionally important in plants. [score:1]
1* (that is, miR319/miR319b*) in four plants, Arabidopsis, rice, Medicago and P. trichocarpa (ptc). [score:1]
1 TTGGACTGAAGGGAGCTCCCT 27 miR319b + miR319b. [score:1]
2* and miR319b. [score:1]
2, and miR319b. [score:1]
[1 to 20 of 25 sentences]
5
[+] score: 27
Of the 21 common targets, most were conserved transcription factors for ancient miRNAs, including SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPLs) protein coding genes targeted by miR156/miR529, ARFs targeted by miR160, TCPs targeted by miR319, and MYBs targeted by miR159. [score:11]
Particularly, some known miRNAs, i. e., osa-miR1876 and osa-miR5150, were abundantly expressed in rice seed but were not detected in other tissues, and osa-miR159f, osa-miR166l, and osa-miR319b were predominantly expressed in the seed, which suggested the pivotal regulatory roles of these miRNAs in seed germination. [score:6]
Additionally, miR164 and miR319 are important for organ morphogenesis by targeting NAM, ATAF1/2 and CUC2 domain-containing proteins (NAC) and TEOSINTE BRANCHED1/CYCLOIDEA/PROLIFERATING (TCP) transcription factor families, respectively [12, 13]. [score:3]
In this study, osa-miR319 and osa-miR156abcdejl showed high abundance, but miR160abe was relatively low-expressed in all three libraries. [score:3]
By repressing TCPs, miR319 played a central role in coordinating multiple miRNAs (i. e., miR396 and miR164) and phytohormones (including auxin, ABA and GA) pathways to control lateral organ development [44, 45]. [score:2]
In particular, miR319, miR168, miR156, miR166, and miR159 were mapped with more than 10,000 reads (S1 Fig). [score:1]
S2 Fig Lanes 3–19 are the 17 known rice miRNAs: osa-miR156abcei, osa-miR156dj, osa-miR160e, osa-miR166j, osa-miR167abc, osa-miR168a, osa-miR171bcde, osa-miR171h, osa-miR319b, osa-miR390, osa-miR535, osa-miR820abc, osa-miR1428e, osa-miR1862abc, osa-miR1882e, osa-miR1883a, and osa-miR5150. [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 17
More complicatedly, the target genes of osa-miR319, LOC_Os03g57190 and LOC_Os07g05720, encode transcription factors belonging to TCP family, which was demonstrated to positively regulate the expression of miR164 at the transcriptional level in Arabidopsis [31]. [score:6]
Another interesting finding is that different from rice, in which miR159 and miR319 regulate distinct sets of target genes separately (MYB and TCP genes, respectively), miR159 and miR319 in Arabidopsis share an overlapping set of targets. [score:6]
Previous study indicates that although the sequences of miR159 and miR319 show high identity with each other, these two miRNA species possess specialized functions by regulating distinct sets of targets, i. e. MYB and TCP genes, separately [32]. [score:4]
Figure 6 osa-miR159-, osa-miR319-, osa-miR164-, and osa-miR395-involved subnetworks. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 16
Overexpression of miR319 caused plants to stay green much longer while compromised miR319 -dependent regulation of one of its main targets, TCP4, resulted in increased expression of genes that are normally active in older leaves [11]. [score:8]
In addition, many other targets, such as WRKY transcription factor 54, Vacuolar-sorting receptor 6, subtilisin, myb and scarecrow-like protein, targeted by osa-miR1851, PC-3p-35500_181, osa-miR5809, osa-miR319, osa-miR159 and osa-miR171, were reported to be involved in senescence [59]- [62] and were identified in the present study (Table 3, Table S5). [score:5]
Another miRNA, miR319, targeting TB1, CYC and PCF (TCP), has crucial function in repressing the onset of senescence. [score:3]
[1 to 20 of 3 sentences]
8
[+] score: 15
Other miRNAs from this paper: osa-MIR319a, sbi-MIR319a, sbi-MIR319b
Whereas, motif 12, representing the target region of miR319, is specific to class II proteins and was detected in 15 TCP proteins (BdTCP4, OsTCP21, SbTCP3, SbTCP1, PCF6, BdTCP1, AtTCP24, AtTCP2, BdTCP14, PCF8, SbTCP18, AtTCP3, AtTCP4, BdTCP5 and PCF5) indicating the possibility of miRNA -mediated regulation of class II proteins. [score:4]
Both SbTCP1 and 3 contain target region of miR319 (motif 12) indicating conserved miRNA -mediated regulation of the orthologous genes in Sorghum as well. [score:4]
Both the genes in Arabidopsis and rice are regulated by miR319 and implicated in organ development and cold stress response, respectively. [score:3]
MEME motif analysis revealed that SbTCP7 contained the motif 12 that corresponds to miR319 binding site, suggesting that SbTCP7 might also be involved in regulation of abiotic stresses in Sorghum through similar mechanism as in rice. [score:2]
Negative regulation of PCF5 through miR319 confers increased tolerance against drought and salinity stress in rice 35 36. [score:2]
[1 to 20 of 5 sentences]
9
[+] score: 14
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR444a, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
A qRT-PCR -based assay for the expression of miRNAs under Cd stress in M. truncatula found that miR393, miR171, miR319, and miR529 were up-regulated, whereas miR166 and miR398 were down-regulated [16]. [score:8]
In M. truncatula, miR393, miR171, miR319, and miR529 were up-regulated, whereas miR166 and miR398 were down-regulated in response to Cd treatment as determined by a qRT-PCR -based assay [16]. [score:6]
[1 to 20 of 2 sentences]
10
[+] score: 13
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR810a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR529b, osa-MIR1425, osa-MIR1430, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR810b, osa-MIR1440a, osa-MIR531b, osa-MIR1847, osa-MIR1848, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR1865, osa-MIR812f, osa-MIR1874, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1320, osa-MIR827, osa-MIR2090, osa-MIR396f, osa-MIR2118c, osa-MIR2863a, osa-MIR2863b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3979, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR3981, osa-MIR5082, osa-MIR2863c, osa-MIR5337a, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1440b, osa-MIR818f, osa-MIR1861o
Moreover, the expression patterns of miR319, miR166, miR810, and miR1861 were in agreement with our study [21]. [score:3]
Interestingly, the expressions of miR171 and miR319 were not only increased, but also repressed during drought stress. [score:3]
Among them, 7 miRNAs, including miR156, miR168, miR169, miR171, miR319, miR396, and miR397 had the same expression pattern in our study. [score:3]
High-throughput sequencing technology has identified miRNAs from Dongxiang wild rice, and 33 differentially expressed miRNAs responded to drought stress, including miR164c, miR319b, miR444, miR166h-5p, miR172d-5p, miR167h-3p, miR160f-5p, etc. [score:3]
Nine miRNAs, including miR408, miR810, miR319, miR2863, miR444, miR166, miR167, miR818, and miR1861 were also detected in our study. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR440, osa-MIR396e, osa-MIR528, osa-MIR529a, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR1428a, osa-MIR169r, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1866, osa-MIR1862d, osa-MIR1862e, osa-MIR1877, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR2275a, osa-MIR2275b, osa-MIR2871a, osa-MIR2871b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1862f, osa-MIR1862g, osa-MIR2863c, osa-MIR5159, osa-MIR5337a, osa-MIR5485, osa-MIR2275c, osa-MIR2275d, osa-MIR5337b
For example, a genome-wide study conducted across different developmental stages of rice revealed that 16 miRNAs, including miR156, miR159 and miR168, were downregulated by drought stress, while 14 miRNAs, such as miR169, miR319 and miR395, were upregulated [42]. [score:8]
For example, miR167, miR393, miR396, miR529 have been shown to be regulated by drought stress [25, 42, 59], miR393 and miR396 were shown to be regulated by cold stress [25, 42, 59], and miR159, miR160, miR319, miR394, miR528, and miR530 were shown to be regulated by salt stress [25, 29, 59- 61]. [score:4]
[1 to 20 of 2 sentences]
12
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
In Arabidopsis, miR156, miR158, miR159, miR165, miR167, miR168, miR169, miR171, miR319, miR393, miR394, miR396, and miR397 are up-regulated by salt stress while the expression of miR398 is down-regulated (Liu et al., 2008). [score:9]
A great number of miRNAs, for example, miR396, miR168, miR167, miR165, miR319, miR159, miR394, miR156, miR393, miR171, miR158, and miR169 have been identified to be regulated by drought in Arabidopsis (Liu et al., 2008). [score:2]
In rice, 14 miRNAs (miR159, miR169, miR171, miR319, miR395, miR474, miR845, miR851, miR854, miR896, miR901, miR903, miR1026, and miR1125) are significantly induced while 16 miRNAs are significantly repressed by drought (Zhao et al., 2007; Zhou et al., 2010). [score:1]
[1 to 20 of 3 sentences]
13
[+] score: 10
Other miRNAs from this paper: osa-MIR319a, bra-MIR319
Bresso E. G. Chorostecki U. Rodriguez R. E. Palatnik J. F. Schommer C. Spatial Control of Gene Expression by miR319-Regulated TCP Transcription Factors in Leaf DevelopmentPlant Physiol. [score:5]
AtTCP2, AtTCP3, AtTCP4, AtTCP10, and AtTCP24 of the CIN subfamily were the targeted genes of miR319, and they modulate leaf development in Arabidopsis [12, 13, 18, 29]. [score:4]
Most of the CIN subfamily members were the taget genes of miR319, such as BrTCP2, BrTCP3, BrTCP4, BrTCP10, and BrTCP24. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR396f, osa-MIR395x, osa-MIR395y, osa-MIR3980a, osa-MIR3980b, osa-MIR5794
Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. [score:4]
For example, miR319 positively regulates plant response to drought and salinity stress (Zhou et al., 2013). [score:2]
These miRNA families include the three conserved miRNA families, miR166, miR169, and miR319, which have been confirmed to play pivotal roles in other stresses (Zhou et al., 2010; Ni et al., 2013; Li Y. et al., 2014). [score:1]
2-3p LOC_Os12g42190 Transposon protein osa-miR319b LOC_Os12g42190 Transposon protein osa-miR169a/h/j/k/l/m LOC_Os12g42400 Nuclear transcription factor Y subunit osa-miR169i-5p. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 8
For instance, miR397 overexpression was described to improve rice yield by increasing grain size and promoting panicle branching (Zhang et al. 2013), whereas rice plants overexpressing miR319 had wider leaf blades and enhanced cold tolerance (Yang and Huang 2014). [score:5]
While auxin signalling pathway is regulated by miR160, miR167, miR390 and miR393, the JA biosynthetic pathway is under the control of miR319 and miR159, and miR159 regulate the ABA signalling pathway (Curaba et al. 2014). [score:3]
[1 to 20 of 2 sentences]
16
[+] score: 8
Four miRNAs (miR159, miR165/166, miR319) participate in regulation of various developmental processes by targeting the GAMYB, Homeodomain Leucine Zipper (HD-ZIP) and TCP transcription factors in Arabidopsis, respectively (Millar and Waterhouse, 2005; Jones-Rhoades et al., 2006; Mallory and Vaucheret, 2006; Jung et al., 2009; Rubio-Somoza and Weigel, 2011). [score:5]
Sliced microRNA targets and precise loop-first processing of MIR319 hairpins revealed by analysis of the Physcomitrella patens degradome. [score:3]
[1 to 20 of 2 sentences]
17
[+] score: 7
It was reported that miR396, miR168, miR167, miR165, miR319, miR159, miR394, miR156, miR393, miR171, miR158, and miR169 were up-regulated in salt stress in Arabidopsis (Liu et al., 2008), while Ath-miR398 was down-regulated under salt stress (Jagadeeswaran et al., 2009). [score:7]
[1 to 20 of 1 sentences]
18
[+] score: 6
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR394a, ath-MIR394b, ath-MIR396a, ath-MIR396b, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, ath-MIR403, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR396e, ath-MIR856, ath-MIR858a, osa-MIR169r, osa-MIR396f, ath-MIR2111a, ath-MIR2111b, osa-MIR396g, osa-MIR396h, osa-MIR396d, ath-MIR858b, ath-MIR156i, ath-MIR156j
Further targets were predicted for certain more conserved miRNAs including miR166, miR167, miR319, miR 396 and miR408, miR856 and miR1310 (Additional file 2 Table S1). [score:3]
miR156, miR159, miR167, miR319, miR396 and miR172 possessed 5, 8, 10, 8, 7 and 6 members respectively whereas other miRNA families such as miR157, miR160, miR169, miR858, miR894, miR2111 etc. [score:1]
Most of the miRNA families were found to be conserved in a variety of plant species e. g. using a comparative genomics based strategy homologs of miR319, miR156/157, miR169, miR165/166, miR394 and miR159 were found in 51,45,41,40,40 and 30 diverse plant species respectively [38]. [score:1]
In addition, miR167 and miR394 were found to have some thousands to tens of thousands of redundancies while miR319, miR166 and miR156 had more than one hundred redundancies. [score:1]
[1 to 20 of 4 sentences]
19
[+] score: 5
For example, a study identified 18 cold-responsive rice miRNAs, including miR167 and miR319, using a microarray approach on a single variety (14), and most of the differentially regulated genes were down-regulated in a cold -treated environment. [score:5]
[1 to 20 of 1 sentences]
20
[+] score: 5
Other miRNAs from this paper: osa-MIR319a
Schommer C. Palatnik J. F. Aggarwal P. Chetelat A. Cubas P. Farmer E. E. Nath U. Weigel D. Control of Jasmonate Biosynthesis and Senescence by miR319 TargetsPLoS Biol. [score:3]
In addition, a recent study showed that miR319-controlled TCP transcription factors were involved in regulating JA content and leaf senescence [55]. [score:2]
[1 to 20 of 2 sentences]
21
[+] score: 5
Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. [score:4]
Several genes, such as ZmSNAC1 (Lu et al., 2012), TaNAC69 (Xue et al., 2011), CarNAC3 (Peng et al., 2009), miR319, AsNAC60 (Zhou et al., 2013), AhNAC2 (Liu et al., 2011), RhNAC2 or RhEXPA4 (Dai et al., 2012), ClNAC (Huang et al., 2012), CsNAM (Paul et al., 2012), SiNAC (Puranik et al., 2011), HSImyb and HSINAC (Robertson, 2004), and TaNAC2a, TaNAC4a, TaNAC6, and TaNAC4 (Tang et al., 2012; Xia et al., 2010a), were increased by drought and NaCl (Figure 5; Table 2). [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 5
We found that At2g33810 in the At2g33810/At2g33815 pair was a target of miR156 and At1g53230 in the At1g53230/At1g53233 pair was a target of miR319. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR827, osa-MIR396f, bdi-MIR171a, bdi-MIR167a, bdi-MIR397a, bdi-MIR156a, bdi-MIR172d, bdi-MIR166a, bdi-MIR171c, bdi-MIR169b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, bdi-MIR169d, bdi-MIR169i, bdi-MIR395a, bdi-MIR169j, bdi-MIR166f, bdi-MIR171b, bdi-MIR390a, bdi-MIR160a, bdi-MIR528, bdi-MIR395b, bdi-MIR166d, bdi-MIR171d, bdi-MIR167b, bdi-MIR166b, bdi-MIR160b, bdi-MIR164b, bdi-MIR167c, bdi-MIR396d, bdi-MIR169k, bdi-MIR168, bdi-MIR160c, bdi-MIR396c, bdi-MIR167d, bdi-MIR156b, bdi-MIR169g, bdi-MIR160d, bdi-MIR160e, bdi-MIR396e, bdi-MIR156c, bdi-MIR172a, bdi-MIR396a, bdi-MIR166e, bdi-MIR166c, bdi-MIR169e, bdi-MIR394, bdi-MIR398a, bdi-MIR164a, bdi-MIR393a, bdi-MIR169a, bdi-MIR172b, bdi-MIR156d, bdi-MIR393b, bdi-MIR169h, bdi-MIR396b, bdi-MIR169c, bdi-MIR395c, bdi-MIR827, bdi-MIR166g, bdi-MIR319a, bdi-MIR395d, bdi-MIR398b, bdi-MIR164c, bdi-MIR169f, bdi-MIR162, bdi-MIR164e, bdi-MIR164f, bdi-MIR395m, bdi-MIR395e, bdi-MIR395f, bdi-MIR395g, bdi-MIR395h, bdi-MIR395j, bdi-MIR395k, bdi-MIR395l, bdi-MIR395n, bdi-MIR529, bdi-MIR319b, bdi-MIR397b, bdi-MIR156e, bdi-MIR156f, bdi-MIR156g, bdi-MIR156h, bdi-MIR156i, bdi-MIR166h, bdi-MIR166i, bdi-MIR167e, bdi-MIR395o, bdi-MIR395p, bdi-MIR156j, bdi-MIR160f, bdi-MIR166j, bdi-MIR167f, bdi-MIR167g, bdi-MIR169l, bdi-MIR169m, bdi-MIR169n, bdi-MIR171e, bdi-MIR171f, bdi-MIR395q
The miR160a, miR164d, miR169f, miR172a, miR172b, miR319, miR390, miR393, miR394, miR395a, miR397a, miR529 and miR827 were moderately expressed, and were represented by the number of sequences varying between 10 and 100. [score:3]
Some miRNAs, including miR166, miR319, miR393, and miR396, respond to cold stress in Arabidopsis [16, 17], but in our experiment no obvious change was found for these miRNAs after the cold treatment. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169j, osa-MIR169m, osa-MIR171d, osa-MIR171f, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, osa-MIR444a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820c, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1441, osa-MIR1846b, osa-MIR1882e, osa-MIR1883b, osa-MIR1846e, osa-MIR396f, osa-MIR2120, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2879, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR5158, osa-MIR5143b, osa-MIR5835, osa-MIR7693, osa-MIR7695
In detail, osa-MIR1883b, osa-MIR319b, osa-MIR1846b, and osa-MIR1882e were down-regulated at 7 dpi. [score:4]
[1 to 20 of 1 sentences]
25
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR414, osa-MIR419, osa-MIR435, osa-MIR390, osa-MIR396e, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1426, osa-MIR169r, osa-MIR1436, osa-MIR1440a, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ctr-MIR156, ctr-MIR166, ctr-MIR319, ctr-MIR164, ctr-MIR167, ctr-MIR171, osa-MIR395x, osa-MIR395y, osa-MIR1440b
We also found homologs of known miRNA target genes for several conserved C. trifoliata miRNAs, such as SBP for miR156, ATP synthase for miR159, ARF for miR160, NAC for miR164, HD-Zip for miR165 and miR166, Anthocyanidin synthase for miR169, GRAS for miR171, AP2 for miR172, TCP for miR319, TIR for miR393, F-box for miR394, Sulfate transporter 2.1 for miR395, IRX12 copper ion binding/oxidoreductase for miR397, ARGONAUTE 2 for miR403, Basic blue copper protein for miR408 and Zinc finger protein-related for miR414. [score:3]
For example, miR319, miR156/157, miR169, miR165/166, and miR394 have been found in 51, 45, 41, 40, and 40 plant species, respectively [9]. [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 4
Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. [score:4]
[1 to 20 of 1 sentences]
27
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169f, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319b, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169f, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, osa-MIR529a, tae-MIR159a, tae-MIR159b, tae-MIR171a, tae-MIR1120a, osa-MIR1430, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR166n, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR397a, zma-MIR397b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, hvu-MIR168, hvu-MIR171, hvu-MIR397a, tae-MIR171b, hvu-MIR1120, hvu-MIR166b, osa-MIR3981, hvu-MIR166c, tae-MIR1120b, tae-MIR397, tae-MIR1120c, hvu-MIR397b, hvu-MIR156b
The expression profiles of miRNA168-5p/168-3p in particular developmental stages also differed, which may suggest a functional role of both miRNA species, as was reported for miR319b and miR319b. [score:4]
[1 to 20 of 1 sentences]
28
[+] score: 4
A similar study showed that miR156, miR166, miR171, miR172, miR319, miR164 along with their target genes, were differentially expressed in stress-tolerant maize hybrids compared with stress-sensitive lines [52]. [score:4]
[1 to 20 of 1 sentences]
29
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5083, ppe-MIR171f, ppe-MIR394a, ppe-MIR828, ppe-MIR171h, ppe-MIR171a, ppe-MIR171e, ppe-MIR169e, ppe-MIR319a, ppe-MIR319b, ppe-MIR171g, ppe-MIR171b, ppe-MIR171c, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR159, ppe-MIR160a, ppe-MIR160b, ppe-MIR162, ppe-MIR164a, ppe-MIR164b, ppe-MIR164c, ppe-MIR164d, ppe-MIR166a, ppe-MIR166b, ppe-MIR166c, ppe-MIR166d, ppe-MIR166e, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR168, ppe-MIR169a, ppe-MIR169b, ppe-MIR169c, ppe-MIR169d, ppe-MIR169f, ppe-MIR169g, ppe-MIR169h, ppe-MIR169i, ppe-MIR169j, ppe-MIR169k, ppe-MIR169l, ppe-MIR171d, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR390, ppe-MIR393a, ppe-MIR393b, ppe-MIR394b, ppe-MIR396a, ppe-MIR396b, ppe-MIR397, ppe-MIR399a, ppe-MIR399b, ppe-MIR399c, ppe-MIR399d, ppe-MIR399e, ppe-MIR399f, ppe-MIR399g, ppe-MIR399h, ppe-MIR399i, ppe-MIR399j, ppe-MIR399k, ppe-MIR399l, ppe-MIR399m, ppe-MIR399n, ppe-MIR403, ppe-MIR827, ppe-MIR858
The expression of 8 conserved (miR166, miR168, miR319, miR394, miR399, miR827, miR894 and miR5139) and six novel miRNAs (miRC1, miRC14, miRC16, miRC112, miRC179 and miRC181) showed no significant change in different tissues (Figs. 5A and 5B). [score:3]
Among the miRNA families in peach, miR156, miR159, miR160, miR166, miR171, miR319, miR390 and miR396 showed a high conservation in plants, indicating that these 12 peach miRNA families are ancient. [score:1]
[1 to 20 of 2 sentences]
30
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR528, osa-MIR529a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR815c, osa-MIR818d, osa-MIR529b, osa-MIR1425, osa-MIR1428a, osa-MIR169r, osa-MIR1436, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1858a, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR812f, osa-MIR1862d, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1428f, osa-MIR1428g, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR812n, osa-MIR812o, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1861o
MiR159, miR319, miR812, and miR819 target gene transcripts coding MYB family transcription factor (MYB), TCP family transcription factor (TCP), 1-aminocyclopropane-1-carboxylate oxidase protein (ACC), and BRASSINOSTEROID INSENSITIVE 1 -associated receptor kinase 1 precursor (BAK1), which are involved in the regulation of ABA, jasmonic acid, ethylene, and brassinosteroid homeostasis, respectively [21], [54], [60]. [score:4]
[1 to 20 of 1 sentences]
31
[+] score: 4
High-throughput sequencing of miRNAs showed that 14 rice miRNA families (osa-miR156, miR160, miR164, miR166, miR167, miR168, miR171, miR319, miR396, miR397, miR408, miR528, miR530, miR820) were significantly down-regulated after drought treatment [23]. [score:4]
[1 to 20 of 1 sentences]
32
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR166c, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160f, osa-MIR164d, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR419, osa-MIR390, osa-MIR444a, osa-MIR528, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR529b, osa-MIR1425, osa-MIR1429, osa-MIR1431, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR1441, osa-MIR531b, osa-MIR1846d, osa-MIR1848, osa-MIR1850, osa-MIR1853, osa-MIR1860, osa-MIR812f, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1319a, osa-MIR2096, osa-MIR2864, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3979, osa-MIR812n, osa-MIR812o, osa-MIR5161, osa-MIR5338, osa-MIR5512a, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1319b, osa-MIR5512b, osa-MIR818f
However, over -expression of miR319, a sequence highly similar to miR159, decreases the levels of TCP transcription factors, then delays flowering in long days, stamen morphogenesis, and causes abortive stamens [22]. [score:3]
In addition, the read numbers of miR169b,c, miR319, miR818d, oru-miR117, oru-miR135, oru-miR139, and oru-miR180 were highest in CWR-F2. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166d, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR396e, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818b, osa-MIR169r, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
In addition, miR171 and miR319 expression is either increased or repressed, depending on the specific drought conditions [15]. [score:3]
[1 to 20 of 1 sentences]
34
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR164f, osa-MIR390, osa-MIR439a, osa-MIR439b, osa-MIR439c, osa-MIR439d, osa-MIR439e, osa-MIR439f, osa-MIR439g, osa-MIR439h, osa-MIR439i, osa-MIR396e, osa-MIR444a, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR171a, tae-MIR399, tae-MIR408, tae-MIR444a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, tae-MIR156, tae-MIR319, tae-MIR167b, tae-MIR169, tae-MIR444b, tae-MIR171b, tae-MIR396, tae-MIR167c, tae-MIR397
Some of these miRNA families (for example, miR319, miR390, and miR165/166) are conserved deeply, including in lower plants such as Physcometrella [26- 28]. [score:1]
MiR169 was represented by five members, miR156, miR165/166, miR167, miR170/171 and miR172 were represented by three members each, and miR159, miR319 and miR168 were represented by two members each in the library. [score:1]
These include miRNA156/157, miR159, miR160, miR164, miR165/166, miR167, miR168, miR169, miR170/171, miR172, miR319, miR390, miR393, miR396, miR397, miR399 and miR408, which are conserved in diverse plant species (Table 2). [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 3
Rice ragged stunt virus (RRSV) and Rice black streaked dwarf virus (RBSDV) infections in rice increase the level of miR319, which suppresses jasmonic acid mediated antiviral defense in rice [10]. [score:3]
[1 to 20 of 1 sentences]
36
[+] score: 3
Previous results showed that overexpression of miR164, miR159a, and miR319 affected members of the NAC, MYB, and TCP families of transcription factor genes, respectively [58– 60]. [score:3]
[1 to 20 of 1 sentences]
37
[+] score: 3
The tissue-specific expression patterns were presented for the conserved miRNAs, miR160, miR167, miR169, miR319, miR390 and miR396, and the less-conserved miRNAs, miR828, miR858 and miR2118 (Figure 2b). [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
Other miRNAs from this paper: osa-MIR319a
For example, the miR319-regulated TCP (TEOSINTE BRANCHED/CYCLOIDEA/PCF) transcription factors regulate the JA biosynthesis gene LOX2, controlling JA content and affecting leaf senescence [47]. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
Other miRNAs from this paper: osa-MIR319a
A recent study in creeping bentgrass showed that overexpressing Osa-miR319 exhibited improved salt and drought tolerance in transgenic plants also with remarkably wider leaves and thicker stems 45 46, but the detailed mechanism still needs to be elucidated. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR444a, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1423, osa-MIR1425, osa-MIR1427, osa-MIR1428a, osa-MIR1429, osa-MIR1430, osa-MIR1431, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR810b, osa-MIR1435, osa-MIR1436, osa-MIR1437a, osa-MIR1440a, osa-MIR1441, osa-MIR1442, osa-MIR1439, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1440b, osa-MIR818f, osa-MIR1437b
Of these, 7 miRNA families, i. e., miR156/157, miR160, miR159, miR319, miR165/166, miR390 and miR408 have been also found in primitive land plants such as Physcometrella and Selaginella suggesting that these are deeply conserved [18- 21]. [score:1]
Similarly, miR319 and miR397 are represented by one member each but represented by two loci in the rice genome. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR435, osa-MIR390, osa-MIR396e, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR162a, ptc-MIR162b, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR393a, ptc-MIR393b, ptc-MIR393c, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR397a, ptc-MIR397b, ptc-MIR397c, ptc-MIR403a, ptc-MIR403b, ptc-MIR408, ptc-MIR477e, ptc-MIR477f, ptc-MIR474a, ptc-MIR474b, ptc-MIR474c, ptc-MIR475a, ptc-MIR475b, ptc-MIR475c, ptc-MIR475d, ptc-MIR476a, ptc-MIR476b, ptc-MIR477a, ptc-MIR477b, ptc-MIR478a, ptc-MIR478b, ptc-MIR478c, ptc-MIR478d, ptc-MIR478e, ptc-MIR478f, ptc-MIR478h, ptc-MIR478i, ptc-MIR478j, ptc-MIR478k, ptc-MIR478l, ptc-MIR478m, ptc-MIR478o, ptc-MIR478p, ptc-MIR478q, ptc-MIR478r, ptc-MIR478s, ptc-MIR478n, ptc-MIR481a, ptc-MIR481b, ptc-MIR481c, ptc-MIR481d, ptc-MIR482a, ptc-MIR171k, ptc-MIR403c, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR477c, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR477d, ptc-MIR482c, ptc-MIR828a, ptc-MIR828b, ptc-MIR403d
miR156/157, miR159 and miR319 are represented by 22 and 38 members respectively and three other families (miR169, miR170/171, miR165/166) are represented by more than 20 members. [score:1]
For families miR156/157, miR159, miR319, miR162, miR172, miR396, miR397, miR473, miR475 and miR482, the number of members identified in this study was at least twice that reported previously [3, 26] (Fig. 2). [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 2
The resolution of northern blots did not permit distinction between family members, so that each band could contain multiple members of a family of miRNAs/miRNA*s. Using clustalW [60], we analyzed the conservation of precursor sequences of miR159, miR319, and miR394 in different plants (Figure S3). [score:1]
The resolution of northern blots did not permit distinction between family members, so that each band could contain multiple members of a family of miRNAs/miRNA*s. Using clustalW [60], we analyzed the conservation of precursor sequences of miR159, miR319, and miR394 in different plants (Figure S3). [score:1]
[1 to 20 of 2 sentences]
43
[+] score: 2
Some novel miRNAs have been reported to regulate the pollen and spikelet fertility, such as miR159, miR172, miR319 and miR397 [20– 23]. [score:2]
[1 to 20 of 1 sentences]
44
[+] score: 2
Similarly, miR319 acts as a positive regulator of cold stress tolerance in rice [22]. [score:2]
[1 to 20 of 1 sentences]
45
[+] score: 1
Other miRNAs from this paper: ath-MIR159a, ath-MIR162a, ath-MIR162b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR162a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR390a, ath-MIR390b, ath-MIR396a, ath-MIR396b, ath-MIR398a, ath-MIR398b, ath-MIR398c, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR159c, ath-MIR319c, osa-MIR156k, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR390, osa-MIR396e, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR162a, ptc-MIR162b, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR398b, ptc-MIR398c, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR408, ptc-MIR482a, ptc-MIR171k, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1448, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR169ag, ptc-MIR482b, ptc-MIR482c, pde-MIR159, pde-MIR162, pde-MIR166a, pde-MIR166b, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR482a, pde-MIR482b, pde-MIR482c, pde-MIR482d, pde-MIR946, pde-MIR947, pde-MIR949a, pde-MIR950, pde-MIR951, pde-MIR952a, pde-MIR952b, pde-MIR952c, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR3701, pde-MIR3704a, pde-MIR3704b, pde-MIR3712
Three P. taeda miRNA families, including pta-MIR319, pta-MIR398 and pta-MIR408, were not found in P. densata. [score:1]
[1 to 20 of 1 sentences]
46
[+] score: 1
The maximum miRNA representation at up to 21 was observed in the miR166 family, and it was followed by 12 miRNAs in the miR396 family, 11 miRNAs each in the miR159 and miR319 miRNA families, and ten miRNAs in the miR156/157 family. [score:1]
[1 to 20 of 1 sentences]
47
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
MicroRNA chip experiments showed that eight miRNAs (miR156/157, miR167, miR168, miR319, miR159, miR894, miR1507, and miR1509) were induced by Pi starvation in soybean leaves, and seven miRNAs (miR159, miR894, miR1507, miR1509, miR396, miR474, and miR482) were induced in soybean roots by low P [31]. [score:1]
[1 to 20 of 1 sentences]
48
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR810a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR820a, osa-MIR1423, osa-MIR1425, osa-MIR1432, osa-MIR169r, osa-MIR810b, osa-MIR1436, osa-MIR1441, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR812f, osa-MIR1873, osa-MIR1862d, osa-MIR1862e, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR827, osa-MIR396f, osa-MIR2873a, osa-MIR2878, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR1862f, osa-MIR1862g, osa-MIR812n, osa-MIR812o, osa-MIR2873b, osa-MIR5071, osa-MIR5074, osa-MIR5075, osa-MIR5077, osa-MIR5080, osa-MIR5081, osa-MIR5144, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR5795, osa-MIR812s, osa-MIR5802, osa-MIR812t, osa-MIR812u, osa-MIR5805, osa-MIR812v, osa-MIR5807, osa-MIR2873c, osa-MIR6253, osa-MIR1861o
Of these, 7 miRNA families, namely miR156/157, miR160, miR159, miR319, miR165/166, miR390 and miR408 were found in primitive land plants such as Physcomitrella and Selaginella suggesting that they are highly conserved over wide evolutionary distance [14]. [score:1]
[1 to 20 of 1 sentences]
49
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR418, osa-MIR396e, osa-MIR531a, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR531b, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR531c
of loci miR156 ND d 1 miR159 MYB and TCP TFs e b 2 miR160 ND d 1 miR162 DICER-LIKE 1 b 1 miR164 ND a 1 miR166 HD-Zip TFs f, h, k h, k, n h, n c 9 miR167 Auxin response factors TFs a, d, f j d a 6 miR168 ARGONAUTE b 1 miR169 CCAAT binding factor and HAP2-like TFs n, p c 3 miR171 SCARECROW-like TFs c, e, f c c, d a 7 miR319 ND a 1 miR395 ATP sulphurylases i, j, k 3 miR396 GRF TFs, rhodenase-like, and kinesin-like protein B b 1 miR397 Laccases and beta-6 tubulin a a 2 miR399 Phosphatase TFs e b, e 3 miR418 ND x x 2 miR420 ND x x x 3 miR441 ND b a, b, c c 5 miR442 ND x x x 3 miR446 ND x x x 3 miR531 ND x x 2 miR535 ND x x x x 4 Total no. [score:1]
[1 to 20 of 1 sentences]
50
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
In Arabidopsis, only the miR171 family is divided in two families, and the following miRBase families are pairwise grouped together: MIR319–MIR159, MIR156–MIR157, MIR165–MIR166, and MIR170–MIR171. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, osa-MIR414, osa-MIR437, osa-MIR390, osa-MIR440, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR531a, osa-MIR529b, osa-MIR1425, osa-MIR1427, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR1439, osa-MIR531b, osa-MIR1846d, osa-MIR1848, osa-MIR1850, osa-MIR1846a, osa-MIR1846b, osa-MIR1859, osa-MIR1860, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1863a, osa-MIR1864, osa-MIR1865, osa-MIR1871, osa-MIR1874, osa-MIR1862d, osa-MIR1876, osa-MIR1862e, osa-MIR1878, osa-MIR1879, osa-MIR1319a, osa-MIR1846c, osa-MIR2055, osa-MIR1846e, osa-MIR2096, osa-MIR396f, osa-MIR2106, osa-MIR2120, osa-MIR2275a, osa-MIR2275b, osa-MIR2863a, osa-MIR2863b, osa-MIR2872, osa-MIR2875, osa-MIR2876, osa-MIR2877, osa-MIR2878, osa-MIR1863c, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR1863b, osa-MIR1862f, osa-MIR1862g, osa-MIR3979, osa-MIR3981, osa-MIR5072, osa-MIR5073, osa-MIR5076, osa-MIR5079a, osa-MIR5082, osa-MIR5083, osa-MIR2863c, osa-MIR5150, osa-MIR5151, osa-MIR5155, osa-MIR5160, osa-MIR5161, osa-MIR5162, osa-MIR5484, osa-MIR5504, osa-MIR5505, osa-MIR5513, osa-MIR2275c, osa-MIR2275d, osa-MIR5788, osa-MIR5792, osa-MIR5809, osa-MIR5812, osa-MIR1319b, osa-MIR6246, osa-MIR6250, osa-MIR6253, osa-MIR5079b, osa-MIR531c
osa-miR319 was suggested to be an oxidative stress-responsive miRNA family in rice (Li et al., 2011). [score:1]
[1 to 20 of 1 sentences]