sort by

77 publications mentioning osa-MIR172c

Open access articles that are associated with the species Oryza sativa and mention the gene name MIR172c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 335
We speculate that the additional floret defects observed in plants over -expressing miR172b are due to repression of Os03g60430 by over-expressed miR172 because both SNB and Os03g60430 are relatively highly expressed in developing panicles (Figure 2A, B), they have similar mRNA expression patterns determined by in situ hybridization [24, 29], and Os03g60430 is down-regulated by elevated levels of miR172 in 0.5-4 cm long panicles (Figure 7B). [score:12]
To determine where miR172 and its target transcripts are expressed during rice development, we analyzed miR172 expression by RNA gel blot and expression of the AP2-like target mRNAs by qRT-PCR in various tissues. [score:12]
However, expression of SNB was not inversely correlated with expression of miR172 in wild-type, and over -expressing miR172b did not reduce the expression levels of SNB in <1 cm long panicles where development of spikelets and florets is occurring, instead SNB transcript abundance increased significantly. [score:10]
We characterized the expression of miR172 and its putative AP2-like target genes in rice and did not find inversely correlated expression patterns although at least three of the AP2-like mRNAs were found to be cleavage targets of miR172, suggesting roles of miR172 via transcriptional and translation repression with the latter as a possible predominant mode of action of miR172 in rice. [score:9]
In maize, expression of GLOSSY15 (GL15), an AP2-like gene with an mRNA targeted for cleavage by miR172, is gradually down-regulated during the early stages of vegetative development due to a progressive increase of miR172 levels, promoting the juvenile-to-adult transition [17]. [score:9]
miR172 -mediated cleavage of mRNAs of these target genes has been detected [21], but there is strong evidence to suggest that the primary mode of repression of these target genes by miR172 is translational inhibition [13, 14]. [score:9]
Expression of SNB and Os03g60430 showed an inverse correlation with the abundance of miR172 in two-leaf shoots, leaf four and leaf ten, but generally the expression of miR172 was not inversely correlated with the expression of its targets in the tissues analyzed (Figure 2A, B, C). [score:9]
Expression analysis of the mature miR172 sequences and their precursors in different tissues and developmental stages might help determine where and when each miR172 member is likely to be expressed; however, distinguishing expression of individual miR172 family members using hybridization and PCR -based approaches is difficult because the four miRNAs have few sequence differences. [score:8]
The unchanged or increased abundances of miR172 target mRNAs in the miR172b over -expression plants is reminiscent of observations made in Arabidopsis [13, 21] where there is evidence that miR172 acts to repress translation and for transcription of the AP2-like genes to be under negative feedback regulation via their protein products. [score:8]
Expression of miR172 was not inversely correlated with expression of its targets although miR172 -mediated cleavage of SNB was detected by 5' rapid amplification of cDNA ends (RACE). [score:7]
Our analyses of expression of miR172 and its target mRNAs are consistent with it acting through transcriptional and/or translational repression with the latter as a possible predominant mode of action of miR172 in rice. [score:7]
Analyses of expression of three miR172 targets showed that SUPERNUMERARY BRACT (SNB) and Os03g60430 have high expression in developing panicles. [score:7]
There was not a uniform decrease in the expression of the AP2-like miR172 target mRNAs in the miR172b over -expression plants. [score:7]
These results suggest that timing and/or positioning of the floral organ meristems are interrupted by over -expression of miR172b, indicating that a proper expression of miR172 target genes is important in specification of floral organ identities. [score:7]
In turn, the transcription of miR172 target genes is under direct or indirect feedback regulation by their protein products [21]. [score:6]
These observations are consistent with miR172 functioning via translational repression or with expression of the AP2-like genes being regulated by a negative feedback loop. [score:6]
The phenotypes resulting from over -expression of miR172b suggests it represses SNB and at least one of the other miR172 targets, most likely Os03g60430, indicating roles for other AP2-like genes in rice floret development. [score:6]
A primer pair spanning the miR172 target site was used to quantify expression of the uncleaved target mRNAs. [score:6]
Analysis of miR172 expression showed that plants with the strongest phenotypic aberrations had the highest expression levels of miR172 (Figure 4). [score:5]
Higher expression of miR172 in later stage vegetative tissues and developing young panicles is consistent with a role in regulating the timing of floret initiation and development in rice. [score:5]
Our data showed that both miR172 and SNB are highly expressed in <1 cm long panicles, so miR172 could be acting to restrict the expression domain of SNB. [score:5]
This could be a result of spatiotemporal expression differences between individual members of the miR172 family, or their targets, but does not rule out the possibility that only MIR172e is functional. [score:5]
These results suggested tissue- or cell-type-specific expression of miR172 and/or its target genes. [score:5]
This is a result of repression of SNB and at least one of the other four target genes, most likely Os03g60430, by the elevated levels of miR172 in plants over -expressing miR172b. [score:5]
Analysis of miR172 expression showed that it is most highly expressed in late vegetative stages and developing panicles. [score:5]
Expression profiles of miR172 and its target genes. [score:5]
To determine whether these rice AP2-like genes are regulated by miR172 and investigate the function of the target genes, we studied the effect of over -expressing two members of the miR172 family on rice plant development. [score:5]
miR172 and the AP2-like genes had overlapping expression patterns in rice and their expression did not show an obvious negative correlation. [score:5]
Figure 7 qRT-PCR analyses of miR172 target genes in panicles of wild-type and miR172b over -expression plants. [score:5]
In Arabidopsis, both loss-of-function ap2 mutants and miR172 over -expression plants have carpels in place of perianth organs (sepals and petals) due to the absence of AP2 and ectopic expression of AGAMOUS (AG), a class C gene, in the outer two whorls of the flower primordium [13, 14]. [score:5]
These phenotypes not only recapitulated but enhanced the mutant phenotypes of SNB, suggesting that SNB and at least one of the other four targets of miR172 were repressed in plants over -expressing miR172b. [score:5]
miR172 has been shown to cleave AP2 and AP2-like target mRNAs in Arabidopsis [13, 14, 21] and maize [15, 17], but is thought to act predominantly through translational repression [13- 15]. [score:5]
miR172 is conserved in higher plants and has been shown to regulate expression of a sub-group of APETALA2 (AP2)-like transcription factors that contain two AP2 domains in Arabidopsis [13, 14], tobacco [6] and maize [15- 17]. [score:4]
miR172 is a conserved miRNA family which has been shown to regulate expression of APETALA2 (AP2)-like transcription factors in Arabidopsis and maize. [score:4]
Similar expression patterns of miR172 have also been observed in vegetative tissues of Arabidopsis and maize [13, 17], suggesting that miR172 has a conserved role during vegetative development. [score:4]
Recently, SNB, a target of miR172, has been shown to be another gene regulating this transition [24] with snb mutants producing multiple bract-like structures that are equivalent to rudimentary glumes. [score:4]
Our results show that SNB is a target of miR172, which adds another layer of complexity to the regulation of spikelet determinacy in rice. [score:4]
In reproductive tissues, miR172 was consistently expressed although its abundance reduced gradually during panicle development (Figure 1B). [score:4]
Expression levels of each gene in various tissues were analyzed using a primer pair spanning the miR172 target site. [score:4]
In wild-type plants, miR172 expression varied considerably between organs and developmental stages. [score:4]
5' RACE was used to map the miR172 -mediated cleavage sites in the predicted targets. [score:3]
This result suggests that both IDS1 and SID1 are targets of miR172. [score:3]
Elevated levels of miR172 were detected in these miR172 over -expression plants, particularly in plants transformed with pre- MIR172b (Figure 4). [score:3]
To determine whether the five putative targets of miR172 in rice are cleaved by miR172, 5' rapid amplification of cDNA ends (RACE) analysis was performed using RNA isolated from two-leaf stage shoots, 1-10 DAF grains and booting panicles (BP). [score:3]
Figure 2 qRT-PCR analyses of miR172 target genes in wild-type plants. [score:3]
RNA isolation, qRT-PCR analysis and miR172 -mediated cleavage of target genes. [score:3]
Over -expression of miR172 causes floral homeotic phenotypes similar to ap2 loss-of-function mutants [18], such as conversion of sepals and petals into carpels, and reduction of stamen numbers [14]. [score:3]
Generation of miR172 over -expression constructs and transgenic plants. [score:3]
For miR172 over -expression transgenic lines, mature leaves (for northern blot) and panicle samples (for qRT-PCR) were collected from T [0 ]plants. [score:3]
However at present the precise expression domain of miR172 in the panicle is yet to be determined. [score:3]
The mature miR172a-d sequences differ only in their 5' and 3' bases and therefore hybridization with a miR172a probe is likely to detect expression of all mature miR172 sequences. [score:3]
Expression of a miR172-resistant version of AP2 increases stamen number [19]. [score:3]
This might be because the accumulation of miR172 in the MIR172a over -expression plants was not sufficient to cause a phenotypic change (Figure 4). [score:3]
Nucleotides that differ among miR172 family members or their targets are shown in bold italic. [score:3]
Arabidopsis miR172 also acts as a repressor of the AP2-like genes, TARGET OF EAT 1 (TOE1), TOE2 and TOE3 to promote early flowering [13, 20]. [score:3]
miR172 -mediated cleavage of target genes. [score:3]
The rice genome encodes five AP2-like genes predicted to be targets of miR172. [score:3]
It has been shown that miR172b is expressed in seedlings and developing grains [8, 10, 12], whereas miR172c is not detected in developing grains [12]. [score:3]
As SNB is cleaved by miR172 a reduced accumulation of SNB mRNA would be expected in miR172b over -expression plants. [score:3]
The rice miR172 family contains four members (MIR172a-d), which are predicted to target five AP2-like genes, Os03g60430, Os04g55560, Os05g03040, Os06g43220 and Os07g13170 [ref [24] and this study]. [score:3]
Expression of miR172 was below the detection limit in 10 DAF (days-after-fertilization) grains (Figure 1B). [score:3]
In Arabidopsis, miR172 serves as a negative regulator of AP2 to specify floral organ identity. [score:2]
5' RACE results suggest that Os04g55560 is regulated by miR172 in both vegetative and reproductive tissues (Figure 3). [score:2]
The abundance of intact transcripts of miR172 target genes was analyzed by qRT-PCR using primer pairs spanning the miR172 cleavage sites. [score:2]
However, it is not known whether or not ZmRap2.7 is also regulated by miR172 as TOE1 is in Arabidopsis. [score:2]
To investigate the functions of the AP2-like genes, we studied the effect of elevated expression of miR172 on rice development. [score:2]
We provide direct evidence for miR172 -mediated cleavage for SNB, Os04g55560 and Os06g43220. [score:2]
B, Accumulation of miR172 in reproductive tissues and grains. [score:1]
Among the five miR172 targets in rice, Os04g55560 is most similar to Arabidopsis AP2 based on phylogenetic analysis, but its function has not been investigated in rice. [score:1]
Mature miR172 accumulation increased significantly in leaves but not in roots as plants grew, reaching a maximum in the flag leaf (Figure 1A). [score:1]
Figure 4 RNA gel blot detection of accumulation of miR172 in mature leaves of wild-type and miR172 transgenic plants. [score:1]
Plants transformed with pre- MIR172a did not show any altered phenotypes (data not shown), even though miR172 accumulated to a higher level than in wild-type plants (Figure 4). [score:1]
To generate the ubiquitin-pre- MIR172 constructs, the SacI fragment released from the pGEM [®]-T Easy vector was gel purified and cloned into the similarly digested vector pKU352 [31]. [score:1]
Figure 1 RNA gel blot analysis of accumulation of miR172 in wild-type plants. [score:1]
A, Accumulation of miR172 in vegetative tissues. [score:1]
Functional specificity of miR172 members. [score:1]
The ids1 sid1 double mutants rescue the phenotypic defects of tasselseed4 (ts4), a loss-of-function mutant of MIR172e [16], one of the five MIR172 genes in maize. [score:1]
The reduced accumulation of miR172 could be because the transgene containing pre- MIR172a is transcribed less efficiently than the pre- MIR172b transgene, or as pre- MIR172a is the least stable precursor (ΔG = -49.1 kcal/mol) among the four miR172 precursors in rice, it may be cleaved by miR172a itself as shown in Arabidopsis [30]. [score:1]
Of the four rice MIR172 members, MIR172b has a mature miRNA sequence identical to maize MIR172e. [score:1]
Cleavage of Os04g55560 was detected in a mixed sample of shoot and grain as well as in booting panicles; cleavage of Os06g43220 was only detected in the mixed sample with a low frequency (most likely contributed by young seedlings as accumulation of miR172 was below the detection limit in 10 DAF grains); and cleavage of SNB was only detected in booting panicles. [score:1]
[1 to 20 of 80 sentences]
2
[+] score: 182
Another possibility is that, OsMADS1 might interact with AP2, and AP2 regulate the expression of miR172 at the transcription level, just as that in Arabidopsis, the miR172 repression orchestrated by LUG and SEU co-repressors is dependent on the miR172 target gene AP2 itself, by a positive-feedback loop allowing AP2 to maintain its own expression in the outer floral whorls (Grigorova et al., 2011), or by binding to the miR172b promoter (Yant et al., 2010). [score:8]
miR172 was first reported to regulate floral organ development by negatively regulating the AP2 gene at the post-translation level in Arabidopsis (Chen, 2004), and miR172 could cooperate with miR156 to regulate flowering time sequentially (Wu et al., 2009). [score:7]
In miR172aOEs plants, both the palea and the lemma were malformed and elongated, with the lemma longer than the palea, while in the AP2-2OE lines, the lemma was shorter than the lemma, overexpression of all target AP2 genes resulted in shortened lemma/palea, indicating miR172/AP2s module regulated the elongation and synchronous development of the palea and the lemma in rice. [score:7]
Overexpression of Each Target AP2 Gene Resulted in Shortened Lemma/PaleaTo study the function of miR172 in detail, we further analyzed the function of miR172 targets genetically. [score:7]
Meanwhile, miR172 negatively regulated its target AP2 genes, and up-regulation of AP2 showed shortened palea/lemma (exemplified by AP2-2OE). [score:7]
Consistently, overexpression of each target AP2 gene resulted shortened lemma/palea to various degrees, suggesting that miR172/ AP2s regulate the elongation of the lemma/palea. [score:6]
Furthermore, miR172s were down-regulated in the AP2-1OE, AP2-2OE, and AP2-5OE plants (Figure 4), indicating the possibility of negative feedback regulation between these AP2s and miR172. [score:5]
In rice, miR172 expressed in each whorl of the floral organs (Figures 6B,C), suggesting its function in all these whorls, as manifested by the phenotype of miR172s over expression (Figure 1). [score:5]
These results strongly suggested that miR172/ AP2s regulated palea/lemma development and floral determinacy in rice, and OsMADS1 was an upstream suppressor of miR172. [score:5]
OsMADS1 expressed mainly in the palea/lemma and lodicules (Figure 6H), while miR172 expressed highly in the newly formed stamens and carpels (Figure 6D). [score:5]
Therefore, the expression domains of OsMADS1 and miR172 showed some degree of complementation, implying the inhibition of OsMADS1 to miR172. [score:5]
miR172 expresses in the late vegetative stage and panicle, and over expression of miR172b could approximately pheno-copy the snb mutant (Zhu et al., 2009). [score:5]
FIGURE 6Expression of miR172 and OsMADS1 in the process of flower development. [score:4]
miR172 regulates stem cell fate and defines the inner boundary of APETALA3 and PISTILLATA expression domain in Arabidopsis floral meristems. [score:4]
To mimic the knock-down function of miR172, these AP2 genes were, respectively, overexpressed. [score:4]
LEUNIG and SEUSS co-repressors regulate miR172 expression in Arabidopsis flowers. [score:4]
In plants, miR172 is involved in the regulation of flowering time and floral organ identity through targeting AP2 genes (Chen, 2004; Mlotshwa et al., 2006; Zhao L. et al., 2007; Martin et al., 2009; Mathieu et al., 2009). [score:4]
Expression Character of miR172 and OsMADS1 during Floral Organ Development. [score:4]
Therefore, during the developmental process of palea/lemma, OsMADS1 exhibited inhibition to miR172, which may further explain the longer palea/lemma of miR172OEs plants. [score:4]
Correspondingly, mutation in the targets of miR172, such as the SNB gene and the OsIDS1 gene resulted in loss of flower determinacy (Lee et al., 2007; Lee and An, 2012). [score:4]
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
For example, in Arabidopsis the transcription factors SQUAMOSA BINDING PROTEIN-like 9 (SPL9) and the MADS-box SHORT VEGETATIVE PHASE (SVP) act as a direct activator and a direct repressor, respectively, of miR172 (Wu et al., 2009; Cho et al., 2012). [score:3]
For each miR172 over expression, 30–50 independent transgenic plants were gotten and over 90% of them showed the phenotypes described below. [score:3]
These phenotypic resemblances indicated the genetic connection between OsMADS1 and miR172, and our study indicated the inhibition of OsMADS1 to miR172. [score:3]
To study the function of miR172 in detail, we further analyzed the function of miR172 targets genetically. [score:3]
Another target of miR172, Osindeterminate spikelet 1 (OsIDS1) functions in the establishment of the floral meristems and formation of the floral organs (Lee and An, 2012). [score:3]
Repression of flowering by the miR172 target SMZ. [score:3]
In rice, one target of miR172, supernumerary bract (SNB), influences the floral organ identity and floral determinacy (Lee et al., 2007). [score:3]
Here we showed that miR172 regulated floral organ development in rice, especially the elongation of the palea and lemma, under the modulation of OsMADS1. [score:3]
So that the expression region of OsMADS1 and miR172 showed complementary character, OsMADS1 might repress excessive accumulation of miR172 in the lemma and the palea. [score:3]
Here, we studied the function of miR172 in regulating rice floral organ development. [score:3]
In rice, five AP2 genes are predicted as targets of miR172 [4] (Zhu et al., 2009), and they were tentatively designated as AP2-1, AP2-2, AP2-3, AP2-4, and AP2-5, respectively, in this study. [score:3]
In the present study, we found that OsMADS1 functioned by modulating miR172s, indicating one primary pathway consisting of OsMADS1-miR172-AP2 involved in the regulation of floral organ development (Figure 8). [score:3]
Various studies showed that miR172 is a pivotal regulator of reproductive development in plants. [score:3]
SHORT VEGETATIVE PHASE (SVP) protein negatively regulates miR172 transcription via direct binding to the pri-miR172a promoter in Arabidopsis. [score:3]
Overexpression of Each miR172 Gene Caused Elongated Lemma/Palea and Indeterminacy. [score:3]
Over -expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa). [score:3]
Furthermore, the timing and specificity of miR172 expression were both influenced by OsMADS1. [score:3]
FIGURE 8 Diagram of the possible pathway of OsMADS1-miR172-AP2 regulation on palea/lemma. [score:2]
Although miR172 is functionally conserved, and several studies strongly suggest the participation of miR172/ AP2s in floral organ development in rice, a comprehensive understanding of their roles is still missing. [score:2]
We carried out yeast one-hybrid and did not detect the direct binding of OsMADS1 protein to the motifs in the promoters of miR172 (Supplementary Figure S6B). [score:2]
Therefore, the upstream regulatory pathway of miR172 in Arabidopsis and rice showed some similarity. [score:2]
So that miR172/AP2 regulated floral organ identity and flower determinacy, especially elongation of the lemma/palea. [score:2]
However, we did not find direct binding of OsMADS1 to any of the miR172 promoters by yeast one-hybrid system. [score:2]
In Arabidopsis, miR172 regulates the elongation of the valve under the modulation of the FUL gene (a MADS-box gene) and the ARF6/8 gene (José Ripoll et al., 2015). [score:2]
Floral patterning defects induced by Arabidopsis APETALA2 and microRNA172 expression in Nicotiana benthamiana. [score:2]
Sequence data used in this study can be found in the rice genome annotation database [1] and NCBI [2] under the following accession numbers: LOC_Os03g11614 (OsMADS1), LOC_Os05g03040 (AP2-1), LOC_Os03g60430 (AP2-2), LOC_Os07g13170 (AP2-3), LOC_Os06g43220 (AP2-4), LOC_Os04g55560 (AP2-5), LM379345 (Osa-miR172a), LM379346 (Osa-miR172b); LM379347 (Osa-miR172c), LM383079 (Osa-miR172d), AC091532 (actin). [score:1]
This further illustrated the conservation of miR172. [score:1]
Four miR172 genes (miR172a-d) have been identified in rice genome [3]. [score:1]
Graft-transmissible induction of potato tuberization by the microRNA miR172. [score:1]
The phenotypic similarity of miR172OEs and the osmads1 mutant suggests a potential interaction between OsMADS1 and miR172. [score:1]
Therefore, the binding of OsMADS1 to the promoter of miR172 might require the involvement of several other OsMADS proteins, making it more difficult to be detected. [score:1]
miR172 was detected with Locked Nucleic Acid (LNA) probes which were Digoxin 5′-end labeled (Exiqon). [score:1]
In the 3 Kb promoter region of miR172a, miR172b, miR172c, and miR172d, there are 6, 4, 3, and 3 CArG-boxes, respectively (Supplementary Figure S6A). [score:1]
[1 to 20 of 54 sentences]
3
[+] score: 119
Its temporal expression gradually decreases as plants mature, and this gene is also down-regulated by miR172 (Lauter et al. [2005]). [score:6]
Overexpression of those AP2 genes delayed flowering; overexpression of miR172-resistant forms of SNB or OsIDS1 further delayed this process. [score:5]
The miR172 s target several AP2 genes, with temporal expression of the latter type being slowly diminished in Arabidopsis and maize (Aukerman and Sakai [2003]; Lauter et al. [2005]; Jung et al. [2007]; Mathieu et al. [2009]; Zhu and Helliwell [2011]). [score:5]
Such overexpression (OX) of miR172 -targeted AP2 causes late-flowering phenotypes in Arabidopsis (Jung et al. [2007]; Mathieu et al. [2009]). [score:5]
Six Arabidopsis genes in this family -- APETALA 2 (AP2), TARGET OF EAT 1(TOE1), TOE2, TOE3, SCHLAFMUTZE (SMZ), and SCHNARCHZAPFEN (SNZ) -- delay flowering in an age -dependent manner (Park et al. [2002]; Aukerman and Sakai [2003]; Schmid et al. [2003]; Chen [2004]; Jung et al. [2007]; Mathieu et al. [2009]), and are suppressed by miR172 (Schmid et al. [2003]; Kasschau et al. [2003]; Chen [2004]; Schwab et al. [2005]; J u ng et al. [2007]; Mathieu et al. [2009]). [score:5]
Based on these findings, we concluded that miR172 induced flowering by suppressing the AP2 genes and the microRNA gene was inhibited by phytochromes. [score:5]
Four synonymous mutations (red characters) were introduced into miR172 target sequences at C-terminus of SNB full-length cDNA. [score:4]
SPL9 prompts miR172 expression and the other SPL genes redundantly function in regulating miR172. [score:4]
Here, we demonstrated in rice that miR172 induces flowering time by suppressing two AP2 family members - SNB and OsIDS1 - that are negative regulators of Ehd1. [score:4]
To confirm that miR172 controls flowering time via the AP2 genes, we constructed the miR172-resistant form of SNB (r SNB) by changing the miR172 target site CTGCAGCATCATCAGGATTCT to CTGCAGCAATGTCCGGATTCT (Figure 6A). [score:3]
The transcripts of SNB and OsIDS1 carry a miR172 target site (Lee and An [2012]). [score:3]
Overexpression of miR172 reduced flowering time significantly, suggesting its role as an inducer. [score:3]
Figure 1 Temporal expression patterns of miR172 and AP2 genes. [score:3]
These observations further demonstrated that miR172 s induce flowering time by suppressing AP2 transcripts in rice. [score:3]
Phenotypes of miR172-resistant OsIDS1 overexpression. [score:3]
In rice, miR172 is most highly expressed during later vegetative stages and in developing panicles (Zhu et al. [2009]; Lee and An [2012]). [score:3]
In rice, five AP2-like genes (SNB, OsIDS1, SHAT1, Os05g03040, and Os06g43220) contain the miR172 target sites (Sunkar et al. [2005]; Zhu et al. [2009]). [score:3]
Moreover, transgenic plants over -expressing the miR172-resistant form of OsIDS1 (r OsIDS1) did not produce any flowers for more than one year (Additional file 1: Figure S6). [score:3]
To examine whether miR172 controls flowering time, we generated six transgenic rice plants that over-express miR172d (Figure 5A). [score:3]
To examine whether miR172 levels change as plants develop, we monitored the temporal expressions of miR172a and miR172d in leaf blades. [score:3]
However, their expression gradually declined to minimal levels at 35 DAG when miR172 transcripts started to increase. [score:3]
In addition, expressions of the AP2 genes were repressed by miR172 and the later was increased in the osphyB and osphyA osphyB mutants. [score:3]
Considering that AP2 genes are controlled by miR172, we might conclude that phytochromes support vegetative growth by maintaining AP2 expression. [score:3]
Transcripts of SNB and OsIDS1, two members of the AP2 family that have the miR172 target site, were reduced in older plants as the level of miR172 rose. [score:3]
In all, six AP2 genes have miR172 target sites (Zhu and Helliwell [2011]). [score:3]
Figure 4 Expression of miR172 s and AP2 genes in oscol4, osphyB, and osphyA osphyB mutants. [score:3]
Expression was monitored at ZT 11 h for miR172 s and at ZT 2 h for SNB and OsIDS1. [score:3]
Expression was monitored at ZT 18 h for miR172 and at ZT 2 h for AP2 genes and Ehd1. [score:3]
For constructing a miR172-resistant form of SNB (r SNB), we introduced synonymous mutations into the miR172 binding site through site-directed mutagenesis, using primer sets rSNB-N-F/rSNB-N-R and rSNB-C-F/rSNB-C-R (Additional file 2: Table S1). [score:2]
We also showed that phytochromes negatively regulated miR172. [score:2]
The miR172 LNA probe was either labeled with P [32] or 3′-end-labeled with DIG-ddUTP (Roche, Mannheim, Germany). [score:1]
To verify this, we conducted northern blot analysis of mature miR172. [score:1]
Levels of miR172 increased as plants aged, further supporting our findings. [score:1]
miR156 plays roles in early vegetative stages, while miR172 functions later stages of develop (Aukerman and Sakai [2003]; Lauter et al. [2005]; Wu and Poethig [2006]; Chuck et al. [2007]; Poethig [2009]). [score:1]
The other two miR172 members in rice - miR172b and miR172c – were not measured because they are expressed mainly in panicles and roots, respectively, and are not likely involved in controlling flowering time (Jeong et al. [2011]). [score:1]
Locked nucleic acid (LNA) 5′-ATgCAgCAtCAtCAaGAtTCT-3′ (upper- and lower-case letters indicate DNA and LNA, respectively) was used as an antisense oligonucleotide probe for miR172 (Varallyay et al. [2008]). [score:1]
The facultative LD-flowering phenotype of rice can be explained in part by the miR172-AP2 pathway. [score:1]
Although an antagonistic role for miR172 and AP2 genes in floral transition has been described in Arabidopsis and maize, their functions in rice have not been reported. [score:1]
The level of miR172 is increased in phyB mutants of Arabidopsis (Jung et al. [2007]). [score:1]
Figure 6 Phenotypes of miR172 -resistant SNB OX plants. [score:1]
In plants, the miR172/ AP2 module is inversely correlated with the miR156/SPL module (Aukerman and Sakai [2003]; [2005]; Wu and Poethig [2006]; Chuck et al. [2007]; Poethig [2009]). [score:1]
This demonstrated that the AP2 genes function downstream of miR172. [score:1]
AP2 family Floral transition miR172 Phytochromes Rice Rice flowers earlier under short day (SD) conditions than under long days (LD). [score:1]
The role of miR172 in controlling flowering time has been reported for Arabidopsis, maize, barley, and soybean (Aukerman and Sakai [2003]; Chen [2004]; Lauter et al. [2005]; Jung et al. [2007]; Mathieu et al. [2009]; Nair et al. [2010]; Yoshikawa et al. [2013]). [score:1]
miR172 and miR156 are involved in phase transition (Aukerman and Sakai [2003]; Lauter et al. [2005]; Wu and Poethig [2006]; Poethig [2009]). [score:1]
[1 to 20 of 45 sentences]
4
[+] score: 115
In A. thaliana, two miRNAs, miR156 and miR172, regulated the juvenile to adult developmental phase change [38]; SPL9 and SPL10 promoted the expression of miR172b by binding to its promoter and acted independently of this and its target genes [38]; and the expression of miR156 was higher in the juvenile phase than in the adult phase, whereas the expression of miR172 was lower in the juvenile phase than in the adult phase [38]. [score:11]
We conclude that when inflorescence architecture is altered by down-regulation of miR172, the SPL gene expression may be altered as a consequence of that or due to up-regulation of AP2-like gene. [score:9]
Since SPL/miR156 module control panicle branching by directly regulating the miR172/AP2 module in rice 30, 47, bract and ear glume development in maize 48, 49 and floral meristem identity in A. majus 2, 28, expression of HvSPL genes in the mir172 barley mutant was analysed. [score:6]
As expression of HvAP2 is regulated by miR172, we also examined the expression of HvAP2 in the spike of wild type and mir172 mutant lines (Figs  S5 and 6H). [score:6]
Vegetative to Reproductive Phase in Barley: Expression of miR156, miR172 and Specific SPL GenesThe timing of juvenile to adult phase transition in A. thaliana is known to be regulated by miR156 and miR172, along with several members of the SPL family [38]. [score:4]
Down-regulation of AP2 genes is also mediated by miR172 [39]. [score:4]
The miR172 is known for the regulation of AP2-like transcription factors through transcript cleavage and translational repression in Arabidopsis 39, 40. [score:4]
The expression of AP2 and SPL genes in the spikes of mir172 mutants and its wild-type counterpart golden promise (GP) elucidated their involvement in spike development. [score:4]
The up-regulation of HvAP2 in mir172 mutant spikes as compared to their wild type counterparts proved its negative regulation by miR172 (Figs  S5 and 5H). [score:4]
Figure 5Barley miR172 sequences and expression analysis of miR156 and miR172 family members. [score:3]
Expression of miR172 promotes the vegetative phase change in maize by repressing an AP2-like gene Glossy15 [41]. [score:3]
Lauter N Kampani A Carlson S Goebel M Moose SP microRNA172 down-regulates glossy15 to promote vegetative phase change in maizeProc. [score:3]
Data are expressed as RPM (reads per million) for the miR172 and miR156 members normalized to all miRNAs identified in the sample. [score:3]
In our study, HvSPL3, 13, 15, and 23 were differentially expressed in the mir172 mutant when compared to control spikes, suggesting a possible feedback regulation of the miR172/AP2 module. [score:3]
To see the effect of AP2/miR172 module on HvSPL genes, we examined the expression patterns of HvSPLs in the spikes of a mir172 mutant and its wild type counterpart, which produce indeterminate and normal spikes, respectively (Fig.   6C–G). [score:3]
The results of the current study revealed that the miR156/HvSPL/miR172 module functions as key molecular integrators that affected developmental phase transitions and spike development in barley. [score:3]
However, the expression of miR172a and of miR172c was lower only in 11, 20–21 and 75–77 day old plants. [score:3]
These results suggest the possible indirect feedback regulation of the AP2/miR172 module on HvSPL genes in barley. [score:3]
Expression of HvSPL3, 13, 15 and 23 was higher in the mir172 mutant than in the wild-type counterpart. [score:3]
In barley, suppression of miR172 guided cleavage of AP2 mRNA produces cleistogamous flowering [42] and affects spikelet determinacy [43]. [score:3]
Expression Analysis of Barley miR156 and miR172 Family Members. [score:3]
In addition, the expression patterns of SPL genes and of miR156 and miR172 from vegetative to reproductive phases revealed their possible functional relationships. [score:3]
Vegetative to Reproductive Phase in Barley: Expression of miR156, miR172 and Specific SPL Genes. [score:3]
Expression of HvSPL3, 13, 15 and 23 was further investigated through qRT-PCR which showed 2.3 to 21 fold higher expression in the mir172 mutant. [score:3]
The timing of juvenile to adult phase transition in A. thaliana is known to be regulated by miR156 and miR172, along with several members of the SPL family [38]. [score:2]
In A. thaliana, these phases are regulated by miR156 and miR172 [38] via SPL genes. [score:2]
As expected, expression of HvAP2 was higher in the mir172 mutant spike as compared to its wild type counterparts. [score:2]
The present study represents the first comprehensive analysis of the miR156/SPL/miR172 regulatory hub in barley. [score:2]
A single 3.6 kb Ds insertion in mir172 mutant was previously identified by Brown and Bregitzer, 2011. [score:1]
Interaction Analysis of miR172, HvSPL & HvAP2 Genes. [score:1]
The respective transcripts of miR156 and miR172 has been shown in RPM (reads per million). [score:1]
The expression of HvSPL3, 6, 13, 15 and 23 was initially investigated through semi-quantitative RT-PCR and followed by qRT-PCR to investigate expression in the immature spikes the mir172 mutant and wild-type barley plants (Figs  S5 and 6C–G). [score:1]
Perturbed interaction between AP2 and miR172 leads to striking differences in the size and shape of the barley spike [44]. [score:1]
Comparison of miR172a/b/c precursor sequence with Ds flanking sequence suggested us that the Ds was inserted in the mature miR172c sequence (Fig.   5A). [score:1]
Interaction Analysis of miR172, HvSPL & HvAP2 GenesPreviously, a barley mir172 mutant line was developed through transposon tagging system in which a 3.6 kb Ds sequence was inserted into the mature sequence of miR172 [43]. [score:1]
Previously, a barley mir172 mutant line was developed through transposon tagging system in which a 3.6 kb Ds sequence was inserted into the mature sequence of miR172 [43]. [score:1]
The sequences of three miR172 family members (miR172a/b/c) in barley were retrieved from the mirex2.0 database (Fig.   5A,B). [score:1]
The red triangle indicates Ds insertion site in miR172c mature sequence. [score:1]
[1 to 20 of 38 sentences]
5
[+] score: 54
In the dh mutant, miR156 expression was up-regulated and miR172 expression remained unchanged (Fig 6C), which is similar to the expression patterns of miR156 and miR172 found in the miR171 over -expressing barley [45]. [score:12]
The expression of these two miRNAs is negatively correlated; thus, miR156 is intensively expressed during the juvenile phase to control shoot development, while miR172 is strongly expressed during the adult phase. [score:8]
Down-regulation of the target gene Glossy15 of miR172 exhibited a shortened juvenile phase [67]. [score:6]
In leaves of dh mutant 5-leaf stage seedlings, osa-miR156 expression level was higher than that in ZH11; however, osa-miR172 expression did not differ between them. [score:5]
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
On the other hand, miR172 targets AP2-like transcription factors, promoting both vegetative phase change and floral induction [20]. [score:3]
A phenotype over -expressing miR172 was not observed in dh mutant [21]. [score:3]
Over -expression of miR172 leads to earlier flowering and produces abnormal floral organs [21]. [score:3]
microRNA172 down-regulates glossy15 to promote vegetative phase change in maize. [score:3]
Over -expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa). [score:3]
To further understand the mechanism underlying the delay in the juvenile—adult phase transition, we used qRT-PCR to examine osa-miR156 and osa-miR172 expression (Fig 6C). [score:3]
Of them, miR156 and miR172 are well known for playing critical roles in the phase change of several species, including Arabidopsis [12, 13], maize [14] and rice [15]. [score:1]
miR156 and miR172 have been shown to play a critical role in the vegetative phase change in several plant species [13, 18]. [score:1]
[1 to 20 of 13 sentences]
6
[+] score: 52
Over -expression of miR156 prolongs the expression of juvenile vegetative traits and delays flowering in both Arabidopsis and maize [18], whereas over -expression of miR172 in Arabidopsis accelerates flowering [8]. [score:7]
As shown in Figure 8, miR156 expression was markedly down-regulated during the floral transition and miR172 increased to higher levels after the lateral buds were differentiated (20 days after self-pruning) in the flowering-competent shoots (spring shoots of the MT). [score:6]
MiR172 exhibits a similar temporal expression pattern in maize, where it targets Glossy15 (Gl15), a gene required for the expression of juvenile epidermal traits [19]. [score:6]
The dynamic expression of miR156 and miR172 in flowering-competent and -incompetent shoots suggested that they were involved in the floral transition (Figure 8). [score:3]
Meanwhile, miR156 and miR172 were expressed in inverse patterns, consistent with previous reports on the two miRNAs. [score:3]
Of the other miRNAs, the Novel34 and Novel38 expression patterns were similar to that of miR156 and miR172, indicating that they may perform a similar role during the flowering process (Figure 8). [score:3]
More recently, Song et al. (2010a) analyzed miR172 and miR156 from trifoliate orange by RACE and verified their expression patterns. [score:3]
In this study, miR156 and miR172 were expressed in inverse patterns: miR156 declined from juvenile to adult stage whereas miR172 increased during this same period, consistent with previous reports on the two miRNAs. [score:3]
Aukerman et al (2003) demonstrated that miR172 causes early flowering and disrupts the specification of floral organ identity when over-expressed in Arabidopsis [47]. [score:3]
Several miRNAs, such as miR156 and miR172, have been shown to affect flowering time when over-expressed in Arabidopsis [8], [17]. [score:3]
These results suggested that miR156 and miR172 not only serves as a master regulator of vegetative phase change, but as a molecular marker for this process. [score:2]
However, in the flowering incompetent shoot (spring shoots of the WT), miR156 and miR172 were expressed in inverse patterns during self-pruning compared with the prior stage. [score:2]
Previous studies have shown that miR156 decreases during phase development in Arabidopsis [46], whereas miR172 increases [47], [48]. [score:2]
The fluctuation in miR156 and miR172 expression was quite significant compared with other miRNAs. [score:2]
Some highly conserved miRNA families such as miR156/157, miR167 and miR172 families were sequenced more than ten thousands or even one hundred thousands times. [score:1]
MiR172 has also been implicated in the regulation of flowering time and floral organ identity in both maize and Arabidopsis [8], [19]. [score:1]
Csi-miR156, Csi-miR172 indicated Citrus sinensis conserved miRNAs; miR396 indicated other plants conserved miRNAs; PtmiR93 indicated known trifoliate orange-specific miRNAs; Novel17, Novel28, Novel29, Novel34, Novel38, Novel45, Novel56, and Novel68 indicated novel miRNAs. [score:1]
0043760.g003 Figure 3 (A) line 2–24 indicated novel miRNA from novel01 to Novel24; (B) line 2–24 indicated novel miRNA from novel25 to Novel50; (C) line 2–24 indicated novel miRNA from novel51 to Novel74; (D) line 2–6 indicated Novel75, Csi-miR156, Csi-miR172, miR396 and PtmiR93; NC indicated negative control; M indicated 100 bp. [score:1]
[1 to 20 of 18 sentences]
7
[+] score: 47
Both Os SPL13 and Os SPL14 contain miR156 target sites, and OsSPL14 ortholog, SPL9 regulates miR172 expression positively in Arabidopsis (Wu et al. 2009). [score:6]
Wild type and d18-dy also showed similar expression pattern of miR172: the expression was quite low in 2nd leaf, and increased dramatically toward the 7th leaf (Figure 3B). [score:5]
Expression patterns of miR156 and miR172 in d18-dy demonstrate that GA regulates juvenile-adult phase change independently of miR156-related pathway. [score:4]
From normal expression patterns of two miRNAs and retarded juvenile-adult phase change in d18-dy, I estimated that GA promotes adult phase transition independently of miR156 and miR172. [score:3]
The glossy15 (gl15) mutant shortens the juvenile phase in the maize epidermis (Moose and Sisco 1996); GL15 is an AP2-like gene that is the target of miR172 (Lauter et al. 2005). [score:3]
Subsequently I examined miR156 and miR172 expression levels in control and GA [3] treated plants. [score:3]
The expression patterns of miR156 and miR172 were comparable between wild type and d18-dy plants. [score:3]
miR156 inhibits juvenile-adult phase change via repression of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family genes resulting in decrease of miR172 (Wu et al. 2009). [score:3]
To quantify the miR156 and miR172 expression, PCR was performed using the TaqMan Fast Universal PCR Master Mix (Applied Biosystem). [score:3]
To demonstrate the relationship between GA and two miRNAs in juvenile-adult phase change, I examined miR156 and miR172 expression patterns in wild type and d18-dy leaves (Figure 3A,B). [score:3]
For observing miR156, miR172, Os SPL s and GA2ox4 expression patterns in GA treated plants, sterilized seeds of wild type were plated on MS medium (Murashige and Skoog 1962) containing 10 [-5] M GA [3] (SIGMA). [score:3]
In higher plants, miR156 and miR172 are also known as juvenile-adult phase change regulator. [score:2]
Juvenile-adult phase change is regulated by miR156, miR172 and gibberellin (GA) in many higher plants (Lawson and poethig 1995; Telfer et al. 1997; Wu and Poethig 2006; Wang et al. 2011; Tanaka et al. 2011). [score:2]
Thus, miR156 and miR172 are key regulators in the juvenile–adult phase change. [score:2]
In the early vegetative stage, transcription level of miR156 exceeds that of miR172, whereas in later vegetative stage, the inverse pattern is seen (Wu and Poethig 2006; Chuck et al. 2007). [score:1]
Gibberellin miR156 miR172 Os SPL s Juvenile and adult phases are distinguished by several morphological markers (Lawson and Poethig 1995; Telfer et al. 1997; Asai et al. 2002). [score:1]
[1 to 20 of 16 sentences]
8
[+] score: 33
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR535, osa-MIR169r, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, ppe-MIR482a, ppe-MIR482b, ppe-MIR171f, ppe-MIR482c, ppe-MIR171h, ppe-MIR171a, ppe-MIR171e, ppe-MIR169e, ppe-MIR398a, ppe-MIR171g, ppe-MIR171b, ppe-MIR482d, ppe-MIR482e, ppe-MIR171c, ppe-MIR398b, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR160a, ppe-MIR160b, ppe-MIR162, ppe-MIR164a, ppe-MIR164b, ppe-MIR164c, ppe-MIR164d, ppe-MIR166a, ppe-MIR166b, ppe-MIR166c, ppe-MIR166d, ppe-MIR166e, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR168, ppe-MIR169a, ppe-MIR169b, ppe-MIR169c, ppe-MIR169d, ppe-MIR169f, ppe-MIR169g, ppe-MIR169h, ppe-MIR169i, ppe-MIR169j, ppe-MIR169k, ppe-MIR169l, ppe-MIR171d, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR390, ppe-MIR393a, ppe-MIR393b, ppe-MIR396a, ppe-MIR396b, ppe-MIR482f, ppe-MIR535a, ppe-MIR535b
miR156 targeted the SPL family gene CNR that was reported to be involved in fruit ripening [48, 49], and the overexpression of miR156 in tomatoes downregulated the weight and the number of fruit [50], miR172 targeted the ethylene-responsive TF APETALA2a, which negatively affects ethylene synthesis and positively affects fruit ripening. [score:10]
miR156 and miR172 particularly targeted the SPL family gene colorless non-ripening (CNR) and the ethylene-responsive transcription factor gene APETALA2a, respectively, whereas miR393 targeted the AFB homolog gene SlTIR1. [score:5]
In the meantime, APETALA2a is positively regulated by CNR, indicating a regulatory feedback loop between miR172 and miR156 during fruit development and ripening [21]. [score:4]
miR172 is known to play crucial roles in regulating fruit growth by mediating the expression of ARFs [19, 20]. [score:4]
In the tomato fruit, miR156, miR172, miR393 and their targets were also detected [21]. [score:3]
Hence, the slight reduction in miR172 expression seen in the NAA -treated fruit was in line with previous reports. [score:3]
Another miRNA, miR172, was shown to be a key regulator in fruit growth since its encoding gene was activated by (MCM1, agamous, deficiens and serum response factor) MADS-domain protein and ARFs, which link auxin pathways to fruit morphogenesis [19, 20]. [score:2]
Furthermore, we found that some miRNAs were also identified in the fleshy fruit of the tomato, including miR156, miR172 and miR393 [21]. [score:1]
We noted that miR156, miR172 and miR393 were also detected in tomatoes. [score:1]
[1 to 20 of 9 sentences]
9
[+] score: 31
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR166c, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160f, osa-MIR164d, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR419, osa-MIR390, osa-MIR444a, osa-MIR528, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR529b, osa-MIR1425, osa-MIR1429, osa-MIR1431, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR1441, osa-MIR531b, osa-MIR1846d, osa-MIR1848, osa-MIR1850, osa-MIR1853, osa-MIR1860, osa-MIR812f, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1319a, osa-MIR2096, osa-MIR2864, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3979, osa-MIR812n, osa-MIR812o, osa-MIR5161, osa-MIR5338, osa-MIR5512a, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1319b, osa-MIR5512b, osa-MIR818f
Studies in Arabidopsis [9], rice [10], [11], Ipomoea nil [12], and the early-flowering mutant of trifoliate orange [13] have shown that miRNAs, such as miR156 and miR172, regulate the expression of developmental factors involved in flowering. [score:5]
MiR156 and miR172 have inverse patterns of expression, miR156 declines while miR172 increases during the plant life cycle, and the miR156 target SPL9 promotes transcription of miR172b [15], [18]. [score:5]
A recent study has shown that miR172 acts downstream of miR156, and its expression is regulated by miR156. [score:4]
On the other hand, miR172 controls flowering time and floral organogenesis by regulating expression of the transcription factor gene APETALA2 (AP2) and other AP2-like genes. [score:4]
Like AP2 mutants, over -expressing of miR172 plants flower earlier and produce abnormal floral organs. [score:3]
Over -expression of miR172 in rice can lead to spikelet loss, abnormal floral organs, and reduced fertility [11]. [score:3]
The number of miR172a and miR172d-specific reads were 4805 and 11717, but the maximum expression of miR172b was 74 reads, and there were only three miR172c-specific reads. [score:3]
Like miR172, osa-miR2096, osa-miR2125, oru-miR127, and oru-miR187 also target AP2 genes. [score:3]
The roles of miR172 and AP2-like genes are important in controlling flowering time in plants [17], miR172 is relatively well conserved in different plant species such Arabidopsis, maize and rice. [score:1]
[1 to 20 of 9 sentences]
10
[+] score: 28
From RNA-seq data, we obtained the expression levels of both miR164 and miR172 target genes. [score:5]
Among the miRNAs differentially expressed in wild-type rice across the developmental stages, the level of miR164 showed a ~7-fold increase from stage 3 to stage 7, whereas miR172 showed a dramatic decline of ~4-fold from stage 3 to stage 5, then remained relatively steady to stage 7 (see Supplementary Fig. S2A). [score:4]
Wu G Park MY Conway SR Wang JW Weigel D Poethig RS 2009 a The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
Three miR172 targets showed an inverse correlation with miR172 levels (Supplementary Fig. S2C). [score:3]
Similar to miR164 and miR172, a subset of miR156 targets showed an inverse correlation with miR156 (Fig. 2C). [score:3]
Zhu QH Upadhyaya NM Gubler F Helliwell CA 2009 Over -expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa). [score:3]
In rice, miR172 targets APETALA2 (AP2) genes controlling inflorescence architecture and spikelet meristem identity (Zhu et al., 2009; Lee and An, 2012). [score:3]
We identified miRNAs with differential accumulation patterns during rice spikelet development, including conserved miRNAs (miR156, miR172, and miR164). [score:2]
miRNAs, such as miR156 and miR172, have been proven to control flower development at a post-transcriptional level in both Arabidopsis and rice (Aukerman and Sakai, 2003; Chen, 2004; Xie et al., 2006; Wu et al., 2009 a; Zhu et al., 2009; Jiao et al., 2010; Lee and An, 2012). [score:2]
[1 to 20 of 9 sentences]
11
[+] score: 25
The expression of Os03g60430 (target of miR172) [55] showed no changes, whereas the expression of Os04g57610 (target of miR167) [54] increased in RSV infected rice (Figure 1C). [score:9]
These patterns correlated well with unaltered expression miR172 and down-regulated expression of miR167. [score:8]
1002176.g001 Figure 1(A) RNA gel blots showing expression of miR156, miR164, miR166, miR167, miR168 and miR172 in virus infected rice plants. [score:3]
Os12g41680, Os03g43930, Os04g57610 and Os03g60430 are the targets of miR164, miR166, miR167 and miR172, respectively [54]. [score:3]
As shown in Figure 1A, miR156, miR166 and miR167 were down regulated, whereas miR172 showed no obvious changes in accumulation. [score:2]
[1 to 20 of 5 sentences]
12
[+] score: 24
In anti- PHYB potato, the expression of miR172 is reduced in leaves but increased in stolons, suggesting miR172 acts downstream of phyB to regulate tuberization in response to day length (Martin et al., 2009). [score:4]
miR156 and miR172 function antagonistically in regulating developmental transitions in both monocots and dicots (Chuck et al., 2007; Wang et al., 2009, 2011; Wu et al., 2009; Huijser and Schmid, 2011). [score:3]
In addition, the expression of miR172 seems to be under the control of PHYB. [score:3]
A light-regulated miRNA, miR172, is also involved in tuberization regulation in a photoperiod -dependent manner in potato (Martin et al., 2009). [score:3]
However, the osa-miR172 family members showed no significantly differential expression (Additional file 2a). [score:3]
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
In this study, four members of osa-miR172 family (osa-miR172a/b/c/d) were also detected in both the WT and phyB libraries (Additional file 2a), and nine genes were identified as the targets of osa-miR172 family (Additional file 6). [score:3]
However, some of miRNAs with 5′ terminal A, such as miR172, were also loaded into AGO1 (Mi et al., 2008). [score:1]
Graft-transmissible induction of potato tuberization by the microRNA miR172. [score:1]
[1 to 20 of 9 sentences]
13
[+] score: 23
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR393a, gma-MIR482a, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ahy-MIR156a, ahy-MIR156b, ahy-MIR156c, ahy-MIR159, ahy-MIR167, ahy-MIR394, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR394c, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR393b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR394e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR167k, gma-MIR167l, gma-MIR169w
miR172 controls flower development by regulating the expression of apetala2 (ap2) in Arabidopsis [4, 43] and glossy 15 in maize [44]. [score:5]
Compared with miR156 and miR172, the expression levels of miR157 and miR162 are moderate while the expression of miR396 is low. [score:4]
Aberrant expression of miR156 and miR172 in plants disrupts normal leaf and flower development. [score:4]
Based on the threshold cycle (C [T]), miR172 and miR156 were highly expressed with C [T ]values of 19.6 ± 3.5 and 20.5 ± 5.3, respectively. [score:3]
In one of our previous studies, we also found that miR172 is highly expressed in cotton leaves [53]. [score:3]
Other studies have shown that conserved miR172 and miR156 play very important roles in plant growth and development [41]. [score:2]
In this study, we adopted this technique to validate and measure the expression of 4 novel miRNAs (miRn1, miRn2 and miRn2*, miRn3, and miRn4) as well as 5 conserved miRNAs (miR156, miR157, miR162, miR172, and miR396). [score:1]
In this study, 5 conserved miRNAs (miR156, miR157, miR162, miR172, and miR396) and 4 peanut-specific miRNAs (miRn1, miRn2 and miRn2*, miRn3, and miRn4) were validated using qRT-PCR (Table 3). [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 22
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
Beyond miR156 and miR172, miR164 targets genes encoding NAM proteins, and may be involved in regulating ear development (Table  3), similar to how miR164 is postulated to regulate NAC-domain targets in Arabidopsis [58]. [score:8]
miR156a-l probably targets several SPL genes during the juvenile-to-adult phase transition in maize (Figure  4a, Tables  2 and 3), and is postulated to indirectly activate miR172 via SPL[31]. [score:4]
miR172 and its targets IDS1 and SID1 function to influence the SM to FM conversion. [score:3]
Figure 4 miR156 and miR172 in maize flower development (Adapted from Poethig (2009). [score:2]
Previous studies showed that miR156 and miR172 function throughout flower development from the earliest stages (floral induction, stage I) to very late stages (floral organ cell-type specification, stage IV) [31- 34]. [score:2]
miR172 has been shown to negatively regulate GL15 (Table  3), which promotes maintenance of the juvenile state [31]. [score:2]
The levels of miR156 and miR172 are conflicting during phase transition (Figure  4b). [score:1]
[1 to 20 of 7 sentences]
15
[+] score: 21
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR528, osa-MIR531a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR814b, osa-MIR1425, osa-MIR1432, osa-MIR444d, osa-MIR444f, osa-MIR531b, osa-MIR1847, osa-MIR1849, osa-MIR1850, osa-MIR1852, osa-MIR1846a, osa-MIR1846b, osa-MIR1868, osa-MIR812f, osa-MIR1875, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1883a, osa-MIR1846e, osa-MIR2093, osa-MIR2865, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR2873b, osa-MIR5074, osa-MIR2863c, osa-MIR5150, osa-MIR5485, osa-MIR5486, osa-MIR5487, osa-MIR5490, osa-MIR5491, osa-MIR5497, osa-MIR5499, osa-MIR5504, osa-MIR5505, osa-MIR5506, osa-MIR5516a, osa-MIR5519, osa-MIR5521, osa-MIR5528, osa-MIR5538, osa-MIR812p, osa-MIR812q, osa-MIR5791, osa-MIR5792, osa-MIR5793, osa-MIR812r, osa-MIR5797, osa-MIR812s, osa-MIR5800, osa-MIR812t, osa-MIR812u, osa-MIR5806, osa-MIR812v, osa-MIR5815, osa-MIR5817, osa-MIR5818, osa-MIR1319b, osa-MIR5179, osa-MIR5834, osa-MIR5836, osa-MIR5516b, osa-MIR6250, osa-MIR6253, osa-MIR531c
Previous studies have also shown that many miRNAs (such as miR156, miR160, miR164, miR166, and miR172) are associated with flower development by regulating expression of the transcription factor genes (Aukerman and Sakai 2003; Achard et al. 2004; Wu et al. 2006; Oh et al. 2008; Shikata et al. 2009; Luo et al. 2013). [score:5]
The upregulation of miR172 may be one of the factors leading to fsv1 female abortion. [score:4]
For instance, ARF10 and ARF22 (of the ARF family) were targeted by miR172 in the comparison of A1 vs. [score:3]
B3, and many of them were targeted by miR160, miR164, miR171, and miR172. [score:3]
Terribly flawed flower organs and reduced fertility existed in the plants with overexpressed miR172 (Zhu et al. 2009). [score:3]
In rice, miR172 targets members of the AP2 family. [score:3]
[1 to 20 of 6 sentences]
16
[+] score: 21
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR390, osa-MIR444a, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR1432, zma-MIR390b, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, zma-MIR444a, osa-MIR6251
[58, 67, 68], most of them showed different expression patterns upon exposure to light (Additional file 14) except (a) miR156, miR166, miR172, which showed almost identical expression curves, and (b) miR171 and miR390, which showed shifted expression patterns. [score:7]
For those miRNAs that showed similar expression patterns between maize and rice, i. e., miR156, miR166, miR168, miR172, miR2275 and miR528, GO enrichment analysis of their predicted targets was applied (Additional file 13). [score:5]
miR172, regulator of seed development and phase change in shoot [67], showed drastic difference in responses during de-etiolation, i. e., it was barely detectable in maize while constantly expressed in rice during de-etiolation (Additional file 8). [score:5]
miR156, miR160, miR164, miR166, miR167, miR171, miR172, and miR390, had been earlier reported to play evolutionarily conserved roles in plant development [54]. [score:2]
Among these 8 miRNAs, miR156, miR172 and miR408 are conserved miRNA families between maize and rice. [score:1]
Many of them, i. e., miR156, miR160, miR164, miR166, miR167, miR171, miR172 and miR390, were suggested to play highly evolutionary conserved roles across plant species [54]. [score:1]
[1 to 20 of 6 sentences]
17
[+] score: 18
In Arabidopsis thaliana, GI regulates FT expression through multiple mechanisms: 1) GI binds to FLAVIN-BINDING, KELCH REPEAT, F BOX protein 1, leading to degradation of a key CO repressor (CYCLING DOF FACTOR 1), upregulation of the expression of CONSTANS (CO), and subsequent activation of FT expression [36, 37]; 2) GI regulates the expression levels of miRNA172, whose targets encode repressors of FT, such as TARGET OF EAT 1 and SCHLAFMUTZE [38, 39]; and 3) GI modulates the stability or promoter accessibility of various FT repressors [40], including SHORT VEGETATIVE PHASE [41], TEMPRANILLO (TEM) 1, and TEM2 [42] Accordingly, the dysfunctional allele at the E2 locus likely is required for photoperiod insensitivity in these soybean accessions. [score:18]
[1 to 20 of 1 sentences]
18
[+] score: 16
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR1520h, gma-MIR1520i, gma-MIR1520j, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR4406, gma-MIR169d, gma-MIR1520q, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR167k, gma-MIR167l, gma-MIR169w
Alternatively, the AP2 factors may not be detected as targets in the degradome data if translational repression by miR172 is operative as has been shown in Arabidopsis flower development [41]. [score:6]
We speculate that miR172 and/or its targets may be more abundant in the very young seed used by the Song et al. group [21] and not prevalent in the mid-maturation seed that we have examined. [score:3]
In Arabidopsis, miR172 has been reported to be involved in the regulation of flowering time and floral development [40]. [score:3]
One notable difference was the absence in our degradome data of miRNA172 targets which include members of the AP2 transcription factor family. [score:3]
From inspection of sequenced small RNA populations from the 50–75 mg seed coats and cotyledons of Williams [27], we find only a few occurrences of the miR172 family (less than 30 occurrences per million reads) while some family members of the miR156 family are highly abundant (99,000 per million) in the cotyledons. [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 16
Thus, in addition to the previously reported translational repressive effect of miR172 on the AP2 genes [37, 38], target cleavages of the AP2 transcripts may also play an indispensable role in floral organ development. [score:6]
Based on the TAIR annotations, five mimic genes, AT1G55860 regulating ath-miR159a, AT2G29070 regulating ath-miR172, AT1G77870 modulating ath-miR775, and AT4G02950 and AT4G03360 modulating ath-miR862-3p, were implicated in post-translational protein modification through a ubiquitin-related pathway (Figure 3A and Additional file 3: Table S3). [score:5]
Based on our computational approach, the target genes of miR172 belonging to the AP2 family were identified based on the significant cleavage signals within the target sites in Arabidopsis (Additional file 4: Figure S1 and Additional file 13: Figure S9). [score:5]
[1 to 20 of 3 sentences]
20
[+] score: 15
Employing 35S, Ubi, and ACTIN promoters, previous studies identified functions of many miRNAs and their target genes via expressing miRNA-resistant versions of target genes, such as 35S::mTCP2, 35S::mTCP3, 35S::mTCP4, 35S::mCUP1, and 35S::mCUP2 (Arabidopsis miR164 target genes) 42 43, 35S::mAP2 (Arabidopsis miR172 target gene) 44, 35S::mSlyARF10 (tomato miR160 target gene) 26, UBI:mGRF6 (rice miR396 traget gene) 45, as well as ACTIN:: mOSHB1, ACTIN:: mOSHB3 and ACTIN:: mOSHB5 (rice miR166 target genes) 46. [score:15]
[1 to 20 of 1 sentences]
21
[+] score: 13
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR393a, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR156a, mtr-MIR171a, mtr-MIR156b, mtr-MIR167a, mtr-MIR166b, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR171c, mtr-MIR398a, mtr-MIR172a, mtr-MIR393b, mtr-MIR398b, mtr-MIR168a, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR398c, mtr-MIR156h, mtr-MIR166f, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR396a, mtr-MIR396b, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR399p, osa-MIR169r, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR397, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR172a, sly-MIR172b, sly-MIR399, osa-MIR827, osa-MIR396f, mtr-MIR2118, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, mtr-MIR169k, mtr-MIR169j, mtr-MIR399q, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5072, mtr-MIR4414a, mtr-MIR4414b, mtr-MIR482, mtr-MIR172b, mtr-MIR172c, mtr-MIR171h, mtr-MIR168b, mtr-MIR399r, mtr-MIR156j, sly-MIR482e, sly-MIR482a, mtr-MIR167b, mtr-MIR168c, mtr-MIR408, mtr-MIR396c, mtr-MIR171g, stu-MIR6024, sly-MIR6024, stu-MIR482c, stu-MIR482b, stu-MIR482a, stu-MIR482d, stu-MIR482e, sly-MIR482b, sly-MIR482c, stu-MIR6025, stu-MIR6026, sly-MIR6026, sly-MIR168a, sly-MIR168b, mtr-MIR169i, mtr-MIR172d, mtr-MIR397, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, stu-MIR7980a, stu-MIR7983, stu-MIR8007a, stu-MIR8007b, stu-MIR7980b, stu-MIR399a, stu-MIR399b, stu-MIR399c, stu-MIR399d, stu-MIR399e, stu-MIR399f, stu-MIR399g, stu-MIR399h, stu-MIR3627, stu-MIR171b, stu-MIR166a, stu-MIR166b, stu-MIR166c, stu-MIR166d, stu-MIR171a, stu-MIR171c, stu-MIR399i, stu-MIR827, stu-MIR172b, stu-MIR172c, stu-MIR172a, stu-MIR172d, stu-MIR172e, stu-MIR156a, stu-MIR156b, stu-MIR156c, stu-MIR156d, stu-MIR171d, stu-MIR167c, stu-MIR167b, stu-MIR167a, stu-MIR167d, stu-MIR399j, stu-MIR399k, stu-MIR399l, stu-MIR399m, stu-MIR399n, stu-MIR399o, stu-MIR393, stu-MIR398a, stu-MIR398b, stu-MIR396, stu-MIR408a, stu-MIR408b, stu-MIR397, stu-MIR171e, stu-MIR156e, stu-MIR156f, stu-MIR156g, stu-MIR156h, stu-MIR156i, stu-MIR156j, stu-MIR156k, stu-MIR169a, stu-MIR169b, stu-MIR169c, stu-MIR169d, stu-MIR169e, stu-MIR169f, stu-MIR169g, stu-MIR169h, sly-MIR403, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR827, sly-MIR393, sly-MIR398a, sly-MIR399b, sly-MIR6025, sly-MIR169f, sly-MIR171f
Soybean miR172c targets the repressive AP2 transcription factor NNC1 to activate ENOD40 expression and regulate nodule initiation. [score:6]
Two recent studies independently found that miR172c modulates the rhizobium infection and nodule organization in both soybean and Lotus japonicus by targeting the transcription factor AP2 (Wang et al., 2014; Holt et al., 2015). [score:3]
micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules. [score:3]
Five miRNA families (miR399, miR156, miR166, miR171, and miR172) had more than 10 members, and miR156 family, the largest family, had 23 members. [score:1]
[1 to 20 of 4 sentences]
22
[+] score: 13
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, ath-MIR167d, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR396a, ath-MIR396b, ath-MIR398a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR437, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR531a, osa-MIR1425, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR531b, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1873, osa-MIR1862d, osa-MIR1862e, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR1862f, osa-MIR1862g, ath-MIR5021, osa-MIR5072, osa-MIR5077, ath-MIR156i, ath-MIR156j, osa-MIR531c
2 target ABC1 protein and Chloroplast 1-deoxy-d-xylulose-5-phosphate synthase; miR172c target APETALA2-like protein and Farnesyl pyrophosphate synthase; miR172c-5p Ethylene-Insensitive 2 isoform X2 and 4-Hydroxy-3-methylbut-2-enyl diphosphate reductase; miR156g. [score:5]
BLAST2GO helped in localization of predicted targets and KEGG (Kyoto Encyclopedia for Genes and Genomes) pathway analysis concluded that miR9662, miR894, miR172, and miR166 might be involved in regulating saponin biosynthetic pathway. [score:4]
Maximum variation was observed in the expression of miR172c-5p and miR398a-3p. [score:3]
5, miR894.6, miR9662a-3p, miR159.12, miR172c, miR167g-5p, miR167g. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 13
In addition to activation by CO, FT is regulated by GI through an independent pathway in Arabidopsis where GI upregulates microRNA172 which acts as a repressor of the APETALA 2 (AP2) domain gene TARGET OF EAT1 (TOE1) which in turn encodes a repressor of FT [56]. [score:6]
The position of the conserved miRNA172 target site is also shown. [score:3]
The TOE1 subfamily members have a smaller first AP2 domain due to an internal deletion of 10 amino acids and all contain a miR172 target site. [score:3]
FCA has also been shown to affect the level of miRNA172, providing a link to the photoperiod pathway in Arabidopsis [56]. [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 12
For example, miR172a, miR172b, miR172c and miR172d were studied individually for their expression and target prediction instead of studying miR172 family in general to emphasis different expression patterns of each family member. [score:7]
Among them regulation of ARF (miR160 and miR167), MYB (miR159), AP2 (miR172), HD-Zip III (miR166) and NAC (miR164) were confirmed experimentally [38, 39, 40, 41, 42]. [score:2]
We observed several miRNAs with prominent roles, such as miR160, mir159, miR528 and miR172, which can regulate important transcription factors and genes under different conditions (Fig 5). [score:2]
In addition to miRNAs that could be involved in ABA signaling, we observed response of miR172 that could be effective in ethylene signaling. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR393a, osa-MIR395d, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR414, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1846d, osa-MIR1853, osa-MIR1860, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5072, osa-MIR5078, osa-MIR5826
Other genes including miR156/157 -targeted SPLs and miR172 -targeted AP2, which might play important role in salinity tolerance, were also identified in this study. [score:5]
It was reported that miR156-regulated SPLs and miR172 -targeted AP2 conjointly conditioned the transitions among different developmental stages [85]. [score:5]
Regulation of flowering time and floral patterning by miR172. [score:2]
[1 to 20 of 3 sentences]
26
[+] score: 11
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR437, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, tae-MIR159b, tae-MIR167a, tae-MIR399, tae-MIR408, tae-MIR444a, osa-MIR1432, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1848, osa-MIR1858a, osa-MIR1858b, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1871, osa-MIR1862d, osa-MIR1862e, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR166a, tae-MIR167b, hvu-MIR168, tae-MIR395a, tae-MIR395b, hvu-MIR397a, tae-MIR398, tae-MIR444b, hvu-MIR166b, hvu-MIR444a, osa-MIR1862f, osa-MIR1862g, hvu-MIR399, hvu-MIR444b, hvu-MIR166c, tae-MIR396, tae-MIR167c, tae-MIR397, hvu-MIR397b, hvu-MIR156b
The miR172, miR394 and miR408 families, which are transcribed in rice and are believed to regulate an APETALA2 transcription factor [43], a F-box protein [19] and a plantacyanin [44], respectively, are abundantly expressed in our unprocessed dataset. [score:4]
Recent studies showed that miR172 acts downstream of miR156 and is regulated by miR156 [56]. [score:2]
Hence, wheat and Brachypodium, but not barley, miRNA candidates for members of the miR172, miR394 and miR408 families are listed in Table 2. The miR398 family, which is present in Arabidposis (3 members), rice (2 members), Brachypodium and wheat, is not present in our barley dataset. [score:1]
Hence, wheat and Brachypodium, but not barley, miRNA candidates for members of the miR172, miR394 and miR408 families are listed in Table 2. The miR398 family, which is present in Arabidposis (3 members), rice (2 members), Brachypodium and wheat, is not present in our barley dataset. [score:1]
In Arabidopsis miR172 is the most abundant miRNA [53], while in barley miR172 is 30 times less abundant than miR168 (Additional file 1). [score:1]
miR172 promotes flowering [43, 54, 55], but its targets are still poorly characterized. [score:1]
Specifically, the read similar to miR172 can be found (with ≤ 3 mismatches) in the Gypsy-class retrotransposon (Triticae Repeat Sequence Database entry TREP3208, Triticum aestivum sequence), the read that matches miR394 is similar to a number of Harbinger-class DNA transposon entries (e. g. TREP3044, Oryza sativa sequence) and the read that matches miR408 is similar to the Gypsy-class retrotransposon TREP2268 (Triticum durum sequence). [score:1]
[1 to 20 of 7 sentences]
27
[+] score: 10
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169f, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319b, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169f, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, osa-MIR529a, tae-MIR159a, tae-MIR159b, tae-MIR171a, tae-MIR1120a, osa-MIR1430, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR166n, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR397a, zma-MIR397b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, hvu-MIR168, hvu-MIR171, hvu-MIR397a, tae-MIR171b, hvu-MIR1120, hvu-MIR166b, osa-MIR3981, hvu-MIR166c, tae-MIR1120b, tae-MIR397, tae-MIR1120c, hvu-MIR397b, hvu-MIR156b
However, there are examples of translation suppression without mRNA cleavage, as has been shown for the ath-miR172-triggered downregulation of APETALA2 expression level [29]. [score:10]
[1 to 20 of 1 sentences]
28
[+] score: 10
In the leaves at early and middle stages of grain-filling, the expression of osa-miR172a, osa-miR172c and osa-miR172d was significantly higher in the resistant cultivar N2Y6 than in the senescence-susceptible cultivar LYP9 (Table S2), decreasing the expression of AP2-like factor gene (Table S6), by which leaf senescence of N2Y6 could be delayed. [score:5]
In the present study, three members of the miR172 family targeting genes of AP2-like factors, osa-miR172a, osa-miR172c and osa-miR172d, were identified in the leaves of rice (Table 3, Table S5). [score:3]
In conclusion, we found six miRNA families, osa-miR159, osa-miR160, osa-miR164, osa-miR167, osa-miR172 and osa-miR1848, were involved in the leaf senescence through phytohormone signaling pathway in rice. [score:1]
This may be one of the mechanisms of osa-miR159, osa-miR167 and osa-miR172 mediated senescence-resistance through ABA -dependent pathway. [score:1]
[1 to 20 of 4 sentences]
29
[+] score: 9
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR414, osa-MIR419, osa-MIR435, osa-MIR390, osa-MIR396e, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1426, osa-MIR169r, osa-MIR1436, osa-MIR1440a, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ctr-MIR156, ctr-MIR166, ctr-MIR319, ctr-MIR164, ctr-MIR167, ctr-MIR171, osa-MIR395x, osa-MIR395y, osa-MIR1440b
It has been confirmed that miR172 targets the mRNA coding for APETALA2-like transcription factors, an important gene known for controlling flower development [36- 38]. [score:4]
We also found homologs of known miRNA target genes for several conserved C. trifoliata miRNAs, such as SBP for miR156, ATP synthase for miR159, ARF for miR160, NAC for miR164, HD-Zip for miR165 and miR166, Anthocyanidin synthase for miR169, GRAS for miR171, AP2 for miR172, TCP for miR319, TIR for miR393, F-box for miR394, Sulfate transporter 2.1 for miR395, IRX12 copper ion binding/oxidoreductase for miR397, ARGONAUTE 2 for miR403, Basic blue copper protein for miR408 and Zinc finger protein-related for miR414. [score:3]
Among the 42 miRNA families, the miR172 family had the most reads, accounting for 22.5% of the conserved miRNA reads. [score:1]
Additionally, fifteen miRNA families namely miR156, miR159, miR160, miR162, miR164, miR166, miR167, miR168, miR169, miR171, miR172, miR390, miR394, miR403, and miR1446, were found to have some thousands to tens of thousands of redundancies while four families (miR395, miR396, miR397, miR414, and miR827), had more than one hundred redundancies. [score:1]
[1 to 20 of 4 sentences]
30
[+] score: 9
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR810a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR820a, osa-MIR1423, osa-MIR1425, osa-MIR1432, osa-MIR169r, osa-MIR810b, osa-MIR1436, osa-MIR1441, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR812f, osa-MIR1873, osa-MIR1862d, osa-MIR1862e, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR827, osa-MIR396f, osa-MIR2873a, osa-MIR2878, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR1862f, osa-MIR1862g, osa-MIR812n, osa-MIR812o, osa-MIR2873b, osa-MIR5071, osa-MIR5074, osa-MIR5075, osa-MIR5077, osa-MIR5080, osa-MIR5081, osa-MIR5144, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR5795, osa-MIR812s, osa-MIR5802, osa-MIR812t, osa-MIR812u, osa-MIR5805, osa-MIR812v, osa-MIR5807, osa-MIR2873c, osa-MIR6253, osa-MIR1861o
Expression profiles from both studies clearly show consistency in identifying the highly expressed and lowly expressed members, especially for 10 conserved miRNA families (MIR156, MIR160, MIR162, MIR164, MIR166, MIR167, MIR168, MIR171, MIR172 and MIR396). [score:7]
However when the results of both these studies were compared, only 5 miRNAs (miR156, miR159, miR169, miR172 and miR408) were found to be commonly regulated by drought stress. [score:1]
as high [transcripts per million (TPM) > 10000/100000; osa-MIR168, osa-MIR156, osa-MIR166], moderate (TPM = 100–10000; osa-MIR167, osa-MIR397, osa-MIR408, osa-MIR159, osa-MIR164, osa-MIR172, osa-MIR396) and low (TPM < 100; osa-MIR160, osa-MIR162, osa-MIR169, osa-MIR171, osa-MIR390, osa-MIR393, osa-MIR394, osa-MIR395, osa-MIR398, osa-MIR399, osa-MIR827). [score:1]
[1 to 20 of 3 sentences]
31
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR827, osa-MIR396f, bdi-MIR171a, bdi-MIR167a, bdi-MIR397a, bdi-MIR156a, bdi-MIR172d, bdi-MIR166a, bdi-MIR171c, bdi-MIR169b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, bdi-MIR169d, bdi-MIR169i, bdi-MIR395a, bdi-MIR169j, bdi-MIR166f, bdi-MIR171b, bdi-MIR390a, bdi-MIR160a, bdi-MIR528, bdi-MIR395b, bdi-MIR166d, bdi-MIR171d, bdi-MIR167b, bdi-MIR166b, bdi-MIR160b, bdi-MIR164b, bdi-MIR167c, bdi-MIR396d, bdi-MIR169k, bdi-MIR168, bdi-MIR160c, bdi-MIR396c, bdi-MIR167d, bdi-MIR156b, bdi-MIR169g, bdi-MIR160d, bdi-MIR160e, bdi-MIR396e, bdi-MIR156c, bdi-MIR172a, bdi-MIR396a, bdi-MIR166e, bdi-MIR166c, bdi-MIR169e, bdi-MIR394, bdi-MIR398a, bdi-MIR164a, bdi-MIR393a, bdi-MIR169a, bdi-MIR172b, bdi-MIR156d, bdi-MIR393b, bdi-MIR169h, bdi-MIR396b, bdi-MIR169c, bdi-MIR395c, bdi-MIR827, bdi-MIR166g, bdi-MIR319a, bdi-MIR395d, bdi-MIR398b, bdi-MIR164c, bdi-MIR169f, bdi-MIR162, bdi-MIR164e, bdi-MIR164f, bdi-MIR395m, bdi-MIR395e, bdi-MIR395f, bdi-MIR395g, bdi-MIR395h, bdi-MIR395j, bdi-MIR395k, bdi-MIR395l, bdi-MIR395n, bdi-MIR529, bdi-MIR319b, bdi-MIR397b, bdi-MIR156e, bdi-MIR156f, bdi-MIR156g, bdi-MIR156h, bdi-MIR156i, bdi-MIR166h, bdi-MIR166i, bdi-MIR167e, bdi-MIR395o, bdi-MIR395p, bdi-MIR156j, bdi-MIR160f, bdi-MIR166j, bdi-MIR167f, bdi-MIR167g, bdi-MIR169l, bdi-MIR169m, bdi-MIR169n, bdi-MIR171e, bdi-MIR171f, bdi-MIR395q
The result showed that the expression of both miR172 and miR397 was up-regulated under the cold treatment (Figure 4). [score:6]
MiR164, miR166 and miR172 were represented by two variants and miR169 was represented by four variants in the library (Table 2). [score:1]
Then, miR169 and miR172 were found to be responsive to cold stress in Arabidopsis both through a computational, transcriptome -based approach and by microarray analysis almost simultaneously [17, 18]. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 8
Other miRNAs from this paper: osa-MIR172a, osa-MIR172b, osa-MIR172d
The AP2 subfamily genes function mainly during flower development [16, 17], and their expression is regulated by the microRNA miR172 [18]. [score:5]
The four physic nut AP2 subfamily genes all contained a target site for miR172 (JcAP2-13: ctgcagcatcatcatgattcg; JcAP2-14: ctgcagcatcatcaggattcc; JcAP2-15 and -16: ctgcagcatcatcaggattct) (Fig 1A) which is conserved across AP2 orthologs form higher plants [18] (Fig 1). [score:3]
[1 to 20 of 2 sentences]
33
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156c, osa-MIR172a, osa-MIR172b, osa-MIR172d
Cly1 contains a putative microRNA (miR172) target site, which suggests that it is potentially regulated by miR172. [score:4]
Sequence variations at three base positions within the miR172 target sequence are found in 274 barley varieties (Nair et al., 2010). [score:3]
In noncleistogamous varieties, the C yl1 mRNA is degraded by miR172 to allow the lodicules to swell; in contrast, the Cly1 mRNA is not cleaved by miR172 causing the failure of the lodicules to expand in cleistogamous varieties (Wang et al., 2015). [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 7
In rice, miR172 was found to be highly expressed in the late vegetative stages and developing panicles. [score:3]
Among the heading date-related miRNAs, miR172 has been reported to be conserved and involved in flowering time and floral patterning by targeting AP2-like transcription factors across the monocotyledons and dicotyledons (30–32). [score:3]
For example, miR172, miR397 and miR156 that were previously discovered to associate with certain agronomic traits could also be identified in this database. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 7
In rice, miR172 targets and regulates AP2 family member genes, and the floral organs display serious developmental defects that lead to a significant reduction in fertility in miR172 -overexpressing mutant plants (Zhu et al. 2009). [score:7]
[1 to 20 of 1 sentences]
36
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1514a, gma-MIR1514b, gma-MIR1536, gma-MIR1530, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR398d, gma-MIR167k, gma-MIR167l, gma-MIR169w
It should be noted that many targets of a single conserved miRNA are in pairs with very similar sequences, and the gma-miR156, gma-miR160, gma-miR164, gma-miR166, gma-miR172 and gma-miR396 had at least 10 targets, with the gma-miR396 having more than 20 targets (Table 3). [score:7]
[1 to 20 of 1 sentences]
37
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR164f, osa-MIR390, osa-MIR439a, osa-MIR439b, osa-MIR439c, osa-MIR439d, osa-MIR439e, osa-MIR439f, osa-MIR439g, osa-MIR439h, osa-MIR439i, osa-MIR396e, osa-MIR444a, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR171a, tae-MIR399, tae-MIR408, tae-MIR444a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, tae-MIR156, tae-MIR319, tae-MIR167b, tae-MIR169, tae-MIR444b, tae-MIR171b, tae-MIR396, tae-MIR167c, tae-MIR397
Twelve conserved miRNA families (miR156/157, miR159/319, miR160, miR164, miR165/166, miR167, miR169, miR170/171, miR172 and miR444) have been predicted to target 24 transcription factors, including squamosa promoter binding proteins, MYB, NAC1, homeodomain-leucine zipper protein, auxin response factor, CCAAT -binding protein, scarecrow-like protein, APETELA2 protein and MADS box protein (Additional data file 2). [score:3]
Furthermore, our analysis revealed that the library included all known members of several miRNA families: miR156, miR159, miR167, miR169, miR168, miR171 and miR172. [score:1]
These include miRNA156/157, miR159, miR160, miR164, miR165/166, miR167, miR168, miR169, miR170/171, miR172, miR319, miR390, miR393, miR396, miR397, miR399 and miR408, which are conserved in diverse plant species (Table 2). [score:1]
MiR169 was represented by five members, miR156, miR165/166, miR167, miR170/171 and miR172 were represented by three members each, and miR159, miR319 and miR168 were represented by two members each in the library. [score:1]
Similarly, miR172n and miR172a appeared 186 and 126 times, respectively, whereas miR172c appeared only 14 times. [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 7
A random subset of the conserved and less-conserved miRNAs was analyzed with RNA blot to validate the expression data from the deep sequencing, utilizing miR172 as a standard (Figure 2a). [score:3]
MiR172 was chosen as the loading control throughout all RNA blots in this study instead of peach U6 because the U6 proved to be expressed at a substantially lower level in the ripest fruit tissue in these experiments. [score:2]
We quantified the changes in transcription of the specific miRNAs among tissues by relative transcription activity (RTA) of miRC1 and miRC26, in regard to miR172 as the loading control. [score:1]
Based on the expression of the control RNA miR172, the processing efficiency is calculated and presented below the blots. [score:1]
[1 to 20 of 4 sentences]
39
[+] score: 6
Soybean miR172c targets the repressive AP2 transcription factor NNC1 to activate ENOD40 expression and regulate nodule initiation. [score:6]
[1 to 20 of 1 sentences]
40
[+] score: 6
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR444a, osa-MIR528, osa-MIR530, osa-MIR531a, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR1429, osa-MIR1431, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR531b, osa-MIR1857, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR812f, osa-MIR1862d, osa-MIR1862e, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1883a, osa-MIR1883b, osa-MIR1320, osa-MIR827, osa-MIR1846e, osa-MIR2121a, osa-MIR2864, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR1862f, osa-MIR1862g, osa-MIR3979, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR5083, osa-MIR5143a, osa-MIR5156, osa-MIR5513, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR6248, osa-MIR6249a, osa-MIR531c
The target genes of miR156, miR159, miR169, and miR172 are categorized into different transcription factor families – SBP, MYB, CBF, bZIP – which further regulate gene expression and signal transduction and probably play roles in stress responses [35]. [score:6]
[1 to 20 of 1 sentences]
41
[+] score: 6
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166d, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR396e, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818b, osa-MIR169r, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
Several miRNAs have been reported to regulate drought-responsive genes [10, 15, 16], and it has been shown that rice miR159, miR169, miR395 and miR474 are drought-inducible, while the expression of miR156, miR168, miR170, miR172, miR396, miR397 and miR408 is suppressed by drought [13, 16]. [score:6]
[1 to 20 of 1 sentences]
42
[+] score: 6
MicroRNA172 (miRNA172) governs floral organ development and organ size by inhibiting translation of APETALA2 (AP2) (Yao et al., 2015). [score:6]
[1 to 20 of 1 sentences]
43
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5083, ppe-MIR171f, ppe-MIR394a, ppe-MIR828, ppe-MIR171h, ppe-MIR171a, ppe-MIR171e, ppe-MIR169e, ppe-MIR319a, ppe-MIR319b, ppe-MIR171g, ppe-MIR171b, ppe-MIR171c, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR159, ppe-MIR160a, ppe-MIR160b, ppe-MIR162, ppe-MIR164a, ppe-MIR164b, ppe-MIR164c, ppe-MIR164d, ppe-MIR166a, ppe-MIR166b, ppe-MIR166c, ppe-MIR166d, ppe-MIR166e, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR168, ppe-MIR169a, ppe-MIR169b, ppe-MIR169c, ppe-MIR169d, ppe-MIR169f, ppe-MIR169g, ppe-MIR169h, ppe-MIR169i, ppe-MIR169j, ppe-MIR169k, ppe-MIR169l, ppe-MIR171d, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR390, ppe-MIR393a, ppe-MIR393b, ppe-MIR394b, ppe-MIR396a, ppe-MIR396b, ppe-MIR397, ppe-MIR399a, ppe-MIR399b, ppe-MIR399c, ppe-MIR399d, ppe-MIR399e, ppe-MIR399f, ppe-MIR399g, ppe-MIR399h, ppe-MIR399i, ppe-MIR399j, ppe-MIR399k, ppe-MIR399l, ppe-MIR399m, ppe-MIR399n, ppe-MIR403, ppe-MIR827, ppe-MIR858
The largest number of targets was shown by miR156, miR172 and miR396, with 25, 21 and 22, respectively. [score:3]
In addition, 11 miRNA families (miR162, miR164, miR167, miR168, miR169, miR172, miR393, miR394, miR397, miR399 and miR827) shared a high conservation in both dicotyledons and monocotyledons. [score:1]
The abundance of miRNA families also varied drastically: miR157, miR166 and miR156 were most frequently represented in the library, with 154,908, 79,863 and 73,043 reads, whereas miR172, miR167, miR168 and miR396 were moderately abundant in the library with 6,411, 5,280, 4,373 and 2,500 copies. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 5
Moreover, post-transcriptional regulation by miRNAs and their targets was found to regulate panicle branching (Wang L. et al., 2015), as demonstrated by the loss of function of maize miR172 which caused a loss of spikelet determinacy and an excessive number of branches (Chuck et al., 2007). [score:5]
[1 to 20 of 1 sentences]
45
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, zma-MIR156l, zma-MIR166n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR482, zma-MIR1432, osa-MIR395x, osa-MIR395y
The miR172 was reported to target APETALA2 floral homeotic transcription factor that is required for spikelet meristem determination [28]. [score:3]
Also, miR172 functions in promoting vegetative phase transition by regulating the APETALA2-like gene glossy15 [29]. [score:2]
[1 to 20 of 2 sentences]
46
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
However, miRNA156, miRNA159 and miR172 targeted more than one gene family. [score:3]
miR396, miR166, miR172, miR169 and miR395 were also present at multiple loci in date palm, and these miRNAs had the highest average copy number in the other plant species. [score:1]
In the miR164, miR172 and miR395 families, all miRNA members were involved in duplication events. [score:1]
[1 to 20 of 3 sentences]
47
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1427, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR5485, osa-MIR5486, osa-MIR5487, osa-MIR5488, osa-MIR5492, osa-MIR5497, osa-MIR5509, osa-MIR2275c, osa-MIR5517, osa-MIR2275d, osa-MIR5528, osa-MIR5791, osa-MIR5792, osa-MIR5793, osa-MIR5796, osa-MIR5797, osa-MIR5800, osa-MIR5806, osa-MIR5818, osa-MIR5179
Regulation of flowering time and floral patterning by miR172. [score:2]
miR172 was reported to control flowering time and floral organ identity in both monocotyledons and dicotyledons with differing morphological outcomes in different species [31]. [score:1]
miR156 acts upstream of miR172 by repressing SQUAMOSA promoter binding protein-like (SPLs) transcription factor genes, whose encoded products are the transcriptional activators of miR172. [score:1]
miR156 and miR172 are two well-studied miRNAs in floral control. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 5
Zhu Q Upadhyaya NM Gubler F Helliwell CAOver -expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa)BMC Plant Biol. [score:3]
Some novel miRNAs have been reported to regulate the pollen and spikelet fertility, such as miR159, miR172, miR319 and miR397 [20– 23]. [score:2]
[1 to 20 of 2 sentences]
49
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR160f, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR1127a, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2275a, osa-MIR2275b, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, tae-MIR167b, hvu-MIR168, hvu-MIR169, tae-MIR169, hvu-MIR397a, tae-MIR398, tae-MIR171b, hvu-MIR166b, hvu-MIR166c, osa-MIR2275c, osa-MIR2275d, tae-MIR1122b, tae-MIR9653a, tae-MIR9654a, tae-MIR9656, tae-MIR9657a, tae-MIR9659, tae-MIR9660, tae-MIR1127b, tae-MIR9661, tae-MIR396, tae-MIR9665, tae-MIR2275, tae-MIR9667, tae-MIR167c, tae-MIR1120b, tae-MIR397, tae-MIR1130b, tae-MIR5384, tae-MIR9675, tae-MIR1120c, tae-MIR9679, tae-MIR9657b, hvu-MIR397b, hvu-MIR156b, tae-MIR9653b
Of the 15 known miRNA families, 8 (miR396, miR168, miR156, miR172, miR159, miR398, miR1318 and miR167) showed different levels of preferential expression in wheat flag leaves, with the logarithm of the fold changes ranged from 0.5 to 5.2 as well as more than those in the developing seeds (Figure  3a, Table  2). [score:3]
The highest read abundance (approximately 238,000 RPM) was detected in the miR168 family and was 3.8 to 78 times more abundant than the other miRNA families, including miR156, miR166, miR167 and miR172, whose abundance ranged from about 2,900 RPM to 62,000 RPM (Table  2). [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 4
Additionally, it has been found that miRNA172 can control flowering time by down -regulating APETALA2-like target genes in Arabidopsis (Chen, 2004). [score:4]
[1 to 20 of 1 sentences]
51
[+] score: 4
The target of miR172 is APETALA2 (AP2) (Karlova et al., 2013), which is a negative regulator of tomato fruit ripening (Chung et al., 2010; Karlova et al., 2011). [score:4]
[1 to 20 of 1 sentences]
52
[+] score: 4
SPL9 and SPL10 mediated the transition from high levels of miR156 to high levels of miR172 through direct activation of miR172 expression, thereby promoting the juvenile to adult phase transition [57, 62]. [score:4]
[1 to 20 of 1 sentences]
53
[+] score: 4
A similar study showed that miR156, miR166, miR171, miR172, miR319, miR164 along with their target genes, were differentially expressed in stress-tolerant maize hybrids compared with stress-sensitive lines [52]. [score:4]
[1 to 20 of 1 sentences]
54
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, osa-MIR414, osa-MIR437, osa-MIR390, osa-MIR440, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR531a, osa-MIR529b, osa-MIR1425, osa-MIR1427, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR1439, osa-MIR531b, osa-MIR1846d, osa-MIR1848, osa-MIR1850, osa-MIR1846a, osa-MIR1846b, osa-MIR1859, osa-MIR1860, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1863a, osa-MIR1864, osa-MIR1865, osa-MIR1871, osa-MIR1874, osa-MIR1862d, osa-MIR1876, osa-MIR1862e, osa-MIR1878, osa-MIR1879, osa-MIR1319a, osa-MIR1846c, osa-MIR2055, osa-MIR1846e, osa-MIR2096, osa-MIR396f, osa-MIR2106, osa-MIR2120, osa-MIR2275a, osa-MIR2275b, osa-MIR2863a, osa-MIR2863b, osa-MIR2872, osa-MIR2875, osa-MIR2876, osa-MIR2877, osa-MIR2878, osa-MIR1863c, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR1863b, osa-MIR1862f, osa-MIR1862g, osa-MIR3979, osa-MIR3981, osa-MIR5072, osa-MIR5073, osa-MIR5076, osa-MIR5079a, osa-MIR5082, osa-MIR5083, osa-MIR2863c, osa-MIR5150, osa-MIR5151, osa-MIR5155, osa-MIR5160, osa-MIR5161, osa-MIR5162, osa-MIR5484, osa-MIR5504, osa-MIR5505, osa-MIR5513, osa-MIR2275c, osa-MIR2275d, osa-MIR5788, osa-MIR5792, osa-MIR5809, osa-MIR5812, osa-MIR1319b, osa-MIR6246, osa-MIR6250, osa-MIR6253, osa-MIR5079b, osa-MIR531c
Another such, miRNA172, regulates AP2 domain-containing protein, which regulates the development of shoot meristems (Licausi et al., 2013). [score:4]
[1 to 20 of 1 sentences]
55
[+] score: 3
Other miRNAs from this paper: osa-MIR172a, osa-MIR172b, osa-MIR172d
Plant Signal Behav 7. 30 Cho HJ, Kim JJ, Lee JH, Kim W, Jung JH, et al (2012) SHORT VEGETATIVE PHASE (SVP) protein negatively regulates miR172 transcription via direct binding to the pri-miR172a promoter in Arabidopsis. [score:3]
[1 to 20 of 1 sentences]
56
[+] score: 3
The sequential action of MIR156 and MIR172 regulates developmental timing in Arabidopsis. [score:3]
[1 to 20 of 1 sentences]
57
[+] score: 3
Furthermore, research on the barley genome identified a microRNA binding site of HvAP2 gene that affected the shape and size of the spike, showing that once mutation occurs in the binding site of microRNA, it will change the binding ability with microRNA172 and ultimately alter the expression of HvAP2 gene to generate more grains (Houston et al. 2013). [score:3]
[1 to 20 of 1 sentences]
58
[+] score: 3
For instance, miR160, miR164 and miR172 showed a positive correlation with their targets in rice [51]. [score:3]
[1 to 20 of 1 sentences]
59
[+] score: 3
Other miRNAs from this paper: osa-MIR172a, osa-MIR172b, osa-MIR172d
The suppression of WRKY44 by GIGANTEA-miR172 pathway is involved in drought response of Arabidopsis thaliana. [score:3]
[1 to 20 of 1 sentences]
60
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
The expression of miR156, miR159, miR160, miR166, miR168, miR169, miR393, and miR827 is increased, while miR172 is significantly repressed under heat stress in wheat (Xin et al., 2010). [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR444a, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1423, osa-MIR1425, osa-MIR1427, osa-MIR1428a, osa-MIR1429, osa-MIR1430, osa-MIR1431, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR810b, osa-MIR1435, osa-MIR1436, osa-MIR1437a, osa-MIR1440a, osa-MIR1441, osa-MIR1442, osa-MIR1439, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1440b, osa-MIR818f, osa-MIR1437b
Similarly two other miRNAs, miR172 and miR167, are represented by 2 members each, and were expressed at a similar abundance (Table 4). [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 3
NaCl -induced changes observed in the miRNA abundance in several miRNA families, particularly miR172, miR408, miR399, miR166, miR165 and miR535 (Fig.   1), is indicative of an altered metabolism in the test plant in the presence of salt, which was also observed in other studies, including halophytes and non-halophytes [27, 57]. [score:1]
The miR162, miR398, miR169, miR172, miR171 and miR167 miRNA families revealed five or more but less than ten representations, and the remaining miRNA families were represented by less than five miRNAs. [score:1]
The reverse was true for other miRNAs, such as miR156a, miR159a, miR159c, miR168a, miR169a, miR169b, miR171b, miR172c, miR319a and miR398a (Fig.   2a, b) [58]. [score:1]
[1 to 20 of 3 sentences]
63
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Over -expression of rice miR172 results in loss of spikelet determinacy and flower abnormalities [37]. [score:3]
[1 to 20 of 1 sentences]
64
[+] score: 2
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR394a, ath-MIR394b, ath-MIR396a, ath-MIR396b, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, ath-MIR403, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR396e, ath-MIR856, ath-MIR858a, osa-MIR169r, osa-MIR396f, ath-MIR2111a, ath-MIR2111b, osa-MIR396g, osa-MIR396h, osa-MIR396d, ath-MIR858b, ath-MIR156i, ath-MIR156j
The abundance of miR172 was 20 times low as compared to miR156 in our dataset which is consistent with the previous finding that these two miRNAs are conversely regulated [36]. [score:1]
miR156, miR159, miR167, miR319, miR396 and miR172 possessed 5, 8, 10, 8, 7 and 6 members respectively whereas other miRNA families such as miR157, miR160, miR169, miR858, miR894, miR2111 etc. [score:1]
[1 to 20 of 2 sentences]
65
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR435, osa-MIR390, osa-MIR396e, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR162a, ptc-MIR162b, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR393a, ptc-MIR393b, ptc-MIR393c, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR397a, ptc-MIR397b, ptc-MIR397c, ptc-MIR403a, ptc-MIR403b, ptc-MIR408, ptc-MIR477e, ptc-MIR477f, ptc-MIR474a, ptc-MIR474b, ptc-MIR474c, ptc-MIR475a, ptc-MIR475b, ptc-MIR475c, ptc-MIR475d, ptc-MIR476a, ptc-MIR476b, ptc-MIR477a, ptc-MIR477b, ptc-MIR478a, ptc-MIR478b, ptc-MIR478c, ptc-MIR478d, ptc-MIR478e, ptc-MIR478f, ptc-MIR478h, ptc-MIR478i, ptc-MIR478j, ptc-MIR478k, ptc-MIR478l, ptc-MIR478m, ptc-MIR478o, ptc-MIR478p, ptc-MIR478q, ptc-MIR478r, ptc-MIR478s, ptc-MIR478n, ptc-MIR481a, ptc-MIR481b, ptc-MIR481c, ptc-MIR481d, ptc-MIR482a, ptc-MIR171k, ptc-MIR403c, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR477c, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR477d, ptc-MIR482c, ptc-MIR828a, ptc-MIR828b, ptc-MIR403d
Several Arabidopsis and rice families such as miR156/157, miR159/319, miR162, miR172, miR396, miR397, miR473, and miR475 are nearly double in size in Populus. [score:1]
For families miR156/157, miR159, miR319, miR162, miR172, miR396, miR397, miR473, miR475 and miR482, the number of members identified in this study was at least twice that reported previously [3, 26] (Fig. 2). [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 2
Arabidopsis miR172, miR159, miR156 and miR171 regulate flowering time and floral patterning [2], [7], [8]. [score:2]
[1 to 20 of 1 sentences]
67
[+] score: 2
GI has multiple roles, including directly interacting with miR172 to control phase change independent of photoperiod (Jung et al. 2007) and with CONSTANS (CO) in the main photoperiodic flowering time pathway (Hayama et al. 2003). [score:2]
[1 to 20 of 1 sentences]
68
[+] score: 2
59Schwab R (2012b) Roles of miR156 and miR172 in Reproductive Development. [score:2]
[1 to 20 of 1 sentences]
69
[+] score: 2
Likewise, the miR172-AP2-1 node acts as a key regulator of nitrogen fixation in the symbiotic relationship of Phaseolus vulgaris– Rhizobium etli (Nova-Franco et al., 2015). [score:2]
[1 to 20 of 1 sentences]
70
[+] score: 1
Most of the SmiRNAs have been reported to be involved in rice grain-filling, including osa-miR444b, osa-miR1861, osa-miR172c, osa-miR1862 and so on [28] (Fig.   3A). [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
Six miRNA families, osa-miR159, osa-miR160, osamiR164, osa-miR167, osa-miR172, and osa-miR1848, were shown to be associated with the rice leaf senescence processes through hormone signaling pathways. [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR394a, ath-MIR394b, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ath-MIR827, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
The abundance of zma-miR172 was extremely low compared to that of zma-miR156 in our dataset, which was consistent with previous finding that these two miRNAs are conversely regulated. [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
It is interesting to note that those MIRNA genes (e. g. miR158, miR159/319, miR164, miR167, miR168, miR172) whose transcripts accumulate in post-transcriptional processing mutants [80], [114], [116] also produce abundant smRNAs (Datafile S2) [14]. [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
Furthermore, miR1139 and miR172 were only shared by the bread and durum wheat loci on the 3B chromosomes, not the wild emmer wheat. [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
In Arabidopsis, the miRNA families miR159, miR167, miR172, miR173, and miR394 are iron deficiency responsive (Waters et al., 2012). [score:1]
[1 to 20 of 1 sentences]
76
[+] score: 1
2 LOC_Os01g02700 Probable receptor-like protein kinase LOC_Os01g02400 Probable receptor-like protein kinase LOC_Os02g17710 Probable leucine-rich repeat receptor-like protein kinase LOC_Os06g05050 Wall -associated receptor kinase 3 LOC_Os11g40970 Probable LRR receptor-like serine/threonine-protein kinase osa-miR159b LOC_Os10g04730 Cysteine-rich receptor-like protein kinase 5 LOC_Os11g40970 Probable LRR receptor-like serine/threonine-protein kinase osa-miR159d LOC_Os09g29520 Wall -associated receptor kinase 3 LOC_Os10g04730 Cysteine-rich receptor-like protein kinase 5 LOC_Os11g40970 Probable LRR receptor-like serine/threonine-protein kinase osa-miR159e LOC_Os09g29520 Wall -associated receptor kinase 3 LOC_Os10g04730 Cysteine-rich receptor-like protein kinase 5 LOC_Os11g40970 Probable LRR receptor-like serine/threonine-protein kinase osa-miR164a LOC_Os06g38340 Probable LRR receptor-like serine/threonine-protein kinase LOC_Os12g43410 Thaumatin-like protein LOC_Os02g57280 Brown planthopper -induced resistance protein 5 LOC_Os11g40970 Probable LRR receptor-like serine/threonine-protein kinase osa-miR164f LOC_Os06g38340 Probable LRR receptor-like serine/threonine-protein kinase LOC_Os12g43410 Thaumatin-like protein LOC_Os02g57280 Brown planthopper -induced resistance protein 4 LOC_Os11g40970 Probable LRR receptor-like serine/threonine-protein kinase LOC_Os12g43410 Thaumatin-like protein LOC_Os02g57280 Brown planthopper -induced resistance protein 3 osa-miR172c LOC_Os12g16540 Wall -associated receptor kinase 3 LOC_Os01g53020 heat shock protein DnaJ osa-miR172d-3p LOC_Os12g16540 Wall -associated receptor kinase 3 LOC_Os01g53020 heat shock protein DnaJ LOC_Os02g57280 Brown planthopper -induced resistance protein 2 osa-miR396c-3p LOC_Os04g21820 Wall -associated receptor kinase 5 osa-miR444a-5p LOC_Os02g57280 Brown planthopper -induced resistance protein 1 osa-miR444c. [score:1]
[1 to 20 of 1 sentences]
77
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
In Arabidopsis, the two candidates are the miRNA* sequences of MIR172 precursors. [score:1]
[1 to 20 of 1 sentences]