sort by

20 publications mentioning hsa-mir-450a-1

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-450a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 52
Other miRNAs from this paper: hsa-mir-450a-2
Overall, these data confirm miR-450a expression in the mammalian eye, suggest that miR-450a plays a regulatory role in eye development and supports the predicted linkage of the miRNA to eye diseases. [score:7]
Three predicted targets of miR-450a - Dusp10, Amd1/2, and Znf385a - are significantly close to genes of numerous different eye-specific diseases in the network. [score:5]
Results produced using RIDDLE to match predicted targets of miR-450a with OMIM disease genes. [score:5]
RIDDLE discovered this functional association without any knowledge of the expression patterns of miR-450a or the predicted targets. [score:5]
Figure 8 Predicted targets of miR-450a and ocular disease genes are disjoint, yet functionally associated. [score:5]
Quantitative real-time PCR experiments show expression of miR-450a's predicted targets to be lower during these stages (Figure 8c). [score:5]
We also note that this association relied entirely on RIDDLE's use of network connectivity, as no genes were shared between the miR-450a targets and the disease pathways (Figure 8a). [score:5]
For example, miR-450a targets are completely disjoint with macular dystrophy genes and share only a single direct connection (Figure 8a). [score:4]
We performed an additional Northern analysis on total RNA from mouse eyes across various stages of development and found that, consistent with a role in the developing eye, miR-450a is expressed from embryonic day 13 (E13) to postnatal day 7 (P7), peaking near E17, and undetectable in adult eyes (Figure 8b). [score:4]
The homologue of miR-450a is already known to be expressed in the cornea in mouse [36]. [score:3]
Four of the top six disease matches for miR-450a are eye-specific (Table 2). [score:3]
Probe sequences used were: U6, CGTTCCAATTTTAGTATATGTGCTGCC; miR-450a, ATATTAGGAACACATCGCAAAA. [score:1]
[1 to 20 of 12 sentences]
2
[+] score: 10
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
The miR-30a, miR-142-5p and miR-450a have roles in metastatic breast and colon cancer [61] and the miR-151-3p can enhance hepatocellular carcinoma cell mobility [66]. [score:1]
[1 to 20 of 2 sentences]
3
[+] score: 9
- In, miR-448 (position 7), miR-450 (position 8), and miR-202 (position 11) show up-regulation; miR-453 (position 6) is a borderline case, although the Western blot suggests that it could be classified as a true positive. [score:4]
5 miRs from the 23 targets that were predicted only by HuMiTar and which are not included in the PicTar's database, i. e. miR-202, miR-248, miR-412, miR-453, and miR-450. [score:3]
Analysis of 39 miRs that were predicted exclusively by HuMiTar shows that 11 of them (miR-101, miR-126, miR-129, miR-134, miR-144, miR-151, miR-202, miR-384, miR-412, miR-450, miR-453) are included in the Western blot on Figure 3. Among them, nine are true positives, miR-453 is a borderline case, and miR-412 is a false positive. [score:1]
The Septin7 expression levels were measured (left to right) for (1) control sample, (2) miR-127, (3) miR-182, (4) miR-412, (5) miR-19a, (6) miR-453, (7) miR-448, (8) miR-450, (9) miR-183, (10) miR-141, (11) miR-202, (12) miR-148, (13) miR-106b, (14) miR-134, (15) miR-106, (16) miR-144, (17) miR-151, (18) miR-384, (19) miR-101, (20) miR-142, (21) miR-129 and (22) miR-126. [score:1]
[1 to 20 of 4 sentences]
4
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
We found eight miRs differentially expressed, six down-regulated (miR-9, miR-141, miR-200a, miR-200b, miR-429 and miR-376a) and two up-regulated (miR-450a-5p and miR130b*) in the Dlx5 [−/−] OE (Fig.  1a). [score:9]
[1 to 20 of 1 sentences]
5
[+] score: 9
This may be due to transcriptional regulation [98] but possibly also to the repression of miRNAs (mmu-miR-1 at ST; mmu-miR-450a-5p at IT; mmu-miR-27a and -92a at LT) that target IGF1 mRNA. [score:4]
The selection of the miRNAs is based on their potential role in the pathology of the lung (mmu-miR-1, 146b, -203, -21, -223, -29b, -29c) or on their high and significant differential expression in the mo del (mmu-miR-455, -574-5p, -672, -690) or for their high (mmu-let-7b a, mmu-miR-145) or low (mmu-miR-450a-5p) signal intensity in microarray analysis. [score:3]
Among these data, 40 out of 42 (95%) gave results and trends similar to those obtained by microarray profiling, except for mmu-miR-29c at ST and LT (Figure 2), although the magnitude of the observed regulation was not always identical (mmu-miR-455 at LT and mmu-miR-450a at IT). [score:2]
[1 to 20 of 3 sentences]
6
[+] score: 8
Among them, 12 miRNAs (let-7e-5p, miR-151a-3p, miR-21-5p/-3p, miR-221-5p/-3p, miR-222-3p, miR-424-3p, miR-450a-5p, miR-450b-5p, miR-503-5p, and miR-99b-5p) were up-regulated by IL-27 and two miRNAs (miR-99a-5p and miR-125b-5p) were down-regulated. [score:7]
These included let-7e-5p, miR-21-5p/-3p, miR-221-5p/-3p, miR-424-5p/-3p, miR-450a-5p, miR-450b-5p, miR-503-5p, etc. [score:1]
[1 to 20 of 2 sentences]
7
[+] score: 8
In particular, miR-450a-5p was upregulated 7-fold in HFKs expressing HPV16 E6/E7 but had only eight potential targets. [score:8]
[1 to 20 of 1 sentences]
8
[+] score: 7
As shown in the heat map, compared with sample on PID 0, most miRNAs were down-regulated in sample on PID 4, whereas only few miRNAs were differentially expressed in sample on PID 7. Compared with sample on PID 4, a majority of miRNAs were up-regulated in sample on PID 7. To validate the Solexa sequencing results, qRT-PCR was performed separately to investigate the relative expression levels of 5 randomly selected DE miRNAs (ssc-miR-424-3p, ssc-miR-542-5p, ssc-miR-365-5p, ssc-miR-450b-5p, ssc-miR-450a). [score:7]
[1 to 20 of 1 sentences]
9
[+] score: 7
The five most significantly differentially expressed miRNAs, as determined through microarray analysis, were miR-33 (FC = −5.5), miR-450 (FC = −3.6), miR-330 (FC = −2.4), miR-181a (FC = −2.1), and miR-10b (FC = −2.1). [score:3]
miR-450 showed minimal expression changes (FC = −1.04; data not shown). [score:3]
Because we did not validate miR-450 results with qRT-PCR, no further analysis was performed on miR-450. [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 6
Other miRNAs from this paper: hsa-mir-34b, hsa-mir-450a-2, hsa-mir-421, hsa-mir-450b, hsa-mir-466
Dashwood et al. demonstrated that a single intake of cruciferous vegetables inhibits HDAC activity in mononuclear cells of peripheral blood promoting H3 and H4 acetylation [141], while other studies demonstrated that exposure to cigarette smoke causes a down-regulation of mir-34b, mir-421, mir450-b, mir-466, and mir-469 [142]. [score:6]
[1 to 20 of 1 sentences]
11
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
In a rat mo del of selenium deficiency, five miRNAs extracted from harvested heart (miR-374, miR-16, miR-199a-5p, miR-195 and miR-30e*) were identified as upregulated >5-fold in the deficiency group, compared to the selenium-supplemented group, and three were downregulated (miR-3571, miR-675 and miR-450a*). [score:6]
[1 to 20 of 1 sentences]
12
[+] score: 5
Other miRNAs from this paper: hsa-mir-424, hsa-mir-450a-2, hsa-mir-503, hsa-mir-542, hsa-mir-450b
The same expression pattern was observed for miRNAs located near the studied loci (miR-424, miR-450a, miR-450b-5p, miR-503 and miR-542-3p). [score:3]
Furthermore, using the normal tissue panel, we observed a significant positive correlation between MIR503HG and LINC00629 lincRNAs (Fig 3K), and also between both lincRNAs and the neighboring miRNAs: miR-424, miR450a, miR-450b-5p, miR-542-3p and miR-503 (Fig 3A–3J). [score:1]
000604), miR-450a (Catalog No. [score:1]
[1 to 20 of 3 sentences]
13
[+] score: 5
The miRNA expression databases further show that miR-214-3p, miR-212-5p, miR-204-3p, miR-362-3p, miR-450a and miR-320 are expressed in the brain. [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 4
For example, SNPs that show evidence for regulating the expression of miRNAs in liver include several replicated clinical associations with response to chemotherapeutic agents, including rs9332377 (cisplatin; miR-619) [30] and rs4880 (cyclophosphamide; miR-199a-5p, miR-376a, miR-450a, miR-590-5p) [31]. [score:4]
[1 to 20 of 1 sentences]
15
[+] score: 4
For example, the miR-424-503 polycistron, miR-542-5p and 3p, and miR-450, all of which are likely to be part of the same primary transcript [8], are up-regulated significantly in senescent BJ cells. [score:4]
[1 to 20 of 1 sentences]
16
[+] score: 3
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-125b-1, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-155, hsa-mir-106b, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-151a, hsa-mir-452, hsa-mir-450a-2, hsa-mir-92b, hsa-mir-151b, hsa-mir-378d-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-151, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-92a-2, bta-let-7d, bta-mir-17, bta-mir-450a-2, bta-mir-7-3, bta-let-7f-1, bta-let-7c, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-450b, bta-mir-106b, bta-mir-143, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-26a-1, bta-mir-378-1, bta-mir-452, bta-mir-92a-1, bta-mir-92b, bta-mir-7-2, bta-mir-7-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-450a-1, bta-mir-378-2, hsa-mir-378b, bta-mir-2284w, bta-mir-2284x, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-450b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-378j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
com/journal/jcb] Alignment of reads with human microRNAs in miRBase identified 13 previously unreported bovine orthologs of human microRNAs and showed a microRNA previously recorded as the unique family member in cows (bta-miR-450) to be expressed with an other member of this family (Supplementary Table IV). [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 1
Taken together, these elements may represent a multipart transcript, and interestingly four additional miRNA coding sites (mir-542, mir-450a-2, mir-450a-1, and mir-450b) reside nearby, which do not have any evidence of being transcribed based on known dbEST sequence records. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
21 hsa-miR-140-3p −1.22 hsa-miR-450a −1.23 hsa-miR-210 †† −1.24 1.48 hsa-miR-26b −1.25 hsa-miR-10b −1.25 −1.25 hsa-miR-101 −1.26 −1.28 hsa-let-7c −1.28 hsa-miR-98 −1.29 −1.21 hsa-miR-23a −1.30 hsa-miR-22* −1.34 −1.42 hsa-miR-337-3p −1.38 −1.23 hsa-miR-31 −1.39 −1.34 hsa-miR-365 −1.43 −1.38 hsa-miR-137 −1.46 −1.45 hsa-miR-494 −1.55 hsa-miR-29b −1.82 −1.93 hsa-miR-221 † −1.88 −1.84 hsa-miR-29c −2.33 hsa-let-7i 1.21 hsa-miR-125b † −1.24 hsa-miR-195 −1. [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
A similar issue is seen with the mir-450 cluster. [score:1]
[1 to 20 of 1 sentences]
20
[+] score: 1
Five miRNA seeds were homologous to miRNAs in the Rfam [35] or miRBase [36] databases, namely: mir-398 (Rfam ID: RF00695), mir-450 (RF00708), mir-598 (RF01059), mir-785 (RF02244) and cte-mir-981 (miRBase ID: MI0010092). [score:1]
[1 to 20 of 1 sentences]