miRBase entry: hsa-mir-450a-1

Stem-loop hsa-mir-450a-1


Accession
MI0001652
Symbol
HGNC: MIR450A1
Description
Homo sapiens hsa-mir-450a-1 precursor miRNA
Gene family
MIPF0000128; mir-450

Literature search
20 open access papers mention hsa-mir-450a-1
(42 sentences)

Sequence

22174 reads, 777 reads per million, 109 experiments
aaacgauacuaaacuguUUUUGCGAUGUGUUCCUAAUAUgcacuauaaauauAUUGGGAACAUUUUGCAUGUAUaguuuuguaucaauaua
....(((((.(((((((...(((((.((((((((((((((.........)))))))))))))).)))))...))))))).)))))......

Structure
--aaac     u       UUU     U              cac 
      gauac aaacugu   UGCGA GUGUUCCUAAUAUg   u
      ||||| |||||||   ||||| ||||||||||||||   a
      cuaug uuugaUA   ACGUU UACAAGGGUUAuau   u
auauaa     u       UGU     U              aaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MIR:MI0000313).

Genome context
chrX: 134540341-134540431 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-450a-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-450a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-450a-5p

Accession MIMAT0001545
Description Homo sapiens hsa-miR-450a-5p mature miRNA
Sequence 18 - UUUUGCGAUGUGUUCCUAAUAU - 39
Evidence experimental
array-cloned [1,3], cloned [1,4]
Database links
Predicted targets

Mature hsa-miR-450a-1-3p

Accession MIMAT0022700
Description Homo sapiens hsa-miR-450a-1-3p mature miRNA
Sequence 53 - AUUGGGAACAUUUUGCAUGUAU - 74
Evidence experimental
Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  4. PubMed ID: 15735639
    Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals
    "Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M"
    "Nature (2005) 434:338-345

  5. PubMed ID: 23226537
    The repertoire and features of human platelet microRNAs
    Plé H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P
    PLoS One (2012) 7:e50746