sort by

10 publications mentioning dre-mir-92a-2

Open access articles that are associated with the species Danio rerio and mention the gene name mir-92a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 22
We tested this experimental strategy in HEK293T cells with three putative targets of miR-92a that were identified by Crosslinking, Ligation And Sequencing of Hybrids (CLASH) 7. Although, in general, CLASH binding results were supported by transcript upregulation upon miR-92a inhibition 7, this assay cannot discriminate between direct and indirect miRNA -mediated regulation. [score:10]
Three MREs identified by CLASH analysis, and whose expression appears upregulated upon loss of miR-92a function were analysed 7. PCMTD1 contains a classical ‘seed’ sequence, whereas MAPRE1 and C9orf7 contain non-canonical binding motifs. [score:6]
Interestingly, C9orf7 is targeted by miR-92a via a non-canonical motif through complementary base pairing with its 3′ end, demonstrating that such interactions can be biologically relevant. [score:3]
The seed region of miR-92a is highlighted by a green box. [score:1]
Complementary base pairing is indicated, and motifs deleted by HDR are highlighted in bold (miR-92a ‘seed’ or miR-92a ‘motif’). [score:1]
This analysis revealed that no endogenous MREs were removed, except for the miR-92 family following integration of the T7-MRE [mut] barcode, as intended (Supplementary Table 1). [score:1]
[1 to 20 of 6 sentences]
2
[+] score: 21
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-mir-204-1, dre-mir-181a-1, dre-mir-214, dre-mir-222a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-25, dre-mir-26a-1, dre-mir-26a-2, dre-mir-26a-3, dre-mir-30d, dre-mir-92a-1, dre-mir-92b, dre-mir-100-1, dre-mir-100-2, dre-mir-125a-1, dre-mir-125a-2, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-125c, dre-mir-126a, dre-mir-143, dre-mir-146a, dre-mir-462, dre-mir-202, dre-mir-204-2, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-181a-2, dre-mir-1388, dre-mir-222b, dre-mir-126b, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-204-3
Several studies have shown mammalian miR-143-3p to function in suppressing cell proliferation 51 52, regulating cell apoptosis 53, and regulating differentiation of cultured adipocyte cells 54. miR-92a-3p was the most dominant gonadal miRNA in our study (Fig. 4). [score:5]
In a previous study, we demonstrated that the knockdown of miR-92a-3p in zebrafish gonads resulted in significantly reduced miR-92a-3p expression in 1-cell stage embryos, which also had a significantly higher rate of embryonic developmental arrest 29. [score:5]
The second most enriched GO term was negative regulation of substrate adhesion -dependent cell spreading (GO:1900025), and contained target mRNA for miR-181a-3p, miR-202-5p, miR-25-3p, miR-30d-5p, miR-430b-3p, miR-92a-3p, and miR-92b-3p. [score:4]
In gametes, miR-92a-3p had several variants with 3′ templated adenine and untemplated uracil additions (Fig. 8c). [score:1]
While miR-92a-3p abundance at 12 wpf was overwhelming, our observations were similar to studies in the mature gonads of zebrafish and yellow catfish (Pelteobagrus fulvidraco) 24 27. [score:1]
Our findings further suggest miR-92a-3p is stored as a maternal transcript in unfertilized eggs. [score:1]
miR-92a-3p was the most frequently abundant miRNA, which was among the top five most abundant miRNAs in every gonadal stage as well as in gametes, while miR-92b-3p was highly abundant in gonads from 3 to 12 wpf, and in spermatozoa. [score:1]
The reference variants for miR-10b-5p (b) and miR-92a-3p (c) are underlined. [score:1]
Here, we found that an exceptionally large proportion of miR-92a-3p transcripts in unfertilized egg, and to a lesser extent spermatozoa, had templated 3′ nucleotide additions (Fig. 8c). [score:1]
This led us to hypothesize miR-92a-3p had a function as a maternal miRNA in zebrafish embryogenesis. [score:1]
[1 to 20 of 10 sentences]
3
[+] score: 14
e Heat maps profiles for change in expression of selected miRNAs Table 2 Cold shock -induced differential expression of known miRNAs miRNA Mature miRNA sequence Fold change Up-regulated miRNAs  Dre-mir-29b-1 UAGCACCAUUUGAAAUCAGUGU 3.90  Dre-mir-99-2 AACCCGUAGAUCCGAUCUUGUG 2.04  Dre-mir-99-1 AACCCGUAGAUCCGAUCUUGUG 1.79  Dre-mir-92a-2 UAUUGCACUUGUCCCGGCCUGU 1.75  Dre-mir-2184 AACAGUAAGAGUUUAUGUGCU 1.73 Down-regulated miRNAs  Dre-mir-737 AAUCAAAACCUAAAGAAAAUA −1.71  Dre-mir-9-2 UCUUUGGUUAUCUAGCUGUAUGA −1.75  Dre-mir-363 AAUUGCACGGUAUCCAUCUGUA −1.79  Dre-mir-125b-2 UCCCUGAGACCCUAACUUGUGA −1.91  Dre-mir-199-1 CCCAGUGUUCAGACUACCUGUUC −2.79 After eliminating miRNAs whose expression might be changed due to development process during incubation (control vs normal). [score:14]
[1 to 20 of 1 sentences]
4
[+] score: 9
For instance, miR-92a (miR-17∼92 cluster) is expressed in vascular endothelial cells and suppresses the function of pro-angiogenic proteins by inhibiting translation of their mRNAs [27]. [score:9]
[1 to 20 of 1 sentences]
5
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
Targeted knockouts of Mir17 and Mir92 in mice results in hypoplasia of most skull bones, including reduced ossification and cleft palate, similar to human patients (Ventura et al., 2008; de Pontual et al., 2011; Li et al., 2012; Wang et al., 2013). [score:3]
Another miRNA family involved in craniofacial development is the MIR17 and MIR92 family, which has been linked to Feingold syndrome in human patients (Kannu et al., 2013; Tassano et al., 2013). [score:2]
MicroRNA-92a upholds Bmp signaling by targeting noggin3 during pharyngeal cartilage formation. [score:2]
Similarly, Mir92a which is in the Mirc1 cluster on mouse chromosome 14 containing Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, and Mir92a-1, is required to promote proliferation of orofacial development (Ning et al., 2013). [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 6
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-mir-183, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-mir-1-2, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-20a, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-92a-1, dre-mir-92b, dre-mir-101a, dre-mir-101b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-145, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-mir-499, ola-mir-430a-1, ola-mir-430c-1, ola-mir-430b-1, ola-mir-430c-2, ola-mir-430c-3, ola-mir-430d-1, ola-mir-430a-2, ola-mir-430c-4, ola-mir-430d-2, ola-mir-430a-3, ola-mir-430a-4, ola-mir-430c-5, ola-mir-430d-3, ola-mir-430b-2, ola-mir-430c-6, ola-mir-430c-7, ola-mir-20a-1, ola-mir-92a-2, ola-mir-9a-2, ola-mir-101a, ola-mir-9b-1, ola-mir-499, ola-let-7a-1, ola-mir-9a-3, ola-mir-183-1, ola-let-7a-2, ola-mir-29b-1, ola-mir-29a, ola-mir-124-1, ola-mir-124-2, ola-mir-9a-4, ola-mir-101b, ola-let-7a-4, ola-mir-10d, ola-mir-9a-1, ola-mir-92b, ola-mir-9b-2, ola-mir-1-2, ola-mir-124-3, ola-mir-15a, ola-mir-10b, ola-mir-92a-1, ola-mir-20a-2, ola-mir-17, ola-mir-29b-2, ola-mir-29c, ola-mir-183-2, ola-let-7a-3, ola-mir-9a-5, ola-mir-145, dre-mir-29b3
We found e. g., miR-10, miR-29 and miR-92 showing potential to be significantly involved in the down-regulation of genes in the aging brain of N. furzeri, like cell cycle regulators (ccne2 [22], nek6 [38], cdk13 [42]) or cancer related genes (mycn [8, 12], vav2 [13, 28]), both processes involved in aging. [score:5]
Furthermore, up to two smaller and lesser conserved clusters, containing at least two miRNAs of the miR-17 or miR-92 family, were identified per fish species, similar to what is known for mammals. [score:1]
[1 to 20 of 2 sentences]
7
[+] score: 5
There are six members of the miR-17-92 group, which includes miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1. In the present study, miR-17 and miR-92 were in Cluster 2 (increased with age), which suggests a potential role of these miRNA in the inhibition of cardiomyocyte proliferation in late gestation, however, miR-20a and miR-19b were in Cluster 6 (peaked before birth, but then decreased into postnatal life) and the expression of miR-18a and 19a did not change with age. [score:5]
[1 to 20 of 1 sentences]
8
[+] score: 3
MicroRNA-92a upholds Bmp signaling by targeting noggin3 during pharyngeal cartilage formation. [score:2]
Interestingly, miR-92a also maintains BMP signaling during pharyngeal cartilage formation (Ning et al., 2013), suggesting a positive feedback loop between the miR-17-92 cluster and BMP signaling. [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
For human miRNAs with same id numbers, only 2 are separated in the consensus families, namely mir-92/mir-92b and mir-449/mir-449b, showing that most of the miRNA families are robust to the variation in the input of the PBC pipeline. [score:1]
We further examined the alignments for mir-92/92b and mir-449/449b. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 1
miRNAs let-7a, miR-100-5p, miR-10b-5p, miR-125b-5p, miR-146a, miR-181a-5p, miR-21, miR-27c-3p and miR-92a-3p were the most abundant miRNAs (>100,000 reads) in the four samples (Excel S1). [score:1]
[1 to 20 of 1 sentences]