sort by

9 publications mentioning dre-mir-155

Open access articles that are associated with the species Danio rerio and mention the gene name mir-155. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 39
Other miRNAs from this paper: hsa-mir-155
Early miR-155 upregulation contributes to neuroinflammation in an Alzheimer's disease transgenic mouse mo del as well as in Aβ-activated microglial and astrocyte cultures (28). [score:6]
miR-155 is a master regulator of pathways involved in the regulation of immune mechanisms (21) that is expressed in both the innate and the adaptive immune system and predominantly acts via moderate mRNA degradation. [score:5]
We further demonstrate early microglial activation with marked upregulation of miRNA-155 (miR-155) which precedes subsequent organ infiltration with Gaucher cells in juvenile gba1 [−/−]. [score:4]
We hypothesized that miR-155 up-regulation may be an early feature in gba1 [−] [/−]. [score:4]
Of note, miR-155 upregulation has already been implicated in the pathogenesis of different neurodegenerative disorders. [score:4]
The identification of distinct and potentially ‘druggable’ molecular targets such as miR-155 will facilitate these in vivo drug screens. [score:3]
Future work needs to determine whether miR-155 may also be a promising ‘druggable’ target for neuroprotective therapy in both GD and PD. [score:3]
Expression levels of miR-155 are increased in the spinal cord of both familial and sporadic amyotrophic lateral sclerosis and genetic ablation of miR-155 markedly increased survival in SOD1 mice with restoration of abnormal microglia (29). [score:3]
Levels of miR-155, a master regulator of inflammatory/immune mechanisms, were analyzed in 5 dpf larvae (C) and 12 wpf brain tissue (D) across gba1 genotypes. [score:2]
miR-155 is a key regulator of inflammation (21). [score:2]
miR-155 was increased 2-fold in gba1 [−/−] larvae (P < 0.05) and 4-fold in 12 wpf gba1 [−/−] brains (P < 0.01). [score:1]
However, miR-155 had not been implicated in the pathogenesis of GD or PD before now. [score:1]
A Taqman probe (sequence: 5′UUAAUGCUAAUCGUGAUAGGGG) was used to quantify miR-155 levels. [score:1]
[1 to 20 of 13 sentences]
2
[+] score: 24
We next tested the potential of the miR155 backbone to trigger knockdown when the open reading frame (ORF) was targeted (Fig. 3). [score:4]
The PCR product was purified, digested with EcoRV and inserted into linearized pDONR223-xhoI to generate pDONR 224. mmu-miR155 -based plasmid: ‘pcDNA 6.2 GW/EmGFP-miR', containing artificial miRNA -expressing mmu-miR155 backbone, was provided by Dr Donald Love 9. The eGFP: mmu-miR155 cassette was transferred into pDONR224 using BP clonase reaction (following the manufacturer's instructions). [score:3]
miR-155 and miR-218 backbones lead to potent knockdownpME -RNAi651, pME -RNAi661 and pME -RNAi671 constructs with green fluorescent protein (GFP) marker followed by a synthetic pre-miR directed against the 3′-UTR of mCherry were cloned downstream of the ubiquitin promoter in a mini-tol2-R4R2 multisite gateway-compatible destination plasmid (Supplementary Fig. 3). [score:3]
All miRsmn1 -expressing constructs were based on the mmu-miR155 scaffold fused to dsRED (pME -RNAi652), and were cloned downstream of the ubiquitin promoter in a mini-tol2-R4R2 destination plasmid (Fig. 4a). [score:3]
miR-155 and miR-218 backbones lead to potent knockdown. [score:2]
According to the cell-specific observations above, miR218 and miR155 backbones led to potent global knockdown with ∼74 and 83% reduction in red fluorescence, respectively, while the miR30 backbone reduced fluorescence modestly by ∼33%. [score:2]
However, the backbone based on dre-miR30 achieved only weak red fluorescence inhibition compared with mmu-miR155 or hsa-miR218 backbones. [score:2]
pME -RNAi651 was digested by BamHI/XhoI and gel-purified to eliminate mmu-miR155. [score:1]
Two additional constructs, encoding dsRED or Cerulean reporters instead of GFP, were generated for the scaffold based on mmu-miR155 (named pME -RNAi652 and pME -RNAi653, respectively). [score:1]
Both the PCR product and pME -RNAi651 plasmid were digested by BamHI and XhoI to exchange the mmu-miR155 backbone with the dre-miR30 one (plasmid was purified before ligase reaction). [score:1]
pME -RNAi651 is based on a mmu-miR155 backbone, pME -RNAi661 on a dre-miR30 backbone and pME -RNAi671 on a hsa-miR218 backbone. [score:1]
Control animals were injected with the empty mmu-miR155 backbone. [score:1]
[1 to 20 of 12 sentences]
3
[+] score: 14
Efficient Knockdown of Reporter Gene In Vivo by Mir-shRNAIt has been previously shown that the 5′ and 3′ flanking sequences of miRNA precursor are crucial for miRNA processing and maturation [16], and the hairpin shRNA can be expressed from a synthetic stem-loop precursor flanked by the 5′ and 3′ flanking sequences of either human miR-30 [14] or mouse miR-155 gene [13]. [score:4]
As a control, injection of miR-155 did not have any effects on the expression of EGFP-2×PT [mir30e] (Figure 1B–D, left panels). [score:3]
It has been previously shown that the 5′ and 3′ flanking sequences of miRNA precursor are crucial for miRNA processing and maturation [16], and the hairpin shRNA can be expressed from a synthetic stem-loop precursor flanked by the 5′ and 3′ flanking sequences of either human miR-30 [14] or mouse miR-155 gene [13]. [score:3]
We first identified zebrafish homologues of mammalian miR-30 and miR-155 genes based on their sequence identity (data not shown), and cloned both zebrafish pri-miR-30e (409 bp) and pri-miR-155 (447 bp) genomic precursor sequences into the pCS2 [+] vector (Figure 1A. [score:1]
The precursor sequences of zebrafish mir30e (409 bp) and mir155 (447 bp) were cloned from the genomic DNA of Tubingen adult fish into the pCS2 [+] vector. [score:1]
The capped EGFP sensor mRNAs were co -injected with either miR-30e or miR-155 precursor mRNAs into one-cell stage embryos (B, bottom). [score:1]
Compared with the mir-30e, injection of the capped miR-155 mRNAs showed less efficiency to knockdown the EGFP sensor containing 2×PT for miR-155 binding (EGFP-2×PT [mir155]) (data not shown). [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 12
To enhance miRNA effectiveness three sflt1 3′UTR-specific target sites with miRNA155 backbone were cloned in series. [score:3]
Tissue-specific miR155-flt1-1-2-3 knockdown constructs. [score:2]
Tissue-specific miR155-flt1-1-2-3 knockdown constructs sflt1 3′UTR-specific miRNAs were designed using the BLOCK-IT RNAi Designer website (https://rnaidesigner. [score:2]
To substantiate the contribution of neuronal sflt1 we next employed multiplexed custom designed miRNAs directed against sflt1 3′UTR arranged with a common miR-155 backbone 50 (Supplementary Fig. 8b). [score:2]
Tubb_ GFP-miR155-sflt1-1-2-3). [score:1]
p5E_flt1 [enh],641-pMER-DsRed-miR155-sflt1-1-2-3 and p3E_polyA were recombined into pDestTol2CG2 (pCG2_flt1 [enh] _DsRed-miR155-sflt1-1-2-3). [score:1]
Tubb-3.8, 641-pMER-GFP-miR155-sflt1-1-2-3 and p3E_polyA were recombined into pDestTol2CG2 (pCG2_Xla. [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 10
In total, 6 up-regulated miRNAs (such as dre-miR-142a-5p, dre-miR-155, dre-miR-29a, dre-miR-457a, dre-miR-223, and dre-miR-338) were joined to the gene regulatory network by potentially targeting relationships with 8 down-regulated genes. [score:10]
[1 to 20 of 1 sentences]
6
[+] score: 9
As previously reported, some of the specifically expressed miRNAs in RPL5 MO (such as Dre-mir-142a-3p, Dre-miR-34b and Dre-miR-15a*) and some miRNAs with two-fold higher expression (such as Dre-miR-150, Dre-miR-223 and Dre-miR-155) are involved in the development and function of the hematological system and most of the above-listed miRNAs participate in normal hematologic functions by regulating the expression of c-myb [28– 31]. [score:9]
[1 to 20 of 1 sentences]
7
[+] score: 6
Tumor protein 53 -induced nuclear protein 1 expression is repressed by miR-155, and its restoration inhibits pancreatic tumor development. [score:6]
[1 to 20 of 1 sentences]
8
[+] score: 5
A similar effect on LDL accumulation was observed by silencing miR-155, another important miRNA regulator of immune processes [58]. [score:2]
For instance, lipopolysaccharide (LPS) stimulation of TLR4 and downstream NFκB activity induced miR-146, miR-147, and miR-155 [11- 13]. [score:1]
Mice deficient in miR-155 could not be protected by vaccination against Salmonella typhimurium infection and showed strong defects in T-cell cytokine production [14]. [score:1]
The induction of members of the miR-21, miR-29, and miR-146 families was in line with earlier microarray studies, which reported these along with some other miRNAs, like miR-9, miR-132, miR-147, and miR-155 as infection-inducible [13, 26, 43, 44]. [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 3
Curtis AM Circadian control of innate immunity in macrophages by miR-155 targeting Bmal1Proc. [score:3]
[1 to 20 of 1 sentences]