sort by

43 publications mentioning ssc-mir-21

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-21. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 278
Inset is a representative Western blot of PDCD4 protein expression impacts parthenogenetic embryo developmentMetaphase II arrested oocytes were parthenogenetically activated (to eliminate confounding impact of sperm-borne miRNA) following in vitro maturation to test the hypothesis that MIR21 inhibition during in vitro oocyte maturation negatively impacts early embryo development prior to activation of the embryonic genome at the 4-cell stage of development. [score:8]
This study tested the hypothesis that increased MIR21 abundance in the maturing cumulus oocyte complex of the pig is associated with posttranscriptional regulation of PDCD4 expression in the oocyte and that suppression of MIR21 function during oocyte maturation would compromise subsequent embryonic development. [score:7]
Our working hypothesis that increased MIR21 abundance in the maturing cumulus oocyte complex of the pig is associated with posttranscriptional regulation of PDCD4 expression in the oocyte and that suppression of MIR21 function during oocyte maturation will compromise subsequent embryonic development. [score:7]
MIR21 is differentially expressed in the oocyte during meiotic maturation in the pig and inhibition of MIR21 during this process alters PDCD4 protein abundance suggesting posttranscriptional regulatory events involving MIR21 during oocyte maturation may impact subsequent embryonic development in the pig. [score:7]
Inset is a representative Western blot of PDCD4 protein expression Metaphase II arrested oocytes were parthenogenetically activated (to eliminate confounding impact of sperm-borne miRNA) following in vitro maturation to test the hypothesis that MIR21 inhibition during in vitro oocyte maturation negatively impacts early embryo development prior to activation of the embryonic genome at the 4-cell stage of development. [score:7]
It is possible that STAT3 could be related to the expression of MIR21 during oocyte maturation and early embryo development as leptin (an adipokine) has been demonstrated to increase STAT3 expression during bovine embryo culture and is associated with reduced apoptosis in bovine blastocysts [7]. [score:6]
The objective of this project was to examine the relationship between MIR21 and PDCD4 expression in porcine oocytes during in vitro maturation and assess the impact of MIR21 inhibition during oocyte maturation on early embryo development. [score:6]
However, inhibition of MIR21 activity during in vitro maturation using antisense MIR21 suppressed embryo development to the 4–8 cell stage following parthenogenetic activation. [score:6]
In mice it has been reported that luteinizing hormone may increase the expression of MIR21 in mouse granulosa cells and in vivo MIR21 inhibition has a negative impact on ovulation rate [11]. [score:5]
These data indicate a reduced ability of MIR21 to suppress PDCD4 protein abundance in the presence of a MIR21 inhibitor suggesting a biological interaction between MIR21 and PDCD4 mRNA occurs during in vitro oocyte maturation in the pig. [score:5]
Inhibition of MIR21 affects oocyte maturation and PDCD4 protein expression. [score:5]
Oocyte growth and development begins prior to antral follicle development and it is unclear when activation of MIR21 expression occurs or what mechanism is primarily responsible for this observation. [score:5]
In summary, these data demonstrate MIR21 miRNA and PDCD4 protein have a reciprocally inverse, temporal expression pattern during oocyte maturation, and that inhibition of MIR21 results in an increased abundance of PDCD4 protein. [score:5]
Fig. 4PDCD4 protein expression following MIR21 inhibition during IVM. [score:5]
The anti-apoptotic capabilities of MIR21 in cancer cells are manifested through the ability to suppress critical apoptotic genes including programmed cell death 4 (PDCD4, previously referred to as neoplastic transformation inhibitor) [3, 16, 24, 33]. [score:5]
Anti-MIR21 antisense oligonucleotides were added to maturation media during oocyte maturation to determine the effects of MIR21 inhibition on maturation rate and PDCD4 expression in MII arrested oocytes. [score:5]
Utilizing miRNA microarray analysis and deep sequencing we have previously identified microRNA-21 (MIR21) as an up-regulated miRNA during porcine oocyte in vitro maturation [41]. [score:4]
MIR21 inhibition during in vitro maturation impacts parthenogenetic embryo development. [score:4]
3′UTR 3′ untranslated region BSA bovine serum albumin COC cumulus oocyte complex GVBD germinal vesicle breakdown IVM in vitro maturation MII metaphase II MIR21 microRNA-21 miRNA microRNA mTBM medium modified Tris-buffered medium PBS phosphate buffered saline PBST phosphate buffered saline containing 0.1 % Tween-20 PDCD4 programmed cell death 4 PNA peptide nucleic acids PTGR posttranscriptional gene regulation PVA polyvinyl alcohol PZM3 porcine zygote medium 3 RT room temperature TCM-199 tissue culture media 199 The authors would like to thank Robyn Scanlon and Ben Selman for their assistance with this project. [score:4]
Fig. 5 In situ hybridization of MIR21 in gilt ovaries to identify MIR21 expression during follicle development. [score:4]
During the transition from GV to MII, MIR21 was up-regulated approximately 6-fold in oocytes (P = 0.001, Fig.   1a) and approximately 25-fold in cumulus cells (P = 0.003, Fig.   1b). [score:4]
MIR21 expression is temporally regulated during porcine cumulus oocyte complex maturation. [score:4]
MiRNA-21 (MIR21) has been shown to elicit posttranscriptional gene regulation in several tissues associated with rapid cell proliferation in addition to demonstrating anti-apoptotic features through interactions with PDCD4 mRNA and other targets. [score:4]
These findings taken together suggest the potential for MIR21 and miRNA in general, to impact protein expression in the maturing oocyte having implications regarding the developmental ability of subsequently produced embryos. [score:4]
AP-1 activation is suppressed by PDCD4, however, AP-1 induction of MIR21 and subsequent posttranscriptional regulation of PDCD4 allows further and more sustained AP-1 activation [17, 37]. [score:4]
The potential ability of MIR21 to interact with PDCD4 leading to posttranscriptional gene regulation of PDCD4 protein expression in the maturing pig oocyte as demonstrated herein has also been described in several types of cancer cells [3, 15, 16, 29, 33, 42]. [score:4]
Development to the 4-cell stage or greater within 60 h post activation was greatest for control oocytes (73.0 ± 5.7) compared with oocytes matured in the presence of a MIR21 inhibitor (41.7 ± 12.1) or in the presence of a negative control PNA (60.2 ± 15.8). [score:3]
Ovaries were preserved in 4 % paraformaldehyde and utilized for in situ hybridization to determine MIR21 expression. [score:3]
To determine the effect of cumulus cell presence on MIR21 expression in oocytes during in vitro maturation we subjected COCs to one of three treatments: 1) standard in vitro maturation as described above using intact COCs, 2) in vitro maturation following cumulus cell removal and then utilization of detached cumulus cells for culture with denuded oocytes or, 3) denuded oocytes matured without the presence of cumulus cells. [score:3]
MIR21 expression in MII arrested oocytes matured in vitro was not affected by gonadotropins or the presence of cumulus cells during in vitro maturation. [score:3]
Mean ± SEM [g]Average number of blastomeres at 60 h based on a subset of embryos stained with nuclear stain DAPI The effect of MIR21 inhibition on PDCD4 protein abundance was analyzed by Western blot with pools of 50 oocytes within each treatment and presented as a percentage of GV stage PDCD4 abundance. [score:3]
[a,b]Means ± SEM with different superscripts are different (P < 0.05) To determine the effect of gonadotropins on MIR21 expression during in vitro oocyte maturation, we matured COCs with and without luteinizing hormone (LH) and follicle stimulating hormone (FSH). [score:3]
In situ hybridization of MIR21 demonstrated expression throughout the granulosa cells and the oocyte (Fig.   5). [score:3]
During in vitro maturation, expression of MIR21 increased approximately 6-fold in the oocyte and 25-fold in the cumulus cell. [score:3]
To examine this, the ability of both LH and FSH to affect MIR21 expression during in vitro maturation was examined. [score:3]
Mean ± SEM [g]Average number of blastomeres at 60 h based on a subset of embryos stained with nuclear stain DAPIThe effect of MIR21 inhibition on PDCD4 protein abundance was analyzed by Western blot with pools of 50 oocytes within each treatment and presented as a percentage of GV stage PDCD4 abundance. [score:3]
b MIR21 relative expression for GV oocytes and MII oocytes cultured with LH and FSH, without FSH, without LH and without LH and FSH. [score:3]
MIR21 expression in oocytes with and without LH and FSH during in vitro maturation. [score:3]
Laser intensity and exposure time was consistent for all images captured To determine the relationship between MIR21 and its putative target PDCD4, during in vitro maturation, RT-qPCR and Western blot analysis were utilized to evaluate expression of MIR21 and PDCD4 in GV and MII stage oocytes and cumulus cells. [score:3]
b Expression of MIR21 in GV oocytes, and MII arrested oocytes from intact COC, denuded oocytes cultured with cumulus cells, and denuded oocytes. [score:3]
Because MIR21 abundance changes appear to occur rapidly during in vitro maturation, it is of interest if MIR21 expression in the pig cumulus oocyte complex is also responsive to the gonadotropins. [score:3]
The effect of oocyte stage on MIR21 and PDCD4 expression (C [T] value) was determined. [score:3]
Inhibition of MIR21 using an anti-MIR21 PNA during oocyte maturation decreased (P < 0.01) the percentage of oocytes achieving MII after 42 h of culture (Table  1). [score:3]
This is consistent with reports in humans [4] and in mice demonstrating increased MIR21 expression in granulosa cells in response to LH [11]. [score:3]
Oocytes cultured in the presence of the negative control inhibitor (NC-PNA 2.0 nM) had similar maturation rates compared to control maturation conditions (P > 0.05) and greater (P < 0.05) maturation rates compared to the MIR21 inhibited oocytes (Table  1). [score:3]
The interaction between MIR21 and PDCD4 is likely conserved in pigs as the MIR21 target recognition sequence in the 3′UTR of human and pig PDCD4 is 97 % similar with 100 % similarity in nucleotides responsible for recognition by the MIR21 seed sequence. [score:3]
To determine the effect of LH and FSH on MIR21 expression in oocytes during in vitro maturation COCs were matured in defined maturation media with LH and FSH as described above or containing only LH, only FSH, or lacking both. [score:3]
The objective of this study was to determine expression patterns of MIR21 and demonstrate its potential interactions with PDCD4 in the cumulus oocyte complex (COC) during oocyte maturation in the pig. [score:3]
MIR21 expression in MII arrested oocytes was not affected by the presence or absence of cumulus cells during maturation (P = 0.82). [score:3]
MIR21 interacts with PDCD4 through binding with complementary sequence in the 3′UTR of PDCD4 mRNA resulting in reduced translation and subsequently reduced protein abundance in oncogenic cell lines [3, 24]. [score:3]
MIR21 inhibition during in vitro maturation. [score:3]
Fig. 2Luteinizing hormone and follicle stimulating hormone affect oocyte maturation to MII arrest and the lack of FSH numerically decreased MIR21 expression in MII oocytes. [score:3]
Treatment effect for the PNA inhibitor of MIR21, presence or absence of gonadotropins, and the presence or absence of cumulus cells during in vitro maturation on MIR21 expression was evaluated. [score:3]
MIR21 expression in oocytes cultured with and without cumulus cells. [score:3]
MIR21 expression in MII arrested oocytes was not significantly different between the control and treatment groups (P = 0.68) (Fig.   2b). [score:3]
To determine the relationship between MIR21 and its putative target PDCD4, during in vitro maturation, RT-qPCR and Western blot analysis were utilized to evaluate expression of MIR21 and PDCD4 in GV and MII stage oocytes and cumulus cells. [score:3]
In many tissues, MIR21 interacts and suppresses PDCD4 due to the strong complementation between MIR21 and the PDCD4 3′UTR. [score:3]
MIR21 expression was designated green and nuclei (DAPI staining) designated blue. [score:3]
Maturation rates, as defined by the percentage of oocytes achieving MII arrest, were recorded and MII oocytes from each treatment and replication were collected in pools and used for MIR21 expression analysis as described above. [score:3]
For analysis of MIR21 expression in cumulus cells total RNA was extracted from cumulus cells of GV stage and MII arrested oocytes using the mirVana RNA isolation kit (Life Technologies, Grand Island, NY), 10 ng of total RNA was utilized for the RT reaction conducted the same way as the oocyte samples. [score:3]
Obtaining an understanding of MIR21 and its mechanism is necessary to further understand molecular regulation of oocyte maturation and early embryo development in the pig. [score:3]
Here we demonstrate PDCD4 protein down regulation is temporally associated with MIR21 abundance increase during in vitro oocyte maturation. [score:2]
However secondary and tertiary follicles express MIR21 more abundantly in the oocyte as well as the surrounding cumulus cells compared to primary follicles. [score:2]
[a,b]Means ± SEM with different superscripts are different (P < 0.05) To determine the impact of cumulus cell presence on MIR21 abundance in the oocyte during in vitro maturation we compared MIR21 expression in MII arrested oocytes following maturation of intact COCs, denuded oocytes cultured in the presence of cumulus cells and denuded oocytes cultured without cumulus cells. [score:2]
GV oocytes had lower MIR21 expression (P < 0.05) compared to MII arrested oocytes for all treatments (Fig.   3b), consistent with data from the experiment presented in Fig.   1. Fig. 3Cumulus cells influence oocyte maturation but not MIR21abundance in MII arrested oocytes. [score:2]
PDCD4 abundance in MII oocytes subjected to IVM in the presence of low (0.2 nM) MIR21 inhibitor concentration was similar (26.4 % of GV stage) to control MII oocytes and oocytes cultured with either concentration of NC-PNA possessed a similar quantity or less of PDCD4 compared to GV oocytes (Fig.   4). [score:2]
b RT-qPCR analysis for MIR21 in cumulus cells isolated from GV stage and in vitro matured oocytes (n = 4). [score:1]
It is possible that increased MIR21 expression in the oocyte occurs earlier during oocyte recruitment or during initial in vitro maturation prior to GVBD and warrants further investigation. [score:1]
Future studies will include an analysis of pri-MIR21 abundance prior to and during oocyte maturation which may yield insight into the mechanisms contributing to the current observations. [score:1]
Therefore, it remains possible that the increased abundance of MIR21 in the MII arrested oocyte occurs as a transcriptional response in the oocyte during the initial phases of in vitro maturation prior to GVBD in the oocyte. [score:1]
Based on staining intensity, MIR21 abundance appears greatest in oocytes and granulosa cells of tertiary follicles. [score:1]
a RT-qPCR analysis for MIR21 and PDCD4 mRNA in GV stage and MII arrested oocytes (n = 4). [score:1]
[a,b]Means ± SEM with different superscripts are different (P < 0.05) Using a fluorescently labeled MIR21 antagonist we first demonstrated its ability to translocate into both the cumulus cell and the oocytes (data not shown). [score:1]
Several promoters have been identified upstream to the pri-MIR21 transcription start site containing predicted consensus sequences for binding of AP-1 and signal transducer and activator of transcription 3 (STAT3) [17]. [score:1]
MIR21 abundance in the developing pig follicle. [score:1]
Daejeon, Korea) designed to specifically bind to and prevent MIR21 activity. [score:1]
MIR21 in situ hybridization in the developing follicle. [score:1]
Gonadotropins in maturation media influence maturation rate but not MIR21 abundance in MII arrested oocytes. [score:1]
This suggests that if both MIR21 and PDCD4 are present in the oocyte, MIR21 could impact PDCD4 protein abundance as the necessary accessory proteins for miRNA function are present in the oocyte during GVBD and progression to MII arrest. [score:1]
The MIR21 gene is transcribed via RNA polymerase II and is located in intronic regions of the transmembrane 49 gene (TMEM49; also referred to as VMP1) [10, 17]. [score:1]
Importantly the 3′UTR of pig PDCD4 possesses a conserved MIR21 recognition sequence, particularly in the seed sequence. [score:1]
In cumulus cells, MIR21 abundance increases approximately 25-fold during in vitro maturation. [score:1]
The potential for these mechanisms to contribute to MIR21 abundance increasing in the oocyte was examined by culturing denuded oocytes during IVM in the presence or absence of cumulus cells. [score:1]
In certain cancers, the interaction between MIR21 and PDCD4 is necessary for maximal AP-1 activation. [score:1]
While a reduction in maturation rate was observed as has been previously demonstrated [43], MIR21 abundance in the oocytes that did achieve MII arrest was not affected by the presence of cumulus cells suggesting the increased MIR21 observed is at least in part, the result of oocyte specific mechanisms. [score:1]
From left to right: Control MII arrested oocytes, MII arrested oocytes in vitro matured in the presence of high concentration (2.0 nM) of the anti-MIR21 PNA or negative control PNA, and MII arrested oocytes in vitro matured in the presence of low concentration (0.2 nM) of the anit-MIR21 PNA or negative control PNA. [score:1]
Neither the presence of cumulus cells nor gonadotropins during in vitro maturation affected MIR21 abundance in those oocytes achieving MII arrest. [score:1]
Cumulus cells influence oocyte maturation but not MIR21 abundance in MII arrested oocytes. [score:1]
Both PDCD4 and MIR21 analysis were analyzed from the same oocyte sample lysis. [score:1]
While exclusion of LH from maturation media negatively impacted oocyte maturation, as demonstrated by others [45], a significant effect of the gonadotropins on MIR21 abundance during in vitro maturation was not detected. [score:1]
The mature MIR21 sequence was first identified in human HeLa cells [22] and has since been predicted and verified to be present in the transcriptome of several other species including the pig. [score:1]
We used an anti-MIR21 PNA (Panagene Inc. [score:1]
In addition to AP-1, STAT3 is another transcription factor that has also been documented to induce pri-MIR21 transcription [23]. [score:1]
miRNA Oocyte Pig MIR21 Germinal vesicle breakdown (GVBD) is the first physical sign that an oocyte is committed to maturation and also represents the onset of a period of transcriptional quiescence which persists until the activation of the embryonic genome. [score:1]
The cumulus oocyte complexes collected for this study were from 3 to 5 mm antral follicles, prior to GVBD, and may be capable of transcribing primary MIR21 (pri-MIR21) transcript that can be further processed into mature MIR21 during maturation. [score:1]
[1 to 20 of 95 sentences]
2
[+] score: 228
C. RT-qPCR was performed to verify the decreased TGFβI expression following the overexpression of miR-21 and enhanced expression after miR-21 inhibition in the PIEC cells. [score:9]
To determine the regulatory target of miR-21, TargetScan (version 6.2) was used to predict the putative targets (http://www. [score:8]
Dual-luciferase reporter analysis demonstrated that miR-21 directly targeted the 3’ UTR of TGFβI, and mutations in the binding site abolished the suppression of luciferase activity by miR-21. [score:7]
To understand the biological function and regulatory mechanism of ssc-miR-21 in skeletal muscle development, TargetScan (version 6.2) and miRanada were used to predict the putative targets of miR-21. [score:7]
Considering the inverse correlation observed between the miRNA and target gene expression, we assayed the co -expression and abundances of ssc-miR-21 and TGFβI in the skeletal muscle. [score:6]
The over -expression of ssc-miR-21 led to decreased TGFβI mRNA levels by 29.21% compared to the negative control, and miR-21 inhibitor could exert potent effects on TGFβI expression (Fig 3C). [score:6]
Here, we postulate that miR-21 may have played a regulatory role in skeletal muscle myogenesis through the suppression of TGFβI expression, thereby governing cell growth, survival and cellular homeostasis. [score:6]
Ssc-miR-21, ssc-miR-30d, ssc-miR-181, ssc-miR-199*, and ssc-miR-378 were all expressed at higher levels at the prenatal compared with the neonatal stage, and their distinct expression patterns during muscle development clearly reflected the relationship between miRNA and myogenesis. [score:5]
These results suggest that miR-21 regulated skeletal muscle development by targeting TGFβI. [score:5]
The miR-21 mimics (double-stranded RNA oligonucleotides) and negative control duplexes, the miR-21 inhibitor (single-stranded RNA oligonucleotides) and inhibitor negative control duplexes were synthesized by GenePharma. [score:5]
Immunoblotting results showed that over -expression of miR-21 attenuated TGFβI protein, whereas miR-21 inhibitor significantly promoted TGFβI protein in PIEC cells. [score:5]
Because the target prediction analysis of this study indicated a potential pairing between miR-21 and the 3’ UTR region of TGFβI and considering the biological function of TGFβI in the process of myogenesis, we concluded that TGFβI was a candidate target gene for miR-21. [score:5]
The results showed that ssc-miR-21 expression varied greatly among the various tissues; it was expressed highly in the ovaries, moderately in the spleen, and only slightly in the other tissues (Fig 4A). [score:5]
0119396.g006 Fig 6 Taken together, we identified miRNA-21 as a new myogenesis miRNA and documented that miR-21 directly affected PI3K/Akt/mTOR signaling by targeting TGFβI during skeletal muscle development in pigs. [score:5]
In our study, we found that miR-21 was expressed throughout the entire period of skeletal muscle development in the Tongcheng pigs. [score:4]
These results suggest that miR-21 affected PI3K/AKT/mTOR signaling by suppressing TGFβI during swine skeletal muscle development. [score:4]
The miR-21 has been implicated in carcinogenesis, and it is up-regulated in many cancers [20– 23]. [score:4]
Expression analysis of ssc-miRNA-21 and TGFβI during skeletal muscle development. [score:4]
Of the miRNAs identified, we found that ssc-miR-21 was up-regulated by 17-fold in the skeletal muscle on E90. [score:4]
gov/) to further delineate the possible roles and mechanisms of ssc-miR-21 and its targets in mediating muscle development. [score:4]
B. Expression profiles of miR-21 at different developmental stages. [score:4]
As presented in Table 2, one class showed 100-fold greater levels of expression at E90 compared to D100, which included ssc-miR-126, ssc-miR-143-3p, ssc-miR-127, ssc-miR-148a, ssc-miR-196b-5p, and ssc-miR-369; another class exhibited expression levels of were slightly lower than 100-fold, which included ssc-miR-542-3p, ssc-miR-99b, ssc-miR-378, ssc-miR-30a-5p, ssc-miR-10b, and ssc-miR-21. [score:4]
Validating TGFβI as a regulatory target for miRNA-21. [score:4]
After the PIEC cells were transfected for 48 hours with miR-21 mimics/negative control and miR-21 inhibitor/inhibitor negative control, cell proteins were extracted using the T-PER Mammalian protein extraction Reagent (Pierce), and E90 and D100 longissimus dorsi proteins were isolated with T-PER Tissue Protein Extraction (Thermo) according to the manufacturer’s protocol. [score:3]
Considering that high levels of miR-21 were observed at the last key myogenesis time point, we hypothesize that miR-21 may be expressed in a tissue-specific and/or stage-specific manner to promote myoblast growth and ultimately promote muscle fiber formation during the prenatal stages in Tongcheng pigs. [score:3]
Postnatally, ssc-miR-21 was expressed at low levels in the myocardial and longissimus dorsi tissues. [score:3]
Moreover, the mutations of the putative binding sites at the TGFβI 3’ UTR abrogated this repression, supporting the direct interaction of ssc-miR-21 with the TGFβI 3’ UTR (Fig 3B). [score:3]
Expression profiles of miR-21 and TGFβI in Tongcheng pigs. [score:3]
Nine differentially expressed miRNAs (ssc-miR-7a, ssc-miR-10b, ssc-miR-21, ssc-miR-30d, ssc-miR-127, ssc-miR-148a, ssc-miR-181, ssc-miR-199*, and ssc-miR-378) were chosen for the validation of the Solexa sequencing data via RT-qPCR. [score:3]
Crosstalk between miR-21, the target gene TGFβI and the PI3K/Akt/mTOR signaling pathway in myogenesis. [score:3]
Based on these in vivo and in vitro experiments, we concluded that ssc-miR-21 directly regulates endogenous TGFβI protein synthesis during myogenesis. [score:3]
2013; doi: 10.1016/S2095-3119(13)60419-0 20 Yin Jie, Bai Zhigang, Song Jianning, Yang Yun, Wang Jin, Han Wei, et al Differential expression of serum miR-126, miR-141 and miR-21 as novel biomarkers for early detection of liver metastasis in colorectal cancer. [score:3]
TGFβI is a target for miR-21. [score:3]
However, no studies have been conduction assessing the expression and function of miRNA-21 in myogenesis. [score:3]
To validate whether TGFβI is directly targeted by ssc-miR-21 in the pig, we engineered a luciferase reporter that included either the wild-type or the mutant 3’ UTR of TGFβI, and a dual luciferase assay was performed using the PIEC cells. [score:3]
We observed that miR-21 regulated PI3K/Akt/mTOR signaling by targeting TGFβI based on dual luciferase and western blot assays. [score:3]
Analyses were performed according to B. D. Correlation between miR-21 and TGFβI expression during myogenesis in pigs. [score:3]
Next, we assessed the expression of TGFβI in the skeletal muscle at the 28 stages in which ssc-miR-21 was detected. [score:3]
Target prediction and pathway analysis for miRNA-21. [score:3]
Therefore, we explored the associations of ssc-miR-21 and TGFβI expression with alterations in the PI3K/Akt/mTOR pathway. [score:3]
To further explore the functions of ssc-miR-21 in skeletal muscle development, we measured its dynamic expression in the skeletal muscle at 28 developmental stages (33, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 and 105 dpc and 0, 9, 20, 30, 40, 60, 80, 100, 120, 140, 160 and 180 dpn and in adult pigs) using quantitative PCR. [score:3]
As shown in Fig 4B, ssc-miR-21 exhibited dynamic expression in the prenatal and post-natal skeletal muscles. [score:3]
In the prenatal skeletal muscle, ssc-miR-21 expression was maintained at generally low levels from 33 to 80 days. [score:3]
The overexpression of miR-21 may remarkably enhance the proliferation and migration of the vascular smooth muscle cells of the lungs [49]. [score:3]
We profiled the miRNA transcriptome in the skeletal muscle at 90 days post coitus (E90) and 100 days postnatal (D100) and found that miR-21 was significantly (17-fold) differentially expressed. [score:3]
We subsequently analyzed the expression of ssc-miR-21 in nine different tissues (heart, liver, spleen, lung, kidney, small intestine, uterus, ovary and longissimus dorsi) of the adult Tongcheng pigs. [score:3]
Bioinformatics prediction analysis suggested that TGFβI was a putative target of miR-21. [score:3]
The relative expression of miR-21 was compared to the internal control reference U6 and was analyzed using ΔΔCt. [score:2]
Chen et al. reported that during the development of vertebrate mo dels (such as zebrafish), miR-21 can be observed after 12 hours in the embryo and accounts for 40% of all miRNAs [50]. [score:2]
In the present study, we hypothesized that miR-21 facilitated myogenesis by regulating the PI3K/Akt/mTOR pathway (Fig 6). [score:2]
Our findings contribute to current knowledge of the roles of miRNA-21 and the molecular mechanisms of skeletal muscle development. [score:2]
To evaluate the myogenic roles of miR-21 and TGFβI, we examined the dynamic expression patterns in the skeletal muscle at 28 developmental stages. [score:2]
The co -expression of the luciferase reporter and the ssc-miR-21 -mimics/negative control (NC) revealed that the luciferase activity of the wild-type 3’ UTR, which contained the ssc-miR-21 binding sites, was significantly decreased compared to that of the negative control. [score:2]
We found that miR-21 was present at the highest levels at 90 dpc, after which the levels decreased throughout development and into adulthood. [score:2]
The results revealed that miRNA-21 and TGFβI were negatively correlated (r = -0.421, P = 0.026) at the mRNA level during the 28 stages of skeletal muscle development. [score:2]
Aside from ssc-miR-206 and ssc-miR-1, ssc-miR-378 was the most abundant at E90, followed by ssc-miR-143-3p, ssc-let-7a, ssc-let-7f, ssc-let-7c, ssc-miR-30d, ssc-miR-30a-5p, ssc-miR-10b, ssc-miR-127, ssc-miR-148a, ssc-miR-126, ssc-miR-7i, and ssc-miR-21. [score:1]
Additionally, we obtained a psi-check2 luciferase reporter vector containing the mutant 3’ UTR of TGFβI and sharing a 7-bp deletion in the conserved miR-21 binding site from Shanghai Generay Biotech. [score:1]
The findings of miR-21 can contribute to our current knowledge of porcine myomiRs. [score:1]
In this study, we demonstrated that miR-21 was a potential novel, myogenic miRNA. [score:1]
0119396.g004 Fig 4 A. Tissue distribution of miR-21. [score:1]
The PIEC cells were co -transfected with the psi-check2-TGFβI 3’ UTR and miR-21 mimics/negative control duplex. [score:1]
A. The predicted binding site between miR-21 and the TGFBI 3' UTR. [score:1]
The results showed that the expression levels of ssc-miR-21 and TGFβI were significantly negatively correlated (r = -0.421, P<0.05) during the 28 stages evaluated in the Tongcheng pigs (Fig 4D). [score:1]
The PIEC cells were co -transfected with 200 ng psi-check2-TGFβI-3’UTR plasmid/ TGFβI-3’UTR mut and 20 pM miR-21 mimics/negative control using the Lipofectamine 2000 reagent (Invitrogen) in 24-well plates. [score:1]
We further examined the effects of ssc-miR-21 on endogenous TGFβI at both the mRNA and protein levels in the PIEC cells. [score:1]
The levels of miR-21 were lower at 33 days during the embryonic stage and higher during the later embryonic stages, thus, it may be inferred that miR-21 played positive roles in the formation and growth of muscle fibers (leading to increased lengths and diameters). [score:1]
A. Tissue distribution of miR-21. [score:1]
Of them, ssc-miR-21 has been recognized as the most prominent miRNA implicated in carcinogenesis. [score:1]
B. Detection of luciferase activity in the PIEC cells after co-transfection with the luciferase reporter and miR-21/NC. [score:1]
ssc-miRNA-21 plays a positive role by promoting PI3K/Akt/mTOR signaling. [score:1]
Based on the progress of miR-21 in kinds of cell lines, we speculated that miR-21 might take part in the myogenesis of porcine skeletal muscle. [score:1]
The miR-21 participates in the formation of multiple tissues, including the secretory gland, lungs and kidney [48]. [score:1]
These findings indicate that miRNA-21 may play an important role during prenatal myogenesis. [score:1]
0119396.g003 Fig 3 A. The predicted binding site between miR-21 and the TGFBI 3' UTR. [score:1]
However, no studies have been performed investigating the expression and function of miR-21 in pigs’ myogenesis to date. [score:1]
[1 to 20 of 75 sentences]
3
[+] score: 63
The results of transient transfection assays demonstrated that (1) miR-21 negatively regulates the expression of Pitx2c (this work), (2) miR-1 suppresses Myocd expression [53], and (3) miR-10a and miR-10b both inhibit Tbx5 expression [54]. [score:11]
An aspect of particular interest of our study was the finding that the upregulation of miR-1, miR-10a, miR-10b, and miR-21 is negatively correlated with downregulation of, respectively, MYOCD, TBX5, and PITX2c in the paced LA (see Figure 5(e)). [score:7]
Likewise, expression of miR-21 was upregulated in the LA of patients with long-term persistent AF [60], as well as after short-term AF in pigs (this work). [score:6]
Transfection of HL-1 cardiomyocytes with miR-21 mimic silenced Pitx2c expression to a certain, but statistically significant, extent, whereas anti-miR-21 induced a marked increase in the Pitx2c transcript without affecting the expression of Mef2c (myocyte enhancer factor 2c) TF. [score:5]
To this end, miR-21 mimic and anti-miR-21 inhibitor were transfected into atrial HL-1 cardiomyocytes and the expression of Pitx2c gene was detected by qRT-PCR and Western blot (Figures 5(b), 5(c), and 5(d)). [score:5]
Computational analysis (by miRanda and Targetscan) of the 3′ untranslated region of pig Pitx2, Tbx5, and Myocd genes revealed consensus sites for binding of, respectively, miR-21, miR-10a/miR-10b, and miR-1 (Figure 5(a)). [score:5]
A complimentary Western blot analysis (Figures 5(c) and 5(d)) revealed that PITX2C protein levels were significantly decreased in miR-21 transfected cells, being only slightly upregulated after anti-miR-21 delivery. [score:4]
Of note, endogenous miR-21, abundantly expressed in HL-1 cells [55], may interfere with Pitx2-silencing by miR-21 mimic transfection. [score:3]
Our qPCR analysis showed that pacing resulted in a significant upregulation of a set of AF -associated miRNAs (i. e., miR-1, miR-10a, miR-10b, miR-21, miR-29a, and miR-208a) in the LA compared with the control (see Figure 3). [score:3]
Consistent with the results obtained and other reports [53, 54], the histogram plot (Figure 5(e)) exhibits a clear inverse correlation in the protein expression of Pitx2 versus miR-21, Tbx5 versus miR-10b, and Myocd versus miR-1 in the LA of paced animals, confirming thus our hypothesis. [score:3]
Pacing -induced alterations in the expression of other miRNAs with particular concern for their involvement in AF could not be determined by microarray hybridizations due to a high variability among replicates (miR-1, miR-21, miR-23a/b, miR-29a, and miR-133a) or very low hybridization signals (miR-10a, miR-10b; see the complete microarray data at NCBI through GEO accession number GSE65330). [score:3]
In this study, we attempted to validate, for the first time, whether miR-21 can alter Pitx2 expression in a cardiomyocyte background. [score:3]
Six miRNAs (miR-1, miR-10a-5p, miR-10b, miR-21, miR-29a, and miR-208a) showed a higher expression in paced as compared with nonpaced animals. [score:2]
HL-1 cells (6 × 10 [5] cells per well) were transfected with pre-miR-21 (Ambion, USA) and anti-miR-21 (Eurogentec, Belgium) at 10–50 nM using Lipofectamine 2000 (Invitrogen, Barcelona, Spain) according to manufacturer's gui delines. [score:1]
From this perspective, our data would suggest that higher levels of miR-21, miR-10b, and miR-1 in the LA myocardium contribute to arrhythmogenesis via perturbation of Pitx2, Tbx5, and Myocd signaling pathways, respectively. [score:1]
The latter could probably be the result of additional mechanisms influencing the Pitx2c transcript versus protein ratio in anti-miR-21 transfected cells. [score:1]
[1 to 20 of 16 sentences]
4
[+] score: 62
Ahn J. Lee H. Jung C. H. Ha T. Lycopene inhibits hepatic steatosis via microRNA-21 -induced downregulation of fatty acid -binding protein 7 in mice fed a high-fat dietMol. [score:6]
Among 13 miRNAs, ssc-miR-21 expression was significantly upregulated following treatment with CLA (Figure 1 and Table S7). [score:6]
In the miR-21 [−/−] mice, the gene expression profiles showed that groups of lipid metabolism genes were changed, including PPARα, which was identified as a direct target of miR-21 [29]. [score:6]
Diets with 1.5% CLA caused the expression of ssc-miR-21 and ssc-miR-146b to be upregulated at 30, 90, and 240 days old in subcutaneous adipose tissues, and at 240 days old in abdominal adipose tissues. [score:6]
In human adipose tissue-derived mesenchymal stem cells (hASCs), miR-21 enhanced adipogenesis by modulating the transforming growth factor beta (TGF-β) signalling pathway, and an overexpression of miR-21 decreased the cell proliferation of hASCs by targeting the signal transducer and activator of transcription 3 (STAT3) [31]. [score:5]
In the present study, we found a significant negative correlation between the expression of miR-21 and PPARγ in adipose tissues, suggesting that the greater levels of miR-21 induced by CLA treatment resulted in decreased PPARγ expression. [score:5]
miR-21 expression significantly correlated with PPARγ expression (r = −0.959, p < 0.05). [score:5]
An overexpression of miR-21 significantly blocked stearic acid -induced intracellular lipid accumulation by targeting fatty acid -binding protein 7 (FABP7). [score:5]
Kang M. Yan L. M. Zhang W. Y. Li Y. M. Tang A. Z. Ou H. S. Role of microRNA-21 in regulating 3T3-L1 adipocyte differentiation and adiponectin expressionMol. [score:4]
Kang et al. found that miR-21 significantly promoted adipocyte differentiation by increasing the expression of adiponectin and decreasing activator protein 1 (AP-1) level in 3T3-L1 adipocytes [30]. [score:3]
We further analysed correlations between the expression of DE miRNAs (ssc-miR-21 and ssc-miR-146b) and the adipocyte phenotype. [score:3]
Ssc-miR-21 and ssc-miR-146b were expressed differentially in both adipose tissues. [score:3]
In high-fat-diet-fed mice, the expression of miR-21 was decreased in the liver compared with chow-fed mice [28]. [score:2]
It has been demonstrated that miR-21 is a representative miRNA that is functionally involved in lipid metabolism and adipogenesis [27]. [score:1]
Several studies in vitro have shown that miR-21 was also involved in adipogenesis. [score:1]
Among these 14 DE miRNAs, miR-21 and miR-146b were identified in both adipose tissues and we speculated that they played a crucial role in adipogenesis by CLA treatment. [score:1]
[1 to 20 of 16 sentences]
5
[+] score: 50
The microRNAs showing remarkably high expression level in our study namely miR-21 is a powerful anti-inflammatory regulator, which by direct targeting of a PDCD4 gene inhibits the pro-inflammatory regulator NF-kB. [score:10]
Furthermore, the relative expression of miR-21 detected by RNAseq points towards up-regulation of this microRNAs in visually unaffected sample in comparison to the necrotic sample (visually unaffected sample contains more than 2 times more reads than the necrotic). [score:6]
In the present study, miR-21 shows down-regulation in the necrotic sample in comparison to the visually unaffected one, however supported by quite low p-values (Table  4). [score:4]
Moreover, the levels of anti-inflammatory cytokine IL-10 are increased upon miR-21 up-regulation [65]. [score:4]
The following five miRNAs (miR-21, miR-143-3p, miR-146a-5p, miR-223, miR-664-5p), target over ten different protein coding genes. [score:3]
No differential expression was found between the samples included in the RT-qPCR experiment, which could indicate an important role of miR-21 in the homeostasis of lung. [score:3]
However, our study detected an extremely high expression of miR-21 in all the samples, regardless the infection status. [score:3]
MiR-21 is by far, the most expressed of all the assayed microRNAs, showing very high, stable expression in the lung tissue, regardless the presence/degree or absence of infection. [score:3]
Similar results of high expression of miR-21 have been found in viral infection of porcine dendritic cells [66]. [score:3]
Literature reports a number of microRNAs, mainly miR-21, miR-155, miR-146a, miR-223 to be important regulators of the protein coding genes involved in the above mentioned pathways [60], [61], [63]. [score:2]
Two targets of miR-21: Interleukin I Beta (IL1β) and tumor necrosis factor, alpha -induced protein 3 (TNFAIP3), which is rapidly induced by the TNF were assayed by RT-qPCR on mRNA in another APP infection study in pigs [23]. [score:2]
RT-qPCR performed on miR-21 detected the highest expression level of all the assayed microRNAs. [score:2]
Noteworthy, the top two, most abundant microRNAs, namely miR-143 and miR-21 are shared between the two libraries. [score:1]
The second most abundant microRNA in both samples – miR-21 is involved in many biological scenarios [58- 61]. [score:1]
Of the miRNAs investigated in the present study, miR15a, miR21, miR126, miR142-5p, miR144-5p, miR146a-5p, miR148a, miR152, miR155, miR192, miR-223, miR-45 and miR-d5 are 5'-miRNAs hence only the mature miRNAs of these targets were detected. [score:1]
However, according to read counts miR-21 is placed as the second most abundant transcript, right after miR-143. [score:1]
The ncRNAs chosen for RT-qPCR validation were: miR-15a, miR-21, miR-126, miR-142-5p, miR-143-3p, miR-144*, miR-146a-5p, miR-148a, miR-155, miR-223, miR-451, miR-664-5p, miR-d5 and SNORD15. [score:1]
[1 to 20 of 17 sentences]
6
[+] score: 37
To verify that this high expression of miR-21 was not due to technical artefacts of deep sequencing, the expression of miR-21 was examined using qPCR in independent samples (DCs challenged with PRV in the same conditions and collected at 4 and 12 hours PI) and compared to the levels of expression of six known miRNAs (miR-339-3p, miR-184, miR-7, miR-370, miR-708*, miR-29b-1*) and U6 small nuclear RNA. [score:6]
MicroRNAs are known to be differentially expressed depending on the developmental stage and tissue [37] and the high expression of miR-21 may be related to cell differentiation. [score:6]
The low Ct values obtained for miR-21 expression confirmed that this miRNA was expressed several folds more than other miRNAs and U6 small RNA molecule in both infected and uninfected samples. [score:5]
The extremely high expression of miR-21 was confirmed for both mock and infected samples; miR-21 was expressed at about 50 fold higher level than U6 RNA and between 3,000 and 20,000 fold higher than porcine miRNAs (Figure S2). [score:5]
In order to test the level of expression of miR21 vs. [score:3]
In particular miR-21 was the most abundantly expressed miRNA, with a mean of nearly 1,500,000 sequence found in both infected and control samples representing almost 91% of all small RNA sequence tags. [score:3]
The most abundant identified miRNA was miR-21, followed by two members of the let-7 family (ssc-let-7f, ssc-let-7c) known to be the most abundantly expressed in higher eukaryotes. [score:3]
Figure S2 Expression level of miR-21 compared to other porcine miRNAs and to U6 small nuclear RNA. [score:2]
The analysis of the deep sequencing data revealed that miR-21 expression was very high, both in infected and mock infected cells at 8 h PI, compared to other miRNAs, and this finding was confirmed by qPCR tests on independent samples. [score:2]
The DCs analyzed in this study were obtained by in vitro differentiation of monocytes purified from peripheral blood mononuclear cells (PBMCs), and miR-21 has been previously reported as being involved in phenotypic and functional differentiation of Monocyte-Derived Dendritic Cells (MDDC) [38], [39]. [score:1]
let-7, miR-21 and others) [40], [41]. [score:1]
[1 to 20 of 11 sentences]
7
[+] score: 35
This study used high-throughput sequencing to compare miRNA expression in pigs susceptible and resistant to E. coli F18 infection and identified 12 miRNAs with differential expression, including 11 upregulated in susceptible animals, ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and one down-regulated, ssc-miR-152. [score:11]
Interestingly, one of the miR-21 target genes is the PTEN tumor suppressor [27]. [score:5]
MiR-21 is wi dely expressed in mammals and is overexpressed in lung, breast, glioblastoma, stomach, pancreatic, liver, colon, and ovarian cancers, indicating an essential role in cancer development. [score:5]
miRNAs overexpressed in E. coli F18-sensitive individuals include ssc-miR-143 (highest expression), ssc-let-7f, ssc-miR-143, ssc-miR-192, ssc-miR-21, ssc-miR-215, ssc-miR-378, ssc-miR-145, ssc-miR-26a, and ssc-miR-30e. [score:5]
These included 11 with increased miRNA expression in E. coli F18-sensitive pigs, ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and one with reduced miRNA expression, ssc-miR-152. [score:5]
MiRNAs with a mean value >10000 by sequence counting (i. e., expression) included ssc-miR-143, ssc-let-7f, ssc-miR-192, ssc-miR-21, ssc-miR-215 and ssc-miR-378. [score:3]
l Note: 1, ssc-miR-27b; 2, ssc-miR-215; 3, ssc-miR-21; 4, ssc-miR-192; 5, ssc-miR-15b; 6, ssc-miR-148a; 7, ssc-miR-143–5p; 8, ssc-let-7f; 9, ssc-miR-152. [score:1]
[1 to 20 of 7 sentences]
8
[+] score: 32
However, there were few differences in expression levels, for example, the expression of ssc-miR-21, ssc-miR-142-5p and ssc-miR-7134-3p were not detected in the castrated male pigs according to the SOLiD sequencing, but a trace amount of expression was detected by RT-qPCR in the castrated male pigs. [score:7]
Based on our results, the TGFBR2 gene was the target of down-regulated ssc-miR-23b, ssc-miR-320a, ssc-miR-103, ssc-miR-142-5p and miR-21. [score:6]
The expression levels of ssc-miR-21, ssc-miR-142-5p, ssc-miR-27a, ssc-miR-7134-3p and ssc-miR-103 were significantly higher in the intact male pigs than in the castrated male pigs, while the expression levels of ssc-miR-30a, ssc-miR-143 and ssc-miR-F3-C13 were lower in the intact male pigs (Figure  5). [score:5]
However, the significantly different expression of miR-21 between castrated and intact male pigs (0 vs 83,244 reads) was unexpected because it is inconsistent with an increase in miR-21 expression during adipogenic differentiation of hASCs [26]. [score:5]
In contrast with miRNAs regulating the MAPK signaling pathway, five of the miRNAs involved in the TGF-beta signaling pathway for fat deposition (ssc-miR-23b, ssc-miR-320a, ssc-miR-103, ssc-miR-142-5p and ssc-miR-21) had decreased levels of expression in castrated male pigs. [score:4]
Ribas et al. showed that androgen -induced AR can bind to the defined miR-21 promoter, miPPR-21, which demonstrated that AR can directly regulate the transcription of miR-21 mRNA [17, 18]. [score:3]
A total of eight miRNAs were validated in the castrated and intact male pigs: ssc-miR-21, ssc-miR-30a, sssc-miR-27a, ssc-miR-143, ssc-miR-103, ssc-miR-142-5p ssc-miR-F3-C13 and ssc-miR-7134-3p. [score:1]
In the F4 library, the 10 most abundant miRNAs (ssc-miR-320a, ssc-miR-21, ssc-miR-191, ssc-miR-143, ssc-miR-145, ssc-miR-423-5p, ssc-miR-7134-3p, ssc-miR-152, ssc-miR-195 and ssc-miR-193a) had reads numbering from 30,883 to 111,160, which contributed to 58.15% of the total miRNAs. [score:1]
[1 to 20 of 8 sentences]
9
[+] score: 26
Among them, let-7 g, miR-17-5p, miR-17-3p, miR-20a, miR-181a, miR-16, miR-146b, miR-10b, and miR-155-5p were upregulated; let-7c, miR-122, miR-18a, miR-19a, miR-19b, miR-196b, miR-21, and miR-9 were downregulated. [score:7]
In contrast, expression of the downregulated immune-related miRNAs was not significantly different, except miR-18a, miR-19b, and miR-21. [score:6]
The expression levels of ssc-miR-10b, ssc-miR-30a-5p, ssc-miR-16, ssc-miR-17-5p, and ssc-miR-192 in the PPV-infected cells were higher than in the uninfected cells, whereas ssc-miR-21, ssc-miR-19b, ssc-miR-18a, ssc-miR-152, and ssc-miR-novel-chr13_10861 were downregulated compared to the uninfected cells (Fig.   2). [score:5]
miR-21, which had high read numbers in both normal and PPV-infected cells, was downregulated; it is related to immune response and virus replication [15]. [score:4]
ssc-miR-21 was the most abundantly expressed miRNA, followed by ssc-miR-30a-5p. [score:3]
Many immune-related miRNAs have been identified in innate and adaptive immune systems, including the miR-17—92 cluster, miR-221, miR-10, miR-196b, miR-126, miR-155, miR-150; miR-181a, miR-326, miR-142-3p, miR-424, miR-21, miR-106a, miR-223, miR-146; the let-7 family, miR-9, and miR-34 [6]. [score:1]
[1 to 20 of 6 sentences]
10
[+] score: 21
Among the up-regulated miRNAs, ssc-miR-21 has the highest expression, while in the down-regulated miRNAs, ssc-let-7c has the highest expression level. [score:11]
STAT3 is a target gene of miR-21 and PCNA is the target of miR-24-3p. [score:5]
miRNA Name Sequence (5'–3') Regulation p-Value ssc-miR-21 TAGCTTATCAGACTGATGTTGA Up 0 ssc-miR-148b-3p UCAGUGCAUCAGAACUUUGU Up 0 ssc-miR-92a TATTGCACTTGTCCCGGCCTGT Up3.4 × 10 [−135] ssc-miR-423-3p AGCUCGGCUGAGGCCCCUCAGU Up1.1 × 10 [−154] ssc-miR-26 TTCAAGTAATCCAGGATAGGCT Down4 × 10 [−155] ssc-miR-24-3p UGGCUCAGUUCAGCAGGAACAG Down1.37 × 10 [−81] ssc-miR-181a AACAUUCAACGCUGUCGGUGAGUU Down1.67 × 10 [−61] ssc-miR-151-5p UCGAGGAGCUCAGUCUAGU Down6.9 × 10 [−4] Target gene prediction was performed to further understand the physiological functions and biological processes involving these miRNAs during mammary gland development and lactation, (Figure 7) based on miRNA/mRNA interactions to provide some molecular insight into the processes. [score:5]
[1 to 20 of 3 sentences]
11
[+] score: 19
Human cytomegalovirus was reported to inhibit expression of miR-21 targeting Cdc25a followed by promoting cells to enter G1/S transition, thereby benefiting viral replication 49. [score:7]
miR-21 and miR-34a have been also shown to regulate the cell cycle progression by targeting relevant G1-to-S transit proteins. [score:4]
In the present study, we found that only miR-15a but not other miRNAs including miR-16, miR-21, and miR-34a, exhibited significant upregulation in the synchronized PCV2-infected PK15 cells. [score:4]
Therefore, we further determined the expression levels of miR-21 and miR-34a in the synchronized PCV2-infected PK15 cells and found that no obvious changes were observed as compared to that in the mock-infected cells (Fig. 4). [score:2]
Synchronized PK15 cells were mock infected or infected with PCV2 at an MOI of 1. At 24 h postinfection, expression levels of miR-15a and miR-16 as well as miR-21 and miR-34a were assayed by qRT-PCR. [score:2]
[1 to 20 of 5 sentences]
12
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22]. [score:5]
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27. [score:3]
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 15
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Recently, Zhao et al. (2016) showed that miR-21 is abundantly expressed and its action modulates alkalinity stress by upregulating VEGFB and VEGFC expression in vivo and in vitro, which are responsible for regulating alkalinity tolerance. [score:9]
Ramachandra et al. (2008) discovered 14 miRNAs in early embryos (5 dpf); among these, miR-21, miR-30d, miR-92a, miR-200, and miR-26 are associated with differentiation and development. [score:2]
The miRNA families miR-181, miR-143, and miR-21 were the most abundant in control groups, while miR-21, miR-181, and miR-30 were the most abundant in animals infected with P. salmonis (Valenzuela-Miranda et al., 2017). [score:1]
Sea louse Caligus rogercresseyi, which affects Chilean aquaculture, were studied during infestation in Atlantic salmon and the most abundant families were mir-10, mir-21, mir-30, mir-181, and let7 in skin, head and kidney (Valenzuela-Muñoz et al., 2017). [score:1]
Therefore, miR-21, miR-30c, and miR-429 may be important markers for tilapia and also for other commercial species. [score:1]
Role of miR-21 in alkalinity stress tolerance in tilapia. [score:1]
[1 to 20 of 6 sentences]
14
[+] score: 15
Researchers, who assessed the effects of garlic on miRNA expression levels in mice, reported that garlic downregulated miR-1959, miR-203 and miR-21 and upregulated 11 miRNAs [40]. [score:9]
Infections with Eimeria papillata parasites induced miRNA expression in mouse jejunum; four miRNAs (miR-1959, miR-203, miR-21 and miR-M23-1-5p) were upregulated [39]. [score:6]
[1 to 20 of 2 sentences]
15
[+] score: 13
Common to all five miRNAs found to correlate negatively with apoptosis-related gene expression (ssc-miR-15a, ssc-miR-18a, ssc-miR-21, ssc-miR-29b, and hsa-miR-590-3p) is that they were significantly up-regulated on day 3 after challenge, and not regulated at other time points. [score:7]
This negative correlation between miRNA expression and their target transcripts thus suggest the specific involvement of ssc-miR-15a, ssc-miR-18a, ssc-miR-21, ssc-miR-29b, and hsa-miR-590-3p in the modulation of important signaling cascades of apoptosis and viral recognition. [score:5]
These include ssc-miR-7 [56], ssc-miR-15a [26], ssc-miR-18a [26, 56], ssc-miR-21 [55, 56], mmu-miR-34b-3p [26], ssc-miR-34c [26], ssc-miR-92b-3p [26], ssc-miR-193a-3p [55], hsa-miR-449a [26], and ssc-miR-671-3p [26]. [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 13
Of these, 40 miRNAs are minimally expressed (0 < average signals ≤ 100; p ≤ 0.01), 77 miRNAs are modestly expressed 100 < average signals ≤ 1,000; p ≤ 0.01), 85 miRNAs were highly expressed (1,000 < average signals ≤ 10,000), and, in particular, 20 miRNAs were extremely highly expressed in the anterior pituitary (average signals ≥ 10,000; p ≤ 0.01), including ssc-miR-7, Y-90, ssc-miR-26a, ssc-miR-125b, Y-1, ssc-miR-125a, Y-77, ssc-let-7g, ssc-miR-29a, ssc-let-7i, ssc-let-7a, ssc-let-7f, ssc-miR-148a, ssc-miR-21, ssc-miR-335, ssc-miR-30b-5p, ssc-miR-191, ssc-miR-29c, ssc-miR-23b, and ssc-miR-23a (Fig 1C). [score:9]
It was reported that anterior pituitary-enriched miR-21 was down-regulated in ACTH-secreting pituitary tumours[27]. [score:4]
[1 to 20 of 2 sentences]
17
[+] score: 12
For example, ssc-miR-21 was significantly up-regulated (log2fold change (logFC) = 1.31, FDR < 1E-6, Fig. 1B), and ssc-miR-146a was significantly down-regulated (logFC = −0.91, FDR < 1E-5, Fig. 1B) at 2 dpi. [score:7]
This study identified differential expression of several miRNAs previously linked to immune response including miR-21, miR-146a and miR-125a 13, and reported several miRNAs not previously linked to immune response to Salmonella infection, such as miR-214, miR-30e-3p and miR-331. [score:3]
Several miRNAs previously reported to be involved in immune response such as miR-21, miR-125a, miR-99b, miR-146a and let-7 families were identified. [score:1]
While 23 miRNAs were DE in PS samples (Table 1), only three were DE in LS (miR-21, miR-340, miR-148a). [score:1]
[1 to 20 of 4 sentences]
18
[+] score: 8
This study also found a series of miRNAs that target host-encoded pre-miRNAs; for example, ssc-miR-9, ssc-miR-19a, ssc-miR-142–5p, ssc-miR-134 and ssc-miR-20c-5p all target ssc-mir-21. [score:5]
Among them, ssc-let-7f, which is derived from the let-7 -family, and the ssc-miR-21 had the highest expression level, and this result is consistent with previous studies [19]. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Ye et al. (2012) examined miRNA expression in the duodenum of E. coli F18-sensitive and -resistant weaned piglets and identified 12 candidate miRNA (ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and ssc-miR-152) disease markers. [score:5]
Additionally, a number of miRNAs including miR-148a, miR-26a, miR-21-5p, miR-27b, miR-143, bta-miR-30a-5p, let-7a-5p, let-7f, miR-10b, and miR-99a-5p are highly expressed in bovine mammary gland/mammary epithelial cells (Li et al., 2012a, 2014a; Jin et al., 2014a; Le Guillou et al., 2014) suggesting roles in the lactation process and mammary gland functions. [score:3]
[1 to 20 of 2 sentences]
20
[+] score: 6
According to the high-throughput sequencing data, the let-7 family (let-7a, let-7f, let-7 g), the miR-10 family (miR-10b, miR-10a-3p, miR-10a-5p), miR-21, miR-143-3p, miR-30a-5p, miR-16 and miR-192 had the highest expression levels among the 10 expression profiles (Additional file  1: Figure S3), which suggests that these miRNAs are highly conserved among different organs in the same species. [score:5]
For example, ssc-let-7a, ssc-let-7c, ssc-let-7f, ssc-let-7 g and ssc-let-7i from the let-7 family and ssc-miR-21 maintained high transcription levels in all samples, which is consistent with previous findings [23] (Additional file  1: Figure S3). [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 6
The unified set of top 10 unique miRNAs over the two pig breeds correspond to 15 unique miRNAs, 11 of which (ssc-let-7a-1/2-5p, ssc-let-7c-5p, ssc-let-7e-5p, ssc-miR-10a-5p, ssc-miR-10b-5p, ssc-miR-127-3p, ssc-miR-148a-3p, ssc-miR-199a-1/2-5p, ssc-miR-21-5p, ssc-miR-26a-5p, ssc-miR-125b-1-5p) had been frequently reported highly expressed in skeletal muscle during porcine prenatal and postnatal developmental stages. [score:4]
For example, Qin et al. had reported that ssc-let-7a, ssc-miR-10a, ssc-miR-10b, ssc-miR-127, ssc-miR-148a, ssc-miR-21, ssc-miR-26a were the most abundant miRNAs during porcine skeletal muscle developmental stages from 35 days post coitum to postnatal day 180 [25]. [score:2]
[1 to 20 of 2 sentences]
22
[+] score: 6
Only the DE miR-21 showed a higher expression in LC mature testes than in LW mature testes within the breed. [score:3]
Moreover, miR-21 could be regulated by the transcription factor ETV5, which is critical for SSC self-renewal to maintain the SSC population 54. [score:2]
Previous studies found that miR-21 is important for cell cycle in the testis and ovary 52 53. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 5
Fusobacterium nucleatum increases proliferation of colorectal cancer cells and tumor development in mice by activating toll-like receptor 4 signaling to nuclear factor-kappaB, and up -regulating expression of microRNA-21. [score:5]
[1 to 20 of 1 sentences]
24
[+] score: 5
Only four miRNAs (hsa-miR-223-5p, ssc-miR-31, ssc-miR-29a, and ssc-miR-182) were differentially expressed at 24 h pi, whereas 10 miRNAs were differentially expressed at 72 h pi (ssc-miR-29b, hsa-miR-203a-3p, hsa-miR-449a, ssc-miR-21, ssc-miR-29a, hsa-miR-23a-3p, ssc-miR-23b, ssc-miR-30c-5p, ssc-miR-423-5p, and hsa-miR-150-5p). [score:5]
[1 to 20 of 1 sentences]
25
[+] score: 5
In comparison to previous studies, Anselmo et al. [36] described miR-21 as the most expressed miRNA in their study by using dendritic cells as approach, representing almost 91% of all small RNA sequence tags, while Wu et al. [35] found miR-7f as the most expressed miRNA in a PK-15 cell line culture, being the 17% of total small RNA reads. [score:5]
[1 to 20 of 1 sentences]
26
[+] score: 4
Several miRNAs (i. e., let-7f, miR-21, miR-140, miR-185, miR-320, miR-423, miR-2476-1, miR-2476-2 and miR-2476-3) are indicated with arrows. [score:1]
Top panel: the predicted secondary structure of miR-21 with the annotated mature miRNA (purple) from miRBase database and a novel miRNA isoform (pink) detected from our study. [score:1]
For example, miR-21 is not the predominant sRNA (with 6,763 reads) in the miR-21 precursor, while another sRNA, which is 2-nt shorter than miR-21 at the 3′ end, is of the most abundance. [score:1]
miR-21 was shown in detail in the above chart. [score:1]
[1 to 20 of 4 sentences]
27
[+] score: 4
The upregulated miR-21 has been reported to promote atrial fibrillation (AF) in MI -induced heart failure in rats [27]. [score:4]
[1 to 20 of 1 sentences]
28
[+] score: 4
Conserved miRNAs showed comparable expression patterns and clustering revealed consistency between both approaches, e. g. miR-126, miR-24 and miR-22 were combined in the same cluster and together with miR-16, miR-21 and let-7d showed increased expression in colon compared with other loci (Figure 4). [score:4]
[1 to 20 of 1 sentences]
29
[+] score: 3
The microarray data showed that several microRNAs including let-7, miR-923, miR-202, miR-21 and miR-145 were highly expressed in the porcine testes (Table S2). [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 3
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
Using gene sequence comparisons and expression analysis, Lee and Ambros [23] reported that about 12% of miRNA in C. elegans, Drosophila and some plants are conserved and of these, miR-21, miR-234, miR-260 and miR-287 are highly conserved [23]. [score:3]
[1 to 20 of 1 sentences]
31
[+] score: 3
Other miRNAs from this paper: ssc-mir-424
For instance, miR-21 is transcriptionally suppressed by FOXO3a 36. [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 3
The ten most commonly sequenced miRNAs in swine alveolar macrophages are listed in Table 1. The highest expressed miRNA was ssc-miR-21 which represented ∼37% of the total miRNA reads. [score:3]
[1 to 20 of 1 sentences]
33
[+] score: 3
In other cases, there is an agreement in all breeds for the most expressed isomiR except in one breed, like in Ssc-miR-21 and Ssc-miR-100 in Iberian breed, Ssc-miR-152 in Piétrain breed, Has-miR-200c-3p in Vietnamese breed or Hsa-let-7d-5p in Landrace breed. [score:3]
[1 to 20 of 1 sentences]
34
[+] score: 3
For example, hsa-miR-21-5p has been documented in nearly 400 Pubmed articles and is associated with 124 human disease phenotypes and has homologs in four animals including chicken. [score:3]
[1 to 20 of 1 sentences]
35
[+] score: 3
The top 10 highest expressed miRNAs detected by deep sequencing were miR-148a, miR-101, miR-143-3p, miR-122, miR-30a-5p, miR-21, miR-30c, miR-192, miR-27b and miR-24 (Table S1). [score:3]
[1 to 20 of 1 sentences]
36
[+] score: 3
The selected miRNAs for the analysis include: miR-99b, miR-204, miR-27a, miR-24, miR-7, miR-145, miR-124, miR-21, miR-125b, miR-30b, miR-128a, miR-122, miR-183, and miR-103. [score:1]
0024883.g002 Figure 2 The selected miRNAs for the analysis include: miR-99b, miR-204, miR-27a, miR-24, miR-7, miR-145, miR-124, miR-21, miR-125b, miR-30b, miR-128a, miR-122, miR-183, and miR-103. [score:1]
0024883.g003 Figure 3 The selected miRNAs for the analysis include: miR-99b, miR-204, miR-27a, miR-24, miR-7, miR-145, miR-124, miR-21, miR-125b, miR-30b, miR-128a, miR-122, miR-183, and miR-103. [score:1]
[1 to 20 of 3 sentences]
37
[+] score: 3
Microarray revealed a total of 31 differentially expressed miRNAs, most of which had been detected in pig pituitary anterior lobe with high abundance in our previous study [20], such as let-7a, let-7c, miR-361-5p, miR-320, miR-21, miR-22, miR-152 and miR-15a. [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
Notably, prv-miR-1, prv-miR-14a, prv-miR-17a, prv-miR-21, prv-miR-24 and prv-miR-25 were encoded directly antisense to the individually corresponding coding gene, which could theoretically lead to the cleavage of the transcript and negative regulation of the gene. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-21 -1.1788 1.45E-02 1.68E-02 -2.4642 2.07E-04 3.85E-04 ssc-miR-143-3p -1.1940 1.40E-02 1.67E-02 -2.7004 2.27E-05 5.34E-05 ssc-miR-145-3p -1.2289 2.47E-02 2.68E-02 -2.6837 6.34E-04 1.10E-03 ssc-miR-505 -1.3657 2.68E-02 2.82E-02 -2.1577 4.16E-02 4.16E-02 ssc-miR-98 -1.5185 3.46E-03 5.15E-03 -2.8061 7.55E-05 1.55E-04 ssc-miR-139-3p -1.6685 2. 54E-02 2.71E-02 -2.5158 1.69E-02 1.93E-02 ssc-miR-23b -1.7157 3.70E-03 5.42E-03 -2.3687 8.39E-03 1.10E-02 ssc-miR-224 -1.8515 1.41E-02 1.67E-02 -2.5778 1.95E-02 2.19E-02 ssc-miR-23a -1.8753 3.40E-03 5.15E-03 -2.4676 1.00E-02 1.24E-02 ssc-miR-143-5p -1.9243 1.15E-04 2.60E-04 -3.9943 1.25E-09 5.88E-09 ssc-miR-139-5p -2.1198 2.01E-02 2.24E-02 -3. 2644 1.01E-02 1.24E-02 ssc-miR-222 -2.2666 2.58E-07 1.02E-06 -2.6019 2.34E-05 5.35E-05 ssc-miR-671-5p -2.3068 1.15E-02 1.47E-02 -2.7986 3.86E-02 3.92E-02 ssc-miR-9843-3p -2.3507 9.68E-04 1.87E-03 -4.7281 5.90E-05 1.31E-04 ssc-miR-145-5p -2.7059 2.08E-03 3.50E-03 -4.3459 7.18E-05 1.51E-04 ssc-miR-221-5p -2.7136 3.21E-07 1.21E-06 -1.9513 3.02E-02 3. 22E-02 ssc-miR-221-3p -2.9643 8.31E-11 5.47E-10 -2.1967 1.74E-03 2.90E-03 ssc-miR-708-5p -4.0615 2.31E-06 7.60E-06 -2.8238 6.43E-03 8.72E-03 ssc-miR-193a-3p -4.1933 2.39E-07 1.02E-06 -4.3848 2.87E-07 9.18E-07 ssc-miR-193a-5p -4.1933 2.39E-07 1.02E-06 -7.1423 2.32E-12 1.33E-11 ssc-miR-452 -4.3025 5.55E-11 3.99E-10 -2.2057 1.53E-02 1.77E-02 ssc-miR-206 -5.3001 6. 39E-09 3.37E-08 -6.2200 3.10E-09 1.38E-08 10.1371/journal. [score:1]
adj ssc-miR-21 -1.1788 1.45E-02 1.68E-02 -2.4642 2.07E-04 3.85E-04 ssc-miR-143-3p -1.1940 1.40E-02 1.67E-02 -2.7004 2.27E-05 5.34E-05 ssc-miR-145-3p -1.2289 2.47E-02 2.68E-02 -2.6837 6.34E-04 1.10E-03 ssc-miR-505 -1.3657 2.68E-02 2.82E-02 -2.1577 4.16E-02 4.16E-02 ssc-miR-98 -1.5185 3.46E-03 5.15E-03 -2.8061 7.55E-05 1.55E-04 ssc-miR-139-3p -1.6685 2. 54E-02 2.71E-02 -2.5158 1.69E-02 1.93E-02 ssc-miR-23b -1.7157 3.70E-03 5.42E-03 -2.3687 8.39E-03 1.10E-02 ssc-miR-224 -1.8515 1.41E-02 1.67E-02 -2.5778 1.95E-02 2.19E-02 ssc-miR-23a -1.8753 3.40E-03 5.15E-03 -2.4676 1.00E-02 1.24E-02 ssc-miR-143-5p -1.9243 1.15E-04 2.60E-04 -3.9943 1.25E-09 5.88E-09 ssc-miR-139-5p -2.1198 2.01E-02 2.24E-02 -3. 2644 1.01E-02 1.24E-02 ssc-miR-222 -2.2666 2.58E-07 1.02E-06 -2.6019 2.34E-05 5.35E-05 ssc-miR-671-5p -2.3068 1.15E-02 1.47E-02 -2.7986 3.86E-02 3.92E-02 ssc-miR-9843-3p -2.3507 9.68E-04 1.87E-03 -4.7281 5.90E-05 1.31E-04 ssc-miR-145-5p -2.7059 2.08E-03 3.50E-03 -4.3459 7.18E-05 1.51E-04 ssc-miR-221-5p -2.7136 3.21E-07 1.21E-06 -1.9513 3.02E-02 3. 22E-02 ssc-miR-221-3p -2.9643 8.31E-11 5.47E-10 -2.1967 1.74E-03 2.90E-03 ssc-miR-708-5p -4.0615 2.31E-06 7.60E-06 -2.8238 6.43E-03 8.72E-03 ssc-miR-193a-3p -4.1933 2.39E-07 1.02E-06 -4.3848 2.87E-07 9.18E-07 ssc-miR-193a-5p -4.1933 2.39E-07 1.02E-06 -7.1423 2.32E-12 1.33E-11 ssc-miR-452 -4.3025 5.55E-11 3.99E-10 -2.2057 1.53E-02 1.77E-02 ssc-miR-206 -5.3001 6. 39E-09 3.37E-08 -6.2200 3.10E-09 1.38E-08 10.1371/journal. [score:1]
[1 to 20 of 2 sentences]
40
[+] score: 1
Interestingly, seven methylated miRNAs were identified in our study: ssc-mir-935, ssc-mir-7144, ssc-mir-671, ssc-mir-451, ssc-mir-21, ssc-mir-1306, and ssc-mir-127. [score:1]
[1 to 20 of 1 sentences]
41
[+] score: 1
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
Obviously, high-abundant miRNAs (let-7c, let-7f, miR-148a, miR-21 and miR-24) had higher edited probability in backfat tissue. [score:1]
[1 to 20 of 1 sentences]
42
[+] score: 1
miR-21. [score:1]
[1 to 20 of 1 sentences]
43
[+] score: 1
Kim Y. J., Hwang S. J., Bae Y. C., and Jung J. S. 2009 MiR-21 regulates adipogenic differentiation through the modulation of TGF-β signaling in mesenchymal stem cells derived from human adipose tissue. [score:1]
[1 to 20 of 1 sentences]