Stem-loop ssc-mir-21

Accession

MI0002459

Description

Sus scrofa ssc-mir-21 precursor miRNA

Literature search

43 open access papers mention ssc-mir-21
(321 sentences)

Sequence

23974 reads, 6294 reads per million, 15 experiments

uguaccaccuugucgggUAGCUUAUCAGACUGAUGUUGAcuguugaaucucauggCAACAGCAGUCGAUGGGCUGUcugacauuuugguauc
.((((((...((((((((((((((((.(((((.(((((.((((.((...))))))))))).)))))))))))))))))))))...)))))).

Structure

u      ccu                A     A     A    u  a 
 guacca   ugucgggUAGCUUAUC GACUG UGUUG cugu ga  
 ||||||   |||||||||||||||| ||||| ||||| |||| || u
 uauggu   acagucUGUCGGGUAG CUGAC ACAAC ggua cu  
c      uuu                -     G     -    -  c 

Annotation confidence High

Genome context

chr12: 37340385-37340476 [+]

Mature ssc-miR-21-5p

• Accession: MIMAT0002165
• Description: Sus scrofa ssc-miR-21-5p mature miRNA
• Sequence: 18 - UAGCUUAUCAGACUGAUGUUGA - 39
• Evidence: experimental ; cloned [2,5], 454 [3], Illumina [4,6-7]

Mature ssc-miR-21-3p

• Accession: MIMAT0037322
• Description: Sus scrofa ssc-miR-21-3p mature miRNA
• Sequence: 56 - CAACAGCAGUCGAUGGGCUGU - 76
• Evidence: experimental ; Illumina [8]

References

1. PubMed ID: 15885146
   Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing
   "Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L"
   "BMC Genomics (2005) 6:70


2. PubMed ID: 19196471
   Cloning, characterization and expression analysis of porcine microRNAs
   Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R
   BMC Genomics (2009) 10:65


3. PubMed ID: 19917043
   MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
   "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
   "Anim Genet (2010) 41:159-168


4. PubMed ID: 20180025
   Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
   "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
   "Mol Biol Rep (2010) 37:3567-3574


5. PubMed ID: 18548309
   Identification and characterization of new microRNAs from pig
   "Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS"
   "Mamm Genome (2008) 19:570-580


6. PubMed ID: 21312241
   MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
   "Li G, Li Y, Li X, Ning X, Li M, Yang G"
   "J Cell Biochem (2011) 112:1318-1328


7. PubMed ID: 24499489
   Exploration of microRNAs in porcine milk exosomes
   Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
   BMC Genomics (2014) 15:100


8. PubMed ID: 25230983
   The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing
   "Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M"
   "J Appl Genet (2015) 56:239-252