sort by

27 publications mentioning hsa-mir-539

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-539. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 140
Recent study indicated that miR-539 inhibits thyroid cancer cell migration and invasion by directly targeting CARMA1 [40], induces cell cycle arrest in nasopharyngeal carcinoma by targeting cyclin -dependent kinase 4 [41]. [score:8]
Results demonstrated that both miR-539-5p and sh-KLF12 treatment suppressed protein expression of KLF12, while both pcDNA3.1-LOC100129148 and pcDNA3.1-KLF12 treatment significantly enhanced protein expression of KLF12 in CNE-1 and SUNE-1 cells (Fig. 8B), respectively. [score:7]
Next, we used luciferase reporter assays to verify whether KLF12 expression are really regulated by miR-539-5p, and results demonstrate that miR-539-5p inhibits luciferase activity in CNE-1 cells and SUNE-1 cells at the reporter plasmid with a WT KLF12 3'-UTR, but no significant inhibition was observed at the reporter plasmid with a mutant KLF12 3'-UTR (Fig. 7B). [score:7]
LOC100129148 was revealed as a direct target of miR-539-5p, and there was an interactive suppression between them. [score:6]
We also found that transfection with miR-539-5p significantly up-regulated the miR-539-5p expression in CNE-1 and SUNE-1 cells (Fig. 7E). [score:6]
These data demonstrated that miR-539-5p suppressed cell growth by directly targeting 3'-UTR of KLF12 mRNA. [score:6]
Up-regulated miR-539-5p in CNE-1 and SUNE-1 cells, which stably over-expressed LOC100129148, largely reversed the favorable effects of LOC100129148 on cell proliferation. [score:6]
To explore the function of miR-539-5p on NPC, we screen Targetscan, miRanda, PicTar to select potential predicted targets of miR-539-5p. [score:5]
Moreover, miR-539-5p decreased the protein expression but had no influence on the mRNA expression for KLF12 in CNE-1 and SUNE-1 cells (Fig. 7F-G). [score:5]
Using bioinformatics, we verified KLF12 as a direct target of miR-539-5p, and luciferase reporter assays confirmed that miR-539-5p targeted KLF12 mRNA at its 3'-UTR. [score:5]
Moreover, our results also demonstrated miR-539-5p exerted its tumor suppressive role on NPC through targeting KLF12. [score:5]
In our present study, miR-539-5p was decreased expression in NPC tissues and cell lines, and miR-539-5p inhibited growth in NPC cell lines. [score:5]
However, when treated CNE-1 and SUNE-1 cells with miR-539-5p plus pcDNA3.1-KLF12, the advantageous role of KLF12 on cell growth was reversed by miR-539-5p, and the growth -inhibitory effect of miR-539-5p was inversed by KLF12 over -expression (Fig. 8A). [score:5]
MiR-539 inhibits prostate cancer progression by directly targeting SPAG5 [39]. [score:5]
However, our results also demonstrated the mRNA of KLF12 expression had no significant correction with the expression of miR-539-5p in NPC samples (r2 =0.0144, P =0.3396) (Fig. 7C). [score:5]
LOC100129148 is a direct target of miR-539-5p. [score:4]
In addition, we also conducted trypan blue staining assay to explore the interaction between miR-539-5p and LOC100129148 on NPC cell growth, and results demonstrated miR-539-5p suppressed cell growth both in CNE-1 and SUNE-1 cells, while when co-transfection of miR-539-5p and pcDNA3.1-LOC100129148, the growth -inhibitory role of miR-539-5p was reversed, but the growth expedited role of LOC100129148 was also hampered (Fig. 6). [score:4]
These revealed that KLF12 could be a direct target of miR-539-5p in NPC (Fig. 7A). [score:4]
Our data demonstrated miR-539-5p may suppress the luciferase activity of pmirGLO-LOC100129148-WT, but it has not affected the luciferase activity of pmirGLO-LOC100129148-MUT (Fig. 5C-E), which implied that miR-539-5p directly bound to LOC100129148 at the recognized sites. [score:4]
But among all of the predicted target genes for miR-539-5p, we found that KLF12 acted as a crucial effector of miR-539-5p. [score:3]
High-expressed LOC100129148 is an oncogenic lncRNA that facilitates the oncogenesis and progression of NPC through miR-539-5p-KLF12 axis. [score:3]
In addition, our study also revealed that miR-539-5p could reverse the favorable roles of LOC100129148 on cell growth in NPC cell lines, which demonstrated LOC100129148 played its favorable role on NPC progression, at least in part, through inhibiting miR-539-5p. [score:3]
Having shown the critical role of miR-539-5p on suppressing NPC progression, we searched for the potential gene effectors involved in its function. [score:3]
The putative miR-539-5p target binding sequence in LOC100129148 (KLF12) and its mutant of the binding sites were synthesized and cloned into the downstream of the luciferase gene to generate the wild-type (wt) reporter plasmid and mutated-type (Mut) reporter plasmid. [score:3]
Furthermore, we next explored the role of LOC100129148 and miR-539-5p on the protein expression of KLF12. [score:3]
MiR-539-5p can regulate numerous of target genes. [score:3]
LOC100129148's oncogenic activity is in part through negative regulation of miR-539-5p, and then activation of KLF12 in NPC cells. [score:2]
Moreover, we also conducted dual-luciferase reporter assay to further identify whether LOC100129148 was a functional target for miR-539-5p. [score:2]
These findings suggest that the oncogenic role of LOC100129148 is mediated by miR-539-5p-KLF12 axis in NPC. [score:1]
Moreover, biotin-avidin pull-down system demonstrated LOC100129148 could pull down miR-539-5p. [score:1]
We then explored the role and mechanism of miR-539-5p on NPC cell growth. [score:1]
Results revealed that miR-539-5p was much richer in precipitate of LOC100129148 probe than that of in NC probe, and also much richer than that of in other predicted miRNAs (including miR-1252-3p, miR-6510-5p, miR-1227-5p, miR-6845-5p, miR-6762-5p, miR-4640-5p, miR-6823-5p, miR-4650-3p, and miR-6771-5p) (Fig. 5A-B). [score:1]
LOC100129148's function as an oncogene to facilitate tumor progression was partially attributed to its ability to acting as a ceRNA for miR-539-5p, and subsequent to activating of the KLF12 signaling pathway in NPC. [score:1]
These data demonstrated that LOC100129148 facilitated cell growth via functioning as a ceRNA for miR-539-5p in NPC cell lines. [score:1]
LOC100129148, sh-LOC100129148, miR-539-5p, or sh-KLF12, were purchased from GenePharma Co. [score:1]
Figure 7 (A) The 3'-UTR of KLF12 harbors one miR-539-5p cognate site. [score:1]
LOC100129148's oncogenic roles are partially via sponging miR-539-5p, and then activating KLF12. [score:1]
In our study, we investigated the effect of LOC100129148 in NPC cell lines and discovered that LOC100129148 involved in the ceRNA regulatory network and functioned as endogenous miRNA sponges to bind to miR-539-5p and regulated its function. [score:1]
Recent studies indicated miR-539-5p showed tumor suppressive role on osteosarcoma [38], prostate cancer [39], and thyroid cancer [40], while their role on NPC had not been investigated. [score:1]
The cells were washed with 1× PBS (pH7.4) and then transiently transfected with 100 nM NC or LOC100129148, sh-LOC100129148, miR-539-5p, or sh-KLF12, using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. [score:1]
LOC100129148 functions as a ceRNA of miR-539-5p in NPC. [score:1]
[1 to 20 of 41 sentences]
2
[+] score: 21
During anoxia, PHB2, an important regulator of mitochondrial fission and fusion dynamics, is strongly downregulated by the increased expression of miR-539, leading to mitochondrial fission and cardiomyocyte apoptosis. [score:7]
CARL lncRNA inhibits anoxia -induced mitochondrial fission and apoptosis in cardiomyocytes by impairing miR-539 -dependent PHB2 downregulation. [score:6]
Interestingly, this dramatic upregulation of miR-539 is the direct consequence of lncRNA CARL silencing. [score:5]
CARL acts as a sponge for miR-539, and is highly expressed in the heart as well as other tissues, indicating this mechanism of apoptosis might be relevant outside the cardiac setting. [score:3]
[1 to 20 of 4 sentences]
3
[+] score: 17
2011.03.014 21496640 4. Wang K. Long B. Zhou L. Y. Liu F. Zhou Q. Y. Liu C. Y. Fan Y. Y. Li P. F. CARL lncRNA inhibits anoxia -induced mitochondrial fission and apoptosis in cardiomyocytes by impairing miR-539 -dependent PHB2 downregulation Nat. [score:6]
A study by Wang et al. showed that a lncRNA, cardiac apoptosis-related lncRNA (CARL) can suppress mitochondrial fission and apoptosis by targeting miR-539 and Prohibitin 2 (PHB2) (Table 2 and Figure 2). [score:5]
They also showed that miR-539 is capable of binding to the PHB2’s 3′-UTR, leading to gene suppression. [score:3]
Furthermore, they showed that CARL acts as an endogenous miR-539 sponge, which ultimately leads to increased PHB2 expression with subsequently decreased mitochondrial fission and apoptosis [4]. [score:3]
[1 to 20 of 4 sentences]
4
[+] score: 16
Mitochondrial fission and apoptosis are inhibited by prohibitin 2 (PHB2), but anoxia also upregulates the expression of certain miRNAs, including miR-539 which provokes downregulation of PHB2 [98]. [score:11]
CARL functions as a sponge for miR-539: in fact, CARL overexpression reduces miR-539 expression and activity, increases PHD2 levels and attenuates anoxia -induced mitochondrial fission and apoptosis in cardiomiocytes [98]. [score:5]
[1 to 20 of 2 sentences]
5
[+] score: 13
Several miRNAs have been documented to directly inhibit TWIST1, including miR-1-1 [26], miR-33a [27, 28], miR-137 [29], miR-186 [30], miR-300 [31], miR-520d-5p [32], miR-539 [31], miR-543 [31], miR-675 [33], and miR-720 [34]. [score:4]
The expression levels of miR-520d, miR-539, miR-543, and miR-675 in breast cancers were significantly lower than paired normal tissues (Fig 7). [score:3]
The expression levels of miR-1-1, miR-33a, miR-137, miR-186, miR-520d, miR-539, miR-543, miR-675, miR-720 in the breast cancer samples and the corresponding adjacent normal tissue samples (N = 101) were downloaded from the “The Cancer Genome Atlas” (TCGA) and the Broad GDAC Firehose data portal. [score:3]
0168171.g007 Fig 7The expression levels of miR-1-1, miR-33a, miR-137, miR-186, miR-520d, miR-539, miR-543, miR-675, miR-720 in the breast cancer samples and the corresponding adjacent normal tissue samples (N = 101) were downloaded from the “The Cancer Genome Atlas” (TCGA) and the Broad GDAC Firehose data portal. [score:3]
[1 to 20 of 4 sentences]
6
[+] score: 11
Additionally, 9 miRNAs (hsa-miR-484, hsa-miR-499-5p, hsa-miR-126*, hsa-miR-491-5p, hsa-miR-1303, hsa-miR-539, hsa-miR-25*, hsa-let-7e*, and hsa-miR-194*) were upregulated in 10 diseases while not downregulated in any other, as the balloon plot (Figure  3) of all miRNAs significant in at least 8 of 19 diseases (>40%) shows. [score:11]
[1 to 20 of 1 sentences]
7
[+] score: 11
Wang K CARL lncRNA inhibits anoxia -induced mitochondrial fission and apoptosis in cardiomyocytes by impairing miR-539 -dependent PHB2 downregulationNat. [score:6]
Researchers also demonstrated that miR-539 binds PHB2 and suppresses its expression to induce mitochondrial fission and apoptosis [120]. [score:5]
[1 to 20 of 2 sentences]
8
[+] score: 10
Wang K. Long B. Zhou L. Y. Liu F. Zhou Q. Y. Liu C. Y. Fan Y. Y. Li P. F. CARL lncRNA inhibits anoxia -induced mitochondrial fission and apoptosis in cardiomyocytes by impairing miR-539 -dependent PHB2 downregulation Nat. [score:6]
In another study, it was reported that cardiac apoptosis-related lncRNA (CARL) could act as an endogenous miR-539 sponge to regulate PHB2 expression, mitochondrial fission and apoptosis. [score:4]
[1 to 20 of 2 sentences]
9
[+] score: 9
The miRNAs that exhibited at least a 2-fold change in expression in the hADSCs before and after the induction of chondrogenic differentiation are listed in Table I, and these include 12 upregulated miRNAs (miR-196a, miR-143, miR-383, miR-193b, let-7i, miR-26a, miR-539, miR-199a-3p, miR-337-5p, miR-146a-5p, miR-646, and miR-381) and 8 downregulated miRNAs (miR-490-5p, miR-1307, miR-125b, miR-96-3p, miR-302-3p, miR-23a-3p, miR-590, and miR-510). [score:9]
[1 to 20 of 1 sentences]
10
[+] score: 9
Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-27a, hsa-mir-27b, hsa-mir-26a-2, hsa-mir-361
Cardiac apoptosis-related lncRNA (CARL) inhibits cell apoptosis by impairing miR-539 -dependent PHB2 downregulation [67]. [score:6]
In cardiomyocytes, miR-539 targets PHB2 and induces mitochondrial fission and apoptosis under anoxia injury. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 7
Seven over-expressed microRNAs that were altered at least four fold, including hsa-miR-671-5p, hsa-miR-542-5p, hsa-miR-542-3p, hsa-miR-1185, hsa-miR-539, hsa-miR-148a and hsa-miR-301a, (Figure 4A) and six over-expressed microRNAs that were highly expressed (normalized data ≥6), including hsa-miR-1290, hsa-miR-136, hsa-miR-424, hsa-miR-30a, hsa-miR-148a and hsa-miR-1246 (Figure 4B), were selected for further qRT-PCR analyses. [score:7]
[1 to 20 of 1 sentences]
12
[+] score: 6
While two of them, miR-539 and miR-300 have no target site in the murine Twist1 3′UTR, a third, miR-543 did not show a significant effect in our screen. [score:3]
While this work was under revision, miR-214 [36], miR-300, miR-539 and miR-543 [37] have also been reported to target the TWIST1 3′UTR. [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 6
is expressed as the canonical miRNA by hsa-mir-539. [score:3]
is expressed as a canonical miRNA by mmu-mir-539 and by contrast an isomiR of mmu-mir-539 (AUCAUACAA…. ) [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 5
Considering a probe signal of over 100 as abundance, eleven of the 28 miRNAs (miR-342-3p, miR-342-5p, miR-376c-3p, miR-301b-3p, let-7f-5p, miR-539-3p, miR-491-3p, miR-10a-5p, miR-98-5p, miR-652-5p, and miR-34a-5p) were shown to have targets that are tightly related to AD and could easily be detected. [score:3]
For further analysis, we chose 11 evidently different miRNAs that were conserved between both human and mouse: miR-342-3p, miR-342-5p, miR-376c-3p, miR-301b-3p, let-7f-5p, miR-539-3p, miR-491-3p, miR-10a-5p, miR-98-5p, miR-652-5p, and miR-34a-5p. [score:1]
To our knowledge, this is the first study to identify the potential effects of miR-342-3p, miR-491-3p, miR-539-3p, miR-376c-3p, miR-10a-5p, and miR-652-5p in the progression of AD. [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 5
Significantly deregulated miRNAs were miR-3163 (fold change 2.0, p = 0.05), miR-539 (fold change 0.5, p = 0.001), miR-1305 (fold change 0.5, p = 0.05), miR-1260 (fold change 0.5, p = 0.03) and let-7a (fold change 0.3, p = 0.02, in all cases unadjusted p-values; 30 most deregulated probes). [score:3]
Others have already been examined on a functional level such as miR-539 which is among the factors sensing biotin and regulating holocarboxylase synthetase. [score:2]
[1 to 20 of 2 sentences]
16
[+] score: 5
For the efficient target BICD1, miR-539 repressed it only in normal stage, and it had contribution to the ‘intracellular mRNA localization’ process only in CIN I stage. [score:3]
Our finding suggests that elicited by miR-539’s differential regulation on BICD1, the length of telomeres may be prolonged in CIN I stage, thus promoting cell immortalization transformation. [score:2]
[1 to 20 of 2 sentences]
17
[+] score: 4
In particular, several miRNAs mapping to 14q32, including miR-376c, miR-495 and miR-539, were identified as up-regulated in MB specimens defined by a neuronal differentiation signature (sub-type C as per [8]) [33]. [score:4]
[1 to 20 of 1 sentences]
18
[+] score: 3
Five of the miRNAs (hsa-miR-154-3p, hsa-miR-4999-5p, hsa-miR-382-3p, hsa-miR-487a-5p, hsa-miR-539-5p) were expressed only in adjacent normal tissues, at the cut-off criteria of 5 read counts in 50% of the samples. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
Besides, researchers also discovered that the distinct set of five miRNAs (miR-150, miR-550, miR-518b, miR-124a and miR-539) was differentially expressed in gastritis in contrast with MALT lymphoma [66]. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
In regards to age, we discovered that the expression levels of 14 miRNAs (miR-654-5p, miR-493*, miR-410, miR-376a*, miR-758, miR-381, miR-543, miR-539, miR-487b, miR-337-5p, miR-136*, miR-154*, miR-330-3p, and miR-421) were significantly higher in HCC up to 66 years old than in HCC over 67 years old. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 2
More recent studies have demonstrated roles for miR-539 and miR-381 in mediating a novel regulatory pathway between KIT and microphthalmia -associated transcription factor in normal and malignant mast cells [17]. [score:2]
[1 to 20 of 1 sentences]
22
[+] score: 2
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUAInterestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUA Interestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 2
It is worth noting that these 10 miRNAs together (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-448, miR-93, miR-106b, miR-217, miR-539) could potentially be regulating 41% of the mRNAs significantly altered in PDAC. [score:2]
[1 to 20 of 1 sentences]
24
[+] score: 1
Interestingly, the levels of some of these miRNA seem to change in response to the infiltration of lymphocytes or the presence of H. pylori while only a few (hsa-miR-150, hsa-miR-550, hsa-miR-124a, hsa-miR-518b, and hsa-miR-539) were associated with lymphoma and presented a steady increase from gastritis to MALT (Thorns et al., 2012). [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
miRNA △△Ct2 [−] [△△Ct] hsa-miR-1290 −10.05 1063.66 hsa-miR-1275 −9.36 655.36 hsa-miR-1260 −9.25 609.09 hsa-miR-574-3p −4.49 22.48 hsa-miR-454 −4.45 21.93 hsa-miR-148a −4.38 20.85 hsa-miR-539 −4.36 20.57 hsa-miR-223 −4.27 19.29 hsa-miR-142-5p −4.27 19.26 hsa-miR-485-3p −4.21 18.56 hsa-miR-548c-5p −4.13 17.56 hsa-miR-17 −4.12 17.41 hsa-miR-484 −4.10 17.17 hsa-miR-652 −4.09 17.01 hsa-miR-660 −4.07 16.78 hsa-miR-20b −4.06 16. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
73(12) hsa-miR-377* 14q32.2 −2.72 hsa-miR-7 15q25.3/19p13.3/9q21.32 −2.72(12, 14) hsa-miR-124 20p23.1/8q12.3/8p23.1 −2.71(12, 14, 29, 48, 49) hsa-miR-323-5p 14q32.31 −2.69(12) hsa-miR-873 9p21.1 −2.65 hsa-miR-129* 11p11.2/7q32.1 −2.63 hsa-miR-338-5p 17q25.3 −2.61(14) hsa-miR-409-5p 14q32.2 −2.61 hsa-miR-874 5q31.2 −2.46 hsa-miR-495 14q32.2 −2.46(52) hsa-miR-885-5p 3p25.3 −2.45 hsa-miR-376c 14q32.2 −2.43(52) hsa-miR-299-5p 14q32.2 −2.41 hsa-miR-539 14q32. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
57/30.85/5.71 Yes 20 64/58 0 (0) hsa-mir-130a-3p 5/5/0 0.76/0.97/0 Yes 56 724/172 27 (3.73) hsa-mir-151a-3p 6/6/3 2.87/1.26/0.48 Yes 49 76/77 3 (3.95) hsa-let-7d-3p 6/4/0 0.70/0.31/0 Yes 66 9/1 0 (0) hsa-mir-27b-3p* 5/0/0 0.25/0/0 Yes 64 921/8 2 (0.22) hsa-mir-301b-3p* 5/2/1 1.24/−/− No 63 NA NA hsa-mir-340-3p* 4/0/0 1.19/0/0 No 70 NA NA hsa-mir-377-3p* 4/3/0 8.10/4.6/0 No 54 NA NA hsa-mir-539-5p* 6/6/0 2.23/1.62/0 No 18 NA NA hsa-mir-889-3p* 5/5/0 0.62/0.41/0 No 62 NA NA hsa-mir-99a-5p 6/6/4 3.40/1.44/0.30 No 13 NA NA 22 miRNAs were found to be significantly hypoedited in GBM (wilcoxon-two-tailed, p < 0.05). [score:1]
[1 to 20 of 1 sentences]