WARNING: This summary was generated by AI. MIR539 is a microRNA (miRNA) that is part of a cluster within the miR655 miRNA cluster, which includes a total of 20 miRNAs [PMC7465874]. This miRNA has been identified as part of an expression signature that includes five miRNAs, where MIR539 is upregulated in colorectal cancer (CC) cases that subsequently relapse [PMC5110606]. MIR539 has been shown to play a role in increasing the sensitivity of non-small cell lung cancer (NSCLC) cells to cisplatin by targeting DCLK1, which is associated with chemoresistance [PMC7904745]. In cardiac myocytes, an increase in MIR539 production leads to mitochondrial fission and apoptosis, and it also acts as a sponge for cardiac apoptosis-related lncRNA to regulate PHB2 expression [PMC7123062]. In the context of myocardial infarction in rat models, MIR539 expression increases and inhibits MEK expression, affecting cardiomyocyte proliferation and apoptosis [PMC7527411]. Furthermore, it has been implicated in reversing cisplatin resistance in NSCLC cells [PMC7321820], and its gene location within the DLK1-DIO3 imprinting region suggests its involvement in leukemia pathogenesis [PMC4633733]. Additionally, MIR539's hypomethylation suggests its contribution to erythropoiesis progression from hematopoietic stem cells (HSC) to megakaryocyte-erythroid progenitors (MEP) [PMC4633733], while lncRNA TP73AS1 down-regulates MIR539 promoting MMP8 expression and TGF-β1 signaling for macrophage polarization and hepatocellular carcinoma progression [PMC8712501].
A G - - uuu
auacuugaGGAGAAAUU UCCUUG UGUG Uucg c a
||||||||||||||||| |||||| |||| |||| | u
uaugaguuUUUCUUUAA AGGAAC AUAC Aagu g u
C - U a uau
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003163 |
| Description | Homo sapiens hsa-miR-539-5p mature miRNA |
| Sequence | 9 - GGAGAAAUUAUCCUUGGUGUGU - 30 |
| Evidence |
experimental
cloned [1,3], miRAP-cloned [2] |
| Accession | MIMAT0022705 |
| Description | Homo sapiens hsa-miR-539-3p mature miRNA |
| Sequence | 49 - AUCAUACAAGGACAAUUUCUUU - 70 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|