miRBase entry: hsa-mir-539

Stem-loop hsa-mir-539


Accession
MI0003514
Symbol
HGNC: MIR539
Description
Homo sapiens hsa-mir-539 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR539 is a microRNA (miRNA) that is part of a cluster within the miR655 miRNA cluster, which includes a total of 20 miRNAs [PMC7465874]. This miRNA has been identified as part of an expression signature that includes five miRNAs, where MIR539 is upregulated in colorectal cancer (CC) cases that subsequently relapse [PMC5110606]. MIR539 has been shown to play a role in increasing the sensitivity of non-small cell lung cancer (NSCLC) cells to cisplatin by targeting DCLK1, which is associated with chemoresistance [PMC7904745]. In cardiac myocytes, an increase in MIR539 production leads to mitochondrial fission and apoptosis, and it also acts as a sponge for cardiac apoptosis-related lncRNA to regulate PHB2 expression [PMC7123062]. In the context of myocardial infarction in rat models, MIR539 expression increases and inhibits MEK expression, affecting cardiomyocyte proliferation and apoptosis [PMC7527411]. Furthermore, it has been implicated in reversing cisplatin resistance in NSCLC cells [PMC7321820], and its gene location within the DLK1-DIO3 imprinting region suggests its involvement in leukemia pathogenesis [PMC4633733]. Additionally, MIR539's hypomethylation suggests its contribution to erythropoiesis progression from hematopoietic stem cells (HSC) to megakaryocyte-erythroid progenitors (MEP) [PMC4633733], while lncRNA TP73AS1 down-regulates MIR539 promoting MMP8 expression and TGF-β1 signaling for macrophage polarization and hepatocellular carcinoma progression [PMC8712501].

Literature search
27 open access papers mention hsa-mir-539
(87 sentences)

Sequence

4263 reads, 14 reads per million, 70 experiments
auacuugaGGAGAAAUUAUCCUUGGUGUGUucgcuuuauuuaugaugaAUCAUACAAGGACAAUUUCUUUuugaguau
(((((((((((((((((.((((((.(((((((((.........).)))).)))))))))).)))))))))))))))))

Structure
                 A      G    -    - uuu 
auacuugaGGAGAAAUU UCCUUG UGUG Uucg c   a
||||||||||||||||| |||||| |||| |||| |   u
uaugaguuUUUCUUUAA AGGAAC AUAC Aagu g   u
                 C      -    U    a uau 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101047321-101047398 [+]
Clustered miRNAs
19 other miRNAs are < 10 kb from hsa-mir-539
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-539 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-539-5p

Accession MIMAT0003163
Description Homo sapiens hsa-miR-539-5p mature miRNA
Sequence 9 - GGAGAAAUUAUCCUUGGUGUGU - 30
Evidence experimental
cloned [1,3], miRAP-cloned [2]

Mature hsa-miR-539-3p

Accession MIMAT0022705
Description Homo sapiens hsa-miR-539-3p mature miRNA
Sequence 49 - AUCAUACAAGGACAAUUUCUUU - 70
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  3. PubMed ID: 16973894
    Mouse microRNA profiles determined with a new and sensitive cloning method
    "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
    "Nucleic Acids Res (2006) 34:e115