sort by

13 publications mentioning hsa-mir-655

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-655. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 429
We first treated MCF7 and T47D cells with PGE2 or PGE1OH, followed by one of two PI3K inhibitors LY and WT and ERK inhibitor U0126 for 12 h and 24 h. Following miRNA extraction and qPCR analysis, we observed that treatment with both PI3K inhibitors significantly blocked miR655 up-regulation in a time dependant manner in both cell lines. [score:10]
To test the role of NF-κB in miR655 regulation, we treated MCF7 and T47D cells with BAY-11-7082 (10 μM), a NF-κB inhibitor along with PGE2 and PGE1OH for 24 h. BAY-11-7082 significantly blocked PGE2 and PGE1OH stimulated miR655 expression in both MCF7 and T47D cells (Fig.   6G and H respectively), indicating NF-κB is an intermediary in miR655 upregulation by EP4. [score:9]
While low COX-2 expressing MCF7 and T47D human breast cancer cells showed significant increases in miR655 expression with PGE2 and PGE1OH treatments (Fig.   6D), above treatments could not increase miR655 expression in MDA-MB-231 cells, which already had high expression of COX-2 and miR655. [score:9]
Contrary to our findings and data presented later in this article, miR655 was reported as an EMT suppressor in pancreatic cell lines [43] by targeting Zeb-1 and an inhibitor of cellular invasion in squamous cell carcinoma cell lines by targeting pituitary tumor-transforming gene-1 (PTTG1) [44]. [score:9]
Genes targeted by miR655 are listed in Supplementary Table  1. We tested numerous COX-2 disparate human breast cancer cell lines varying in gene expression profile [46] to explore whether miR655 expression levels were broadly correlated with COX-2 expression. [score:9]
Treatment with COX-2 inhibitor or EP4 receptor antagonist (EP4A) downregulates miR655 expression in COX-2 high cells. [score:8]
It was also reported that miR655 targets and down regulates ZEB1, a negative regulator of E-Cad, resulting in upregulation of E-Cad in miR655 cells [43]. [score:8]
In esophageal squamous cell carcinoma cell lines, miR655 over -expression was reported to suppress cellular invasion by targeting pituitary tumor-transforming gene-1 [44]. [score:7]
We showed that ectopic over -expression of miR655 in human breast cancer cell lines markedly increased their ability to form spheroids in vitro, induced NOTCH gene expression, and increased the expression of SLC markers ALDH, OCT3/4 and lung colony forming ability in vivo. [score:7]
We identified two miRNAs, miR526b and miR655 which were up-regulated in MCF7-COX-2 cells, along with several genes which were up- or down-regulated in the same cell line [23]. [score:7]
Our results unequivocally demonstrate that miR655 is a COX-2 -induced oncogenic miRNA linked with SLC-phenotype, up-regulated by EP4 -mediated signaling pathway PI3K/AkT/NFκB and SLC pathway NOTCH/WNT upregulation and resulting in TGFβ resistance for Smad3 activation. [score:7]
Our contention was supported by several findings: (1) MCF-7-miR665 cells exhibited 8–10 fold upregulation of TGFβ-R2 relative to MCF-7 cells (Fig.   7A), rather than miR655 mediated downregulation of TGFβ-R2 as noted by Harazano et al. [43]. [score:7]
As shown in Fig.   6A, expression of COX-2 protein in MCF7-miR655 cells was found to be as high as in ectopic COX-2 over expressing MCF7-COX-2 cells which also expressed high EP4 [23]. [score:7]
In aggressive COX-2 expressing breast cancer cell lines, treatments with EP4A and COX-2 inhibitor could reduce miR655 expression. [score:7]
[23]), in which we identified miR655; suggesting a possible mechanism of PTEN down-regulation leading to up-regulation of PI3K/AkT signaling via the EP4 receptor. [score:7]
Comparison of miR655 expression after stimulation with PGE2 and PGE1OH followed by treatment with two PI3K inhibitors, Wortmannin (WT), LY-240-002 (LY) both at (10 µM) and ERK inhibitor U0126 (10 µM) in (E) MCF7 and in (F) T47D cells. [score:7]
Surprisingly, we observed that miR655 expression leads to COX-2 up-regulation. [score:6]
Here we report the functions of miR655 as another oncogenic and SLC-promoting miRNA, which was significantly upregulated in COX-2 -high human breast cancer cell lines, during natural as well as ectopic COX-2 over -expression. [score:6]
Figure 4Effects of miR655 knock-down and NOCTH/WNT inhibitors on SLC phenotypes of miR655 overexpressing cells: in MCF7-COX-2-655KD and SKBR3-COX-2-655KD cells (achieved with transient miR655 knock-down), compared to respective Mock controls. [score:6]
To examine the potential role of the EP4 receptor in COX-2 induced miR655 expression in vitro, MCF7-COX-2 and SKBR3-COX-2 cells were treated with an EP4A (ONO-AE3–208), COX-2 inhibitors (NS398), or vehicles for 24 h before miRNA extraction. [score:5]
ERK inhibitor could also abrogate miR655 expression (Fig.   6E,F). [score:5]
These results suggest that miR655 expression in COX-2 over -expressing cells is dependent on both COX-2 and EP4 activity. [score:5]
In surprising contrast to our findings, miR655 was reported as an EMT-suppressive miRNA targeting ZEB1 and TGFBR2 in pancreatic cancer cell lines [43]. [score:5]
A weak but positive correlation between miRNA655 and COX-2, EP4 and SLC marker ALDH1A expression in tumor tissues were noted; their expression was also higher than non-cancerous tissues (Fig.   8D–F). [score:5]
A comparison of miR655 expresssion in 105 primary breast cancer and 20 adjacent non-cancerous tissues revealed significantly higher expression in cancerous tissues (Fig.   8A). [score:5]
Morpholino -mediated knock-down of miR655 in high COX-2 expressing MCF7-COX-2 and SKBR3-COX-2 cell lines was confirmed using Taqman miRNA expression assays [37]. [score:5]
Furthermore, miR655 was reported to suppress EMT by targeting Prrx1 in triple -negative breast cancer (TNBC) [45]. [score:5]
Conversely, following miR655 knockdown in MC7-COX-2 and SKBR3-COX-2 cells, COX-2 protein was significantly downregulated (Supplementary Figure  2). [score:5]
Furthermore, both NOTCH and WNT inhibitors significantly reduced spheroid formation by miR655 overexpressing cells. [score:5]
In the present study, we show that both COX-2 and EP4 activities directly upregulated another oncogenic and SLC-stimulating miRNA miR655 in human breast cancer. [score:5]
Wang Y Mir-655 up regulation suppresses cell invasion by targeting pituitary tumor-transforming gene 1 in esophageal squamous cell carcinomaJ. [score:5]
There is a positive correlation between certain genes and miRNA expression, such as between (D) miR655 and COX2, (E) miR655 and EP4 and (F) stem cell marker ALDH and mir655 expression. [score:5]
Lv ZD miR-655 suppresses epithelial-to-mesenchymal transition by targeting Prrx1in triple -negative breast cancerJ. [score:5]
These findings reveal an association of miR655 expression with disease progression, and its potentials as a biomarker in breast cancer patients. [score:5]
We show that COX-2 overexpression in breast cancer cell lines induced the expression of two oncogenic and SLC-promoting miRNAs, miR526b [37] and miR655 (present study). [score:5]
Figure 2MiR655 over -expression promotes EMT in MCF7 cells and miR655 knock-down in MCF7-COX2 cells reverts to MET. [score:4]
To test intermediary role of NF-κB in EP4 mediated regulation of miR655 in (G) MCF7 and (H) T47D cells, the cells were treated with NF-κB inhibitor BAY-11-7082 (10 µM) or vehicle (DMSO) along with PGE2 and PGE1OH. [score:4]
So, we tested whether NF-κB played an intermediary role in COX2/EP4 mediated miR655 upregulation. [score:4]
To test the distinctive role of EP4 in regulating miRNA stimulation, we examined whether blocking the PI3K/AkT and ERK pathways, known to be stimulated by EP4 12– 14, but not EP2 [12], could mitigate the stimulatory effects of PGE2 and PGE1OH on miR655 expression. [score:4]
We have further established that the PGE2/EP4 mediated signaling via PI3K/AkT and ERK pathways, which promotes cell survival and migration, is responsible for miR655 upregulation. [score:4]
Data presented in Supplementary Figure  1A reveal that this was indeed the case, suggesting that, amongst many genes, COX-2 may play an important role in miR655 up-regulation. [score:4]
Identification of miR655 upregulation in MCF7-COX-2 cells. [score:4]
MiR655 expression in (B) MCF7-COX-2 and (C) SKBR3-COX-2 cells treated with COX-2 inhibitor (NS-398, 10 µM) and EP4 antagonist (ONO-AE3-208, 10 µM). [score:4]
MiR655 expression was elevated in primary breast cancer tissues, high expression being associated with reduced survival. [score:4]
MiR655 over expression increased COX-2 protein expression (Fig.   6A). [score:4]
We also conducted post-study genome data mining to search miR655 target genes with MIRBASE and MIRDB softwares to identify another NF-κB negative regulator RAB7L1 (RAS oncogene family-like 1) gene. [score:4]
assay showing down regulation of E-Cadherin (C) and upregulation of TWIST1 (D) in MCF7-miR655 cells. [score:4]
We suggest that miR655 mediated upregulation of COX-2 is one mechanism explaining SLC stimulation by this miRNA. [score:4]
We also observed an increase in NOTCH (Fig.   3D) and WNT genes (c-MYC, CCDN1, AXIN2), however AXIN1 was downregulated in MCF7-miR655 cells (Fig.   3E). [score:4]
These results gave us the first clue of a positive association of SLC phenotype with miR655 upregulation in human breast cancer cells. [score:4]
Figure 1MiR655 over -expression promotes cellular migration, invasion and proliferation, and knock-down of miR655 in COX-2 high cells reduce aggressive phenotypes. [score:4]
To further link NOTCH and WNT with SLC regulation, we treated MCF7-miR655 cells with NOTCH and WNT inhibitors. [score:4]
Expression of miR655 was observed in all stages of tumor except stage 0 (Fig.   8B). [score:3]
EP receptor activation stimulates miR655 expression. [score:3]
Positive association of miR655 with COX-2 expression in multiple COX-2 disparate human breast cancer cell lines. [score:3]
MCF7 and SKBR3 cell lines stably transfected with the pCMV-MIR-Mock (empty) vector were referred to as MCF7-Mock and SKBR3-Mock respectively, and transfected with the pCMV-MIR miR-655 expression plasmid were referred to as MCF7-miR655 and SKBR3-miR655. [score:3]
To examine the clinical relevance of miR655 expression in breast cancer, we obtained frozen female human breast tumor (n = 105) and control (n = 20) tissues (adjacent non-tumor tissue from unrelated patients) from the Ontario Tumor Bank, maintained by the Institute for Cancer Research (OICR). [score:3]
MiR655 downregulated cell lines were named as MCF7-COX-2-655KD, SKBR3-COX-2-655KD, and their respective empty vector controls named as MCF7-COX-2-Mock and SKBR3-COX-2-Mock. [score:3]
These results with an in vivo mo del of experimental metastasis revealed that over -expression of miR655 in human breast cancer cells promoted their lung colony forming ability, an oncogenic phenotype. [score:3]
Cancer genome atlas data mining revealed that high miR655 expression (80th percentile) in breast cancers is associated with decreased overall survival (Fig.   8G). [score:3]
Stable over -expression of miR655 in MCF7 and SKBR3 was achieved using nucelofection [37] and named as MCF7-miR655 and SKBR3-miR655. [score:3]
MCF7 and SKBR3 cells were transfected with 2 µg of either pCMV-MIR Mock vector (control) or pCMV-MIR miR655 expression plasmids (OriGene, MD) using the Amaxa Cell Line Nucleofector Kit V (Lonza, MO), according to the manufacturer’s protocol. [score:3]
Over -expression of miR655 was confirmed in both cell lines using real-time polymerase chain reaction (RT-PCR) in which RNU44 and RNU48 serving as control miRs (Supplementary Figure  1B). [score:3]
Comparison of (A) migration, (B) invasion and (C) proliferation of parental, empty vector (Mock) transfected, and miR655 over -expressing MCF7 and SKBR3 cells. [score:3]
We treated a panel of breast (both epithelial and cancer) cell lines with PGE2 and PGE1OH for 24 h and quantified miR655 expression. [score:3]
Figure 5Expression of miR655 supports lung colony formation and multi-organ metastasis. [score:3]
High expression of miR655 was detectable in higher-grade primary human breast cancer tissues and negatively correlated with overall patient survival. [score:3]
We investigated whether discrepancies between our results of miR655 as an EMT promoter in miR655 over -expressing breast cancer cells and other reports of miR655 being an EMT suppressor in cancer cell lines exhibiting TGF-β -induced EMT [43] could be explained by subversion to COX2/EP4 pathway. [score:3]
Validation of stable miR655 over -expression in MCF7 and SKBR3 cells. [score:3]
Fold change in E-Cadherin, N-Cadherin (CDH2), ZEB1, Vimentin and SNAIL mRNA (A) and protein expression (except ZEB1 and SNAIL) (B) in MCF7-miR655 cells indicating EMT. [score:3]
Correlation of COX-2, EP4 and miR655 expression. [score:3]
For example, miR655 was shown to suppress TGF-β -induced EMT in pancreatic cancer cells [43] which depended on Smad 2/3 activation, whereas miR655 mediated promotion of EMT observed in the present study is due to COX-2/EP4 activation. [score:3]
Both reagents significantly reduced miR655 expression in MCF7-miR655 cells (Fig.   4D), abrogated spheroid formation, as indicated by reduced spheroid size (Fig.   4E) and numbers (Fig.   4F,G) in a dose dependent manner. [score:3]
Very significant correlation exists between (C) miR526b and miR655 expression. [score:3]
We selected MCF7 (non-metastatic, low COX-2, HER-2 negative, low miR655), and SKBR3 (poorly metastatic, COX-2 negative, HER-2 positive, low miR655) cell lines for miRNA over -expression. [score:3]
In spheroids miR655 expression increased in all cell lines including COX-2 -high and miRNA -high cells, however, this was more pronounced in COX-2-low and miRNA low cell lines (Fig.   3A). [score:3]
A very strong positive correlation between miR526b and miR655 expression was also observed in tumor tissues (Fig.   8C). [score:3]
These results reveal the role of PI3K/AkT and ERK signalling, presumably mediated by EP4 activation, in stimulating miR655 expression in MCF7 human breast cancer cells. [score:3]
Kaplan-Meier curves for overall survival associated with miR655 expression were conducted in 639 primary breast carcinomas. [score:3]
Compared to controls, both miR655 over -expressing cell lines displayed a significant increase in the number of spheroids (Fig.   3B,C), as well as spheroid sizes (given by average perimeter, Fig.   3C). [score:2]
MiR655 over expression in MCF7 cells induced EMT, evidenced by decrease in E-Cad and increase in Vimentin, TWIST, ZEB1, SNAIL and N-Cadherin; mRNA data represented in Fig.   2A and protein in Fig.   2B,C. [score:2]
Conversely, knockdown of miR655 in MCF7-COX-2 cells resulted in a significant increase in the E-Cad and decrease in Vimentin (Fig.   2E–G), indicating mesenchymal to epithelial transition (MET) or a reversal of their EMT phenotype. [score:2]
This finding prompted us to investigate the regulation of miR655 by COX-2 or EP4, using inhibitors and activators of COX-2 and EP4. [score:2]
Figure 6COX-2 and EP4 mediated regulation of miR655. [score:2]
These authors reported that miR655 expression was significantly lower in TNBC compared to control tissues, in sharp contradiction to our findings noted above. [score:2]
MiR655 overexpression promotes cellular migration, invasion and proliferation. [score:2]
Both treatments caused a significant decrease in miR655 expression compared to vehicle treated cells (Fig.   6B,C). [score:2]
We used Qiagen RNA and miRNA extraction kits to extract mRNA/miRNA from tissue followed by cDNA synthesis and Taqman miRNA and gene expression assays (miR655, COX-2, EP4 and ALDH1A) as described before 23, 37. [score:2]
MiR655 expression in human breast tissues and plasmas and correlation with overall patient survival. [score:2]
Role of NF-κB in miR655 regulation. [score:2]
MiR655 was significantly downregulated in both cell lines at two different morpholino concentrations in a dose dependent way (Supplementary Fig.   1C), compared to mock transfected cells. [score:2]
Our results further suggest a positive feedback-regulatory loop for SLC promotion/sustenance via COX-2/EP4/NF-κB/miR655/COX-2 axes. [score:2]
In the present study, we provide multiple evidences for miR655 being directly associated with SLC stimulation. [score:2]
MiR655 over -expression makes cells refractory to TGF-β mediated stimulation of Smad3 phosphorylation. [score:2]
Knock down of miR655 in MCF7-COX2 cells up regulates E-Cadherin and down regulates Vimentin mRNA (E) and protein, measured with Western Blots (F), quantification presented in (G). [score:2]
Knock-down of miR655 in both MCF7-COX-2 and SKBR3-COX-2 cells resulted in significantly reduced abilities for migration (Fig.   1D), invasion (Fig.   1E) and proliferation (Fig.   1F). [score:2]
Conversely, knock-down of miR655 in MCF7-COX-2 and SKBR3-COX-2 cells resulted in a significant reduction in the spheroid formation efficiency (Fig.   4A,B) and spheroid perimeter (Fig.   4C). [score:2]
These results suggest that miR655 directly promoted SLC phenotype in human breast cancer cell lines. [score:2]
Together, these results demonstrate an important role for miR655 in promoting an aggressive phenotype in human breast cancer by inducing EMT. [score:1]
Finally, our results suggest COX-2/EP4/NF-κB/miR655/COX-2 axis mediates SLC perpetuation. [score:1]
MiR655 knock-down in MCF7-COX-2 and SKBR3-COX-2 cells reduces cellular migration, invasion and proliferation. [score:1]
We believe that miR655 is no exception to the complexity of determinants of miRNA actions listed above. [score:1]
We also estimated the frequency of well-recognized breast cancer SLC marker ALDH [49] and a pluripotency marker OCT3/4 [50] in MCF7 and MCF7-miR655 cell lines with immunostaining. [score:1]
We interpreted these results representing a positive feedback loop for COX-2/EP4/NF-κB/miR655/COX-2 -mediated SLC perpetuation (schema presented in Fig.   7E). [score:1]
We show here that parental or Mock -transfected MCF7 cells responded to exogenous TGFβ1 by assumption of mesenchymal morphology and increased Smad3 phosphorylation, whereas MCF7-miR655 cells exhibited EMT phenotype and were refractory to TGFβ1 -mediated Smad3 phosphorylation. [score:1]
Both miR526b and miR655 are members of same miRNA cluster. [score:1]
Epithelial to Masenchymal Transition (EMT) in miR655 manipulated cells. [score:1]
Link between miR655 and stem-like cell (SLC) phenotype. [score:1]
We screened other organs of mice for micro and macro metastasis, showing miR655 cells metastasized to the liver and the spleen (Fig.   5E). [score:1]
Here we present a detailed study of the functions of miR655 in human breast cancer employing miRNA-manipulated breast cancer cell lines tested in vitro and in vivo for changes in a variety of functions related to their oncogenic phenotypes. [score:1]
MCF7 and MCF7-miR655 cells were grown in regular growth medium in 96 well plates until confluent. [score:1]
Thus the discordance of miR655 mediated EMT responses shown in the present study from earlier reports 43, 45 can be explained in the context of COX-2/EP4 mediated signaling. [score:1]
In our preliminary findings conducted in vitro with human breast cancer cell lines [42], miR655 was shown to have oncogenic and SLC-inducing properties. [score:1]
In conclusion, our results taken together established that miR655 is an oncogenic miRNA in human breast cancer, promoting EMT, cellular migration, invasion, proliferation, SLC stimulation and metastasis in vivo. [score:1]
Comparison of lung colony formation by MCF7-miR655 and SKBR3-miR655 cells and respective control cells in GUSB null mice, n = 5 mice per cell line. [score:1]
Although miR655 has no binding site for E-Cadherin (E-Cad) mRNA, it binds to the 3′UTR of CTNNB1 catenin (cadherin -associated), beta 1. The protein encoded by this gene is part of a complex of proteins that constitute adherens junction in epithelial cells. [score:1]
In miR655 overexpressing cells we measured the levels of COX-2 protein. [score:1]
[1 to 20 of 117 sentences]
2
[+] score: 338
Neha et al. reported that inhibiting ADAM10 expression subsequently diminishes β-catenin intracellular signaling and repress TCF/LEF target gene expression [27], which is similar to our founding that miR-655-3p could reduce E-cadherin protein level and inhibit β-catenin pathway by target regulating ADAM10 in HCC. [score:14]
b Relative miR-655-3p expression levels in HCC tissues and adjacent normal regions; c QRT-PCR analysis of miR-655-3p expression in HCC cells (Bel-7402, MHCC-97 L, MHCC-97H, HepG2, SK-Hep1, HCCLM3, Huh7) and normal hepatocytes (LO-2) In order to explore the potential clinical significance of miR-655-3p in HCC patients, the cases were divided into miR-655-3p low -expression group (n = 51) and mid/high -expression group (n = 33), according to the relative ratio of miR-655-3p expression in tumor/adjacent non-tumor < or > 0.5. [score:11]
Then, the underlying molecular mechanism of miR-655-3p inhibiting HCC progress was detected, and the results showed upregulating miR-655-3p expression increased E-cadherin protein but decreased the nucleus β-catenin, cyclinD1 and c-myc expression. [score:10]
Moreover, ADAM10 was identified as a direct target of miR-655-3p, and miR-655-3p down-regulated E-cadherin protein level and inhibits β-catenin pathway by mediating ADAM10. [score:9]
MiR-655-3p expression is reduced in several cancers and overexpression of miR-655 act as a tumor suppressor by targeting pituitary tumor-transforming gene-1(PTTG1) in esophageal squamous cell carcinoma metastasis [14]. [score:9]
Yang et al. showed miR-655 expression was decreased in esophageal squamous cell carcinoma (ESCC) and overexpression of miR-655 inhibited ESCC cell invasiveness by targeting PTTG1 [14]. [score:9]
As predicted, overexpression of miR-655-3p in HepG2 and HCCLM3 cells decreased the expression of ADAM10 at both the mRNA and protein levels, whereas miR-655-3p inhibitor increased its expression in Huh7 cells (Fig.   5a, b, d). [score:9]
Further study showed that miR-655-3p could down-regulate E-cadherin and inhibit β -catenin pathway by targeting A Disintegrin and Metalloprotease Domain 10(ADAM10). [score:8]
In conclusion, our study demonstrate that miR-655-3p functions as tumor suppressor by directly targeting ADAM10 and indirectly regulating β-catenin pathway in HCC progression and metastasis. [score:8]
MiR-655-3p might functions as a tumor suppressor by directly targeting ADAM10 and indirectly regulating β-catenin pathway in the development of progression of HCC. [score:8]
MiR-655-3p can upregulate E-cadherin expression and inhibit β-catenin signal pathway in HCC cells. [score:7]
Therefore, we identified miR-655 target genes using the target prediction tool, miRwalk, a comprehensive database on miRNAs with six established program (miRanda, miRDB, miRWalk, TargetScan, RNA22, and PITA) [18]. [score:7]
All these results suggested that miR-655-3p might influence the biological behavior of HCC by regulating E-cadherin expression and inhibiting β-catenin signal pathway. [score:6]
These results indicate that miR-655-3p might influence the biological behavior of HCC by regulating E-cadherin expression and inhibiting β-catenin signal pathway. [score:6]
Zhang Z, Song X, Feng X, Miao Y, Wang H, Li Y, Tian H. Norcantharidin modulates miR-655-regulated SENP6 protein translation to suppresses invasion of glioblastoma cells. [score:6]
We also found that down-regulation of miR-655-3p expression levels was significantly associated with the tumor size, portal vein tumor thrombosis(PVTT) status, TNM stage and metastasis status. [score:6]
Overexpression of miR-655-3p significantly suppressed the luciferase activity of the wild-type ADAM10 3’-UTR, but failed to affect the mutant 3’-UTR in HCCLM3 and HepG2 cells (Fig.   5e, f). [score:5]
Overexpression of miR-655-3p suppressed cell proliferation, migration and invasion of HCC in vitro. [score:5]
We found enhancement of the expression of miR-655-3p in HepG2 and HCCLM3 cells could significantly inhibit cell invasion and migration abilities. [score:5]
Using MTT, colony formation and transwell assays, we found that overexpression of miR-655-3p could suppress the proliferation, migration and invasion ability in HCC cells in vitro, indicating the crucial role of miR-655-3p in HCC development. [score:5]
Restoration of miR-655-3p repressed migration and invasion of HepG2 and HCCLM3 cells; and inhibiting miR-655-3p expression promoted cell migration and invasion in Huh7 cells. [score:5]
Ectopic expression of miR-655-3p inhibits HCC cell lines proliferation. [score:5]
These results demonstrated that miR-655-3p inhibited the proliferation, migration and invasion of HCC cells by targeting ADAM10. [score:5]
Moreover, inhibition of ADAM10 expression significantly attenuated the abilities of cell proliferation, migration and invasion promoted by anti-miR-655-3p in Huh7 cells (Fig.   6c, h). [score:5]
In addation, Zhang et al. showed that Norcantharidin suppress glioblastoma cell invasion through modulation of miR-655 -mediated SUMO-specific protease 6 translation [22]. [score:5]
miR-655-3p was significantly down-regulated in HCC tissues and HCC cell lines. [score:4]
Compared to the negative control group, the cancer cell proliferation was dramatically inhibited in miR-655-3p overexpression group by MTT analysis after transfection for 48 h and 72 h (Fig.   2d, e). [score:4]
Fig. 5ADAM10 is a direct target of miR-655-3p in HCC. [score:4]
Then, a dual-luciferase reporter system was carried out to determine whether ADAM10 was a direct target of miR-655-3p. [score:4]
All the above results indicated that miR-655-3p was down-regulated in HCC. [score:4]
Taken together, these results demonstrated that ADAM10 was a direct target of miR-655-3p. [score:4]
The result showed that down-regulation of miR-655-3p was observed in 61 (72.6 %) cases of HCC tissues, which was significantly lower than that in matched non-tumorous tissues (P <0.001, Fig.   1a, b). [score:4]
ADAM10 is a direct target of miR-655-3p in HCC. [score:4]
The results showed that miR-655-3p up-regulation in HCCLM3 and HepG2 cells increased E-cadherin and decreased the nucleus β-catenin (the total β-catenin showed no change), cyclinD1, c-myc protein levels(Fig.   4a, b, c). [score:4]
In this study, we first demonstrated that miR-655-3p was significantly down-regulated in human HCC tissues and cell lines. [score:4]
To examine the functional roles of miR-655-3p in HCC, we upregulated HCCLM3 and HepG2 cells by miR-655-3p agomiR (100nM) transfection. [score:4]
Conversely, inhibiting miR-655-3p in Huh7 cells decreased E-cadherin and unregulated nucleus β-catenin, cyclinD1 and c-myc proteins (Fig.   4a, d). [score:4]
However, the expression level of miR-655-3p and its roles in the development of HCC have not yet been reported. [score:4]
In cell level, miR-655-3p expression was lower in the HCCLM3, HepG2, SK-hep1, MHCC-97H, Huh7, MHCC-97 L cell lines than that in the normal liver cell line LO2 (Fig.   1c). [score:3]
These results proved that miR-655-3p inhibit proliferation in HCC. [score:3]
b, d. analysis of ADAM10 protein expression after the miR-655-3p agomiR, or antagomiR transfection in HCC cells; and their Column charts analysis. [score:3]
The effect of ADAM10 silencing was similar to the effect of miR-655-3p overexpression on proliferation, migration and invasion of HepG2 cells (Fig.   2d, Fig.   3). [score:3]
Only nucleus β-catenin decrease after miR-655-3p overexpression indicated that miR-655-3p may affect the distribution of β-catenin. [score:3]
In addition, miR-655-3p overexpression and depletion decreased and increased HCC cell proliferation, migration and invasion, respectively. [score:3]
Overexpression of miR-655-3p in the two HCC cell lines were confirmed by qRT-PCR after transfection for 48 h (Fig.   2a, b). [score:3]
Thus, we conclude that miR-655-3p mediates HCC progress by targeting the 3’-UTR of ADAM10. [score:3]
a QRT-PCR analysis of miR-655-3p expression in 84 pairs HCC and their corresponding adjacent nontumorous livers tissues. [score:3]
The correlation between miR-655-3p expression and clinicopathological characteristics was shown in Table  1. MiR-655-3p expression was positively associated with tumor size (p = 0.035), PVTT (p = 0.028), TNM stage (p = 0.004) and metastasis (p = 0.001), respectively. [score:3]
Based on above results, miR-655-3p might was a tumor suppressor in HCC. [score:3]
The wild-type ADAM10-3’UTR(WT) and mutant ADAM10-3’UTR(MUT) containing the putative binding site of miR-655-3p were established and cloned in the Firefly luciferase expressing vector pMIR-REPORT (Obio Technology, China). [score:3]
Our findings elucidated the detailed roles of miR-655-3p in HCC and further contribute to offering the effective therapeutic targets for the treatment of HCC. [score:3]
c. The predicted interaction site of miR-655-3p and candidate target gene ADAM10 wild-type 3’-UTR and serial deleted forms of the 3’UTR reporters. [score:3]
These findings provide a new insight into the molecular pathogenesis of HCC and identify miR-655-3p as a novel therapeutic candidate target for HCC. [score:3]
Association of miR-655-3p expression with clinicopathological features. [score:3]
a. qRT-PCR analysis of ADAM10 mRNA expression after the miR-655-3p agomiR, or antagomiR transfection in HCC cells. [score:3]
Yosuke et al. reported that miR-655 represses EMT progress through inducing inactivation of the TGF-β signaling pathway by targeting ZEB1 and TGFBR2, in ESCC [15]. [score:3]
Using TargetScan, we located potential binding sites for miR-655-3p at the 3’UTR of ADAM10 mRNAs (Fig.   5c). [score:3]
Low miR-655-3p expression was negatively related to tumor size, portal vein tumor thrombosis (PVTT) status, TNM stage and metastasis status. [score:3]
To analysis the miRNA-655-3p expression pattern, 84 pairs of HCC tissues and adjacent non-tumorous liver tissues were detected by qRT-PCR. [score:3]
Aberrant miR-655-3p expression has been associated with several cancers. [score:3]
MiR-655-3p -mediated control of ADAM10 expression was further validated by complementary gain and loss-of-function approaches. [score:2]
MiR-655-3p expression was detected by quantitative RT-PCR (qRT-PCR) in human HCC tissues and cell lines. [score:2]
MiR-655-3p expression in HCC tissues and cell lines. [score:2]
However, the role and underlying mechanism of miR-655-3p in the development of hepatocellular carcinoma (HCC) remains unclear. [score:2]
Based on these findings, we speculated miR-655-3p might play a vital role in HCC development. [score:2]
In our study, we also found that ADAM10 silencing suppresses HCC proliferation, migration and invasion in vitro, and using a luciferase -based reporter assay, we demonstrated that miR-655-3p could bind to a sequence within the 3’-UTR of ADAM10. [score:2]
Various publications have associated the dysregulation of miR-655 with cancer progress. [score:2]
The target gene and downstream of miR-655-3p were determined by qRT-PCR, western blot and dual-luciferase reporter assays. [score:2]
The number of invasive and migrated cells in the miR-655-3p overexpression group(82 ± 5 and 58 ± 6, respectively) was significantly decreased, compared with the negative control group (180 ± 8 and 105 ± 7, respectively) in HepG2 cells. [score:2]
Conversely, miR-655-3p inhibitor significantly promoted the proliferation potential in Huh7 cells both in MTT and colony formation assays (Fig.   2c, f, i). [score:2]
Consistent with the, colony formation assay also showed that miR-655-3p overexpression led to a significant reduction of colony number in HCC cells (Fig.   2g, h). [score:2]
Fig. 6Loss-of function of ADAM10 mimicked impact of miR-655-3p on HCC cell proliferation and metastasis. [score:1]
e, f. of co -transfected with miR-655-3p agomiR and pMIR-REPORT-ADAM10 plasmid (miR-NC and miR-655-3p with ADAM10 WT 3’UTR; miR-NC and miR-655-3p with ADAM10 MUT 3’UTR) after 24 h. Data are mean ± SEM (n = 3). [score:1]
a analysis of E-cadherin and β-catenin signal pathway proteins after transfection of miR-655-3p agomiR or antagomiR or controls. [score:1]
The sequences of Oligonucleotides were as follows: agomiR-655-3p, sense 5’-AUAAUACAUGGUUAACCUCUUU-3’ and antisense 5’-AGAGGUUAACCAUGUAUUAUUU-3’; miRNA negative controls, sense 5’-UUCUCCGAACGUGUCACGUTT-3’ and antisense 5’-ACGUGACACGUUCGGAGAATT-3’; anti-miR-655-3p, 5’-AAAGAGGUUAACCAUGUAUUAU-3’; negative control, 5’-UUGUACUACACAAAAGUACUG-3’; Si-ADAM10, 5’-CAGUGUGCAUUCAAGUCAA-3’. [score:1]
The association between miR-655-3p relative expression and the clinicopathological parameters was evaluated by the χ2 test or Fisher’s exact test when appropriate. [score:1]
The miR-655-3p agomiR (agomiR-655-3p), antagomiR (anti-miR-655-3p), small interfering RNA for ADAM10 (siADAM10) and their negative control (Neg. [score:1]
a, b, c. QRT-PCR analysis of miR-655-3p transfection efficiency after the miR-655-3p agomiR, or antagomiR transfection in HCC cells. [score:1]
However, the relationship between miR-655 and HCC remains unknown. [score:1]
While, ADAM10 was one of the gene that was predicted to binding miR-655 by at least five program and related to HCC biological progress according to the relevant previous reports [19, 20]. [score:1]
h Transwell analysis of migration and invasion abilities of Huh7 cells after transfected miR-655-3p antagomiR or co -transfected Si-ADAM10 or controls. [score:1]
There are several miRNAs encoded in 14q32 locus, including miR-655-3p, miR-127-5p, miR-369-3p, miR-544a. [score:1]
c The analysis of proliferation ability of Huh7 cells after transfected miR-655-3p antagomiR or co -transfected Si-ADAM10 or controls. [score:1]
g, h, i. analysis of HCC cells after treatment with miR-655-3p agomiR or antagomiR or controls. [score:1]
Based on these results, we concluded that miR-655-3p decreased the migration and invasion of HCC cells. [score:1]
Loss-of function of ADAM10 mimicked impact of miR-655-3p on HCC cell proliferation and metastasis. [score:1]
miR-655-3p Hepatocellular carcinoma ADAM10 β-catenin pathway Proliferation Migration and invasion Hepatocellular carcinoma (HCC), accounting for 85-90 % of primary liver cancers, is the fifth most frequent malignancy and the second leading cause of cancer-related death in developing countries [1, 2]. [score:1]
Fig. 3Effect of miR-655-3p on invasion and migration in HCC. [score:1]
Restoration of miR-655-3p represses migration and invasion of HCC cells. [score:1]
The relative expression level of miR-655-3p in each paired tumor and adjacent non-tumorous tissue was calculated by the 2 [-ΔΔCT] method. [score:1]
There were no miR-655-3p binding sites predicted on mRNA of E-cadherin, β-catenin, cyclinD1 and c-myc. [score:1]
[1 to 20 of 91 sentences]
3
[+] score: 295
Finally, we analyzed miRNA-target associations at the mRNA level in ESCC and OSCC primary samples (Fig. S6A), however significant correlations were not found between miR-655 expression and expression of ZEB1 or TGFBR2 transcripts as well as a large number of miRNAs and their targets, indicating that not only miR-655 but also other unknown molecules including transcription factors might regulate ZEB1 and TGFBR2 expression. [score:12]
Furthermore, overexpression of exogenous miR-655 significantly inhibited the upregulation and downregulation of these EMT-regulatory genes in KP1N cells treated with and without TGF-b, respectively (Fig. 4D and Fig. S9), whereas miR-655 could not change levels of phosphorylated Smad2/3 in these cells. [score:12]
Overexpression of miR-655 remarkably increased E-cadherin expression and suppressed cell motility in several cancer cell lines, clearly indicating that this miRNA is a strong suppressor of EMT. [score:9]
Similar to result in primary samples, there were no correlations between miR-655 expression and mRNA or protein expression of these targets in ESCC cell lines because of remarkable reduction of miR-655 expression in almost ESCC cell lines (Fig. S6B). [score:9]
Second, our studies past and present, have showed the mesenchymal-specific downregulation of miR-200 expression in a panel of OSCC [35] and pancreatic cancer cell lines, respectively, but not miR-205 and miR-655 expression. [score:8]
In Kaplan-Meier survival curves for 29 patients with ESCC expressing higher and lower levels of miR-655, univariate analyses of overall and non-recurrent survival with log-rank tests demonstrated a significant association between higher levels of miR-655 expression and a better survival rate (Fig. 3C, P = 0.0359, log-rank test), whereas the miR-655 expression in each tumor was not associated with clinicopathological features (Table S3). [score:7]
Our findings strongly suggest that the TGF-b -induced EMT can be suppressed by miR-655, independently of miR-200 family members, through translational inhibition of ZEB1 and TGFBR2 in cancer cells (Fig. 4E). [score:7]
Marked down regulation of miR-655 expression was also observed in 97.7% (42/43) of ESCC and 94.7% (18/19) of OSCC cell lines (<0.5-fold expression) (Fig. S3A and B). [score:6]
However, in all four cell lines 96 hours after transfection with miR-655, a morphological shift toward the epithelial phenotype was induced (Fig. 2B) consistent with an upregulation of CDH1/E-cadherin expression at the mRNA and protein levels (Fig. 2C). [score:6]
In the present study, the expression of miR-655 was largely downregulated in a panel of pancreatic cancer, ESCC and OSCC cell lines, and a breast cancer cell line, MDA-MB-231. [score:6]
In a Western blot analysis in the parental Panc1 cells 96 hours after transient transfection with these miRNAs, miR-520d-3p and miR-655, as well as miR-200b-3p, were confirmed to upregulate expression of the E-cadherin protein markedly, whereas only slight effects of other miRNAs were observed (Fig. 1D). [score:6]
Moreover, the expression of endogenous miR-655 was higher in MCF7 and MCF10A (human breast epithelial cells) than MDA-MB-231, suggesting that downregulation of miR-655 might contribute to phenotypic stabilization of mesenchymal feature in MDA-MB-231 cell line (Fig. S3C). [score:6]
The Panc1 and KP1N cell lines are miR-655 -high expressers, while the KP4-4 and MDA-MB-231 cell lines are miR-655-low expressers (Fig. 2A). [score:5]
Moreover, in the luciferase reporter assay with vectors containing the wild type or a mutated 3′-UTR target site of ZEB1 (region 4) and TGFBR2 (region 1) downstream of the luciferase reporter gene, we detected statistically significant reductions in luciferase activity in wild type constructs, but not in mutant constructs (Fig. 4C and Fig. S8A and B), indicating that ZEB1 and TGFBR2 were novel direct targets of miR-655. [score:5]
On the other hand, overexpression of miR-655, as well as the miR-200 family, induced significant morphologic changes and inhibited cell migration and invasion in 3 pancreatic cancer cell lines and a breast cancer cell line, MDA-MB-231. [score:5]
In addition, we confirmed that ectopic expression of miR-655 increased CDH1/E-cadherin expression at the mRNA and protein levels in an ESCC cell line, TE8, and an OSCC cell line, HSC2, (Fig. S4), although a morphological shift toward the epithelial phenotype in these cell lines was not observed (data not shown). [score:5]
Among 22 normal tissues, upregulation of miR-655 expression was observed in brain, cervix, esophagus and placenta (>2-fold increase compared with a normal pancreas) (Fig. 3A). [score:5]
E, Schema of regulation of the ZEB1-E-cadherin axis and TGF-b signaling pathway by miR-655 through downregulation of ZEB1 or TGFBR2 in cancer cells. [score:5]
Marked upregulation of miR-655 expression (>2-fold increase compared with pancreas) was observed in brain, cervix, esophagus and placenta. [score:5]
To take into consideration off-target effects of dsRNAs, these EMT-suppressive effects of miR-655 were also confirmed using two kinds of dsRNAs purchased from independent companies (Fig. S5). [score:5]
Moreover, we found a significant correlation between higher levels of miR-655 expression and a better survival rate in patients with ESCC, suggesting miR-655 expression to be a promising prognostic marker for ESCC. [score:5]
In addition, several components of TGF-b signaling pathways, TGFBR2, Snail and ZEB1, were reduced directly or indirectly by overexpression of miR-655 in cancer cells treated with or without TGF-b. Recent studies have demonstrated that a miRNA significantly decreased signal output over time, by reducing the concentration of several components in a signaling cascade [50], [51]. [score:5]
Our results suggest the potential of the EMT-suppressor miR-655 targeting ZEB1 and TGFBR2 as a prognostic marker and therapeutic agent for cancer. [score:5]
EMT-suppressive Effects of miR-655 on Mesenchymal-like Cancer Cells having Phenotypic Plasticity at EMT/METThe expression profile of miR-655 was compared with that of each of seven typical EMT-related genes (CDH1/E-cadherin, miR-141, -200a, -200b, -200c, -205, and VIM) in a panel of 23 pancreatic cancer cell lines and a breast cancer cell line, MDA-MB-231 (Fig. 2A and Fig. S2). [score:4]
In the present study, ZEB1 and TGFBR2 were identified as direct targets of miR-655. [score:4]
Expression levels of miR-655 in tumors as compared with paired non-tumorous mucosae were markedly reduced in 44.8% (13/29) and 60.9% (14/23) of primary ESCC and OSCC cases, respectively (<0.5-fold expression) (Fig. 3B). [score:4]
C, Confirmation of ZEB1 and TGFBR2 as direct targets of miR-655. [score:4]
org/) [39], [40] for direct targets of miR-655, and focused on ZEB1 and TGFBR2 as potential candidates, respectively. [score:4]
Although no correlation between the expression pattern of miR-655 and that of any of these marker genes was found in this panel, these cell lines all showed lower expression of miR-655 than the miR-200 family and miR-205, as compared with a normal pancreas. [score:4]
B, Expression profiles of miR-655 in a panel of paired tumorous and non-tumorous tissues from primary ESCC and OSCC cases. [score:3]
Here, we successfully identified miR-655 for the first time as a novel EMT-suppressive miRNA through function -based screening. [score:3]
D, Suppressive effects of ds- miR-655 on TGF-b -induced EMT in KP1N cells. [score:3]
Although expression levels of ZEB1 and TGFBR2 tended to be lower in pancreatic cancer cell lines and a breast cancer cell line relative to a normal pancreas (Fig. 4A), transcript and protein levels of these candidate genes were markedly reduced in mesenchymal-like pancreatic or breast cancer cells 96 hours after transfection with dsRNAs mimicking miR-655 (Fig. 4B). [score:3]
The present study is the first to show clearly that miR-655 targets ZEB1 and TGFBR2 inducing inactivation of the TGF-b signaling pathway, involving the miR-200-ZEB1-E-cadherin axis, strongly suggesting a potential role for miR-655 as a prognostic marker and therapeutic agent in human cancers. [score:3]
These differences between miR-655 and miR-200 family members indicate the biological function of each EMT-suppressive miRNA in physiological and pathophysiological processes, including EMT/MET. [score:3]
Although the miR-200 family and miR-205, like miR-655, target ZEB1, their biological functions were found to differ from those of miR-655. [score:3]
C, Expression profiles of miR-655 in normal esophagus and mammary gland, MCF7, MCF10A (human breast epithelial cells) and MDA-MB-231. [score:3]
Relative expression levels of transcripts of CDH1/E-cadherin and miR-655 were quantified in comparison to GAPDH and RNU6B, respectively, to normalize the initial input of total RNA. [score:3]
In univariate analyses of overall and non-recurrent survival with log-rank tests, a high level of miR-655 expression was significantly associated with a much better survival rate among patients with ESCC (P = 0.0359, log-rank test). [score:3]
Expression Analysis of miR-655 in Primary ESCC and OSCC Cases. [score:3]
EMT-suppressive Effects of miR-655 on Mesenchymal-like Cancer Cells having Phenotypic Plasticity at EMT/MET. [score:3]
We next examined the expression level of the miR-655 transcript in primary tumors of ESCC and OSCC, respectively. [score:3]
In ESCC, miR-655 expression demonstrated a significant association with a better prognosis. [score:3]
To confirm the EMT-suppressive effects of miR- 655 on mesenchymal-like pancreatic or breast cancer cells having phenotypic plasticity at EMT/MET, we ectopically introduced 10 nM of synthetic dsRNA mimicking mature miR-655 into Panc1, KP1N, KP4-4 and MDA-MB-231 cells. [score:3]
B, Representative results of phase contrast images (Upper) and CDH1/E-cadherin protein expression level detected by immunofluorescence staining (Lower) in Panc1, KP1N, KP4-4 and MDA-MB-231 cells 96 hours after transfection with 10 nM of ds- NC or dsRNA mimicking miR-655 (ds- miR-655) (Ambion). [score:3]
These observations suggest the EMT-suppressive effects of miR-655 to be essential for cancer progression. [score:3]
We could not analyze the prognostic significance of miR-655 expression in OSCC because complete survival data was not included in our clinical data. [score:3]
Expression Analysis of miR-655 in Primary ESCC and OSCC CasesWe investigated the normal human tissue distribution and tumor expression of endogenous miR-655 by TaqMan RT-PCR analysis. [score:3]
0062757.g003 Figure 3Expression analysis of miR-655 in primary ESCC and OSCC cases. [score:3]
Moreover, the relative fluorescence intensity of miR-655 was clearly higher than that of miR-520d-3p (Table 1), suggesting miR-655 to be a prime candidate for EMT-suppressive miRNA. [score:3]
By using the system for the first time we identified miR-655 as a novel EMT-suppressive miRNA, the biological meaning of which was different from that of the miR-200 family. [score:3]
Figure S3Expression profiles of miR-655 in a panel of 43 ESCC cell lines. [score:3]
0062757.g002 Figure 2EMT-suppressive effects of miR-655 on mesenchymal-like cancer cells having phenotypic plasticity at EMT/MET. [score:3]
Expression analysis of miR-655 in primary ESCC and OSCC cases. [score:3]
EMT-suppressive effects of miR-655 on mesenchymal-like cancer cells having phenotypic plasticity at EMT/MET. [score:3]
These results suggest that miR-655 may suppress EMT in mesenchymal-like cancer cells. [score:3]
These findings suggest that miR-655 expression may significantly correlate with prognosis in ESCC. [score:3]
Characterization of ZEB1 and TGFBR2 as Novel Direct Targets of miR-655 We searched the websites microRNA. [score:2]
Characterization of ZEB1 and TGFBR2 as novel direct targets of miR-655. [score:2]
0062757.g004 Figure 4Characterization of ZEB1 and TGFBR2 as novel direct targets of miR-655. [score:2]
Characterization of ZEB1 and TGFBR2 as Novel Direct Targets of miR-655. [score:2]
Furthermore, ZEB1 and TGFBR2, which are cardinal components of the TGF-b signaling pathway, were characterized as direct targets of miR-655. [score:2]
First, besides ZEB1, TGFBR2 was characterized as a direct target of miR-655 in our study, but not the miR-200 family and miR-205. [score:2]
The expression profile of miR-655 was compared with that of each of seven typical EMT-related genes (CDH1/E-cadherin, miR-141, -200a, -200b, -200c, -205, and VIM) in a panel of 23 pancreatic cancer cell lines and a breast cancer cell line, MDA-MB-231 (Fig. 2A and Fig. S2). [score:2]
Right, of luciferase reporter assays in Panc1 cells 48 hours after cotransfection of pMIR-REPORT luciferase vectors containing wild-type (Wt) or mutated (Mut) 3′-UTR target sites of ZEB1 or TGFBR2 for miR-655, ds- miR-655 or ds- NC, and pRL-CMV internal control vector. [score:2]
Figure S8 A, Complementary miR-655 seed sequence and PCR region in the 3′UTR of ZEB1 (Upper) and TGFBR2 (Lower). [score:1]
C, TaqMan real-time RT-PCR analysis (Upper) and Western blot (Lower) analysis of mRNA and protein levels of CDH1/E-cadherin, respectively, in Panc1, KP1N, KP4-4 and MDA-MB-231 cells 96 hours after transfection of 10 nM of ds- NC or ds- miR-655. [score:1]
D, Growth curves in Panc1, KP1N, KP4-4 and MDA-MB-231 cells after transfection of 10 nM of ds- NC or ds- miR-655. [score:1]
Cells were analyzed 72 hours after treatment with or without TGF-b (5 ng/ml) and transfection with ds- miR-655 or ds- NC, simultaneously. [score:1]
Figure S7TaqMan real-time RT-PCR analysis (Upper) and Western blot (Lower) analysis for ZEB1 (left) and TGFBR2 (right) in Panc1, KP1N and MDA-MB-231 cells 96 hours after transfection of 10 nM of ds- NC or ds- miR-655 (Thermo Scientific Dharmacon). [score:1]
Table S3Correlation between clinicopathological characteristics and status of miR-655 expression in primary ESCC cases. [score:1]
A, TaqMan real-time RT-PCR analysis of CDH1/E-cadherin and miR-655 in a panel of 23 pancreatic cancer cell lines and a breast cancer cell line, MDA-MB-231. [score:1]
A, TaqMan real-time RT-PCR analysis of endogenous miR-655 in 22 normal human tissues (Ambion and Clontech). [score:1]
The miR-655 gene is located within a non-coding region at 14q32.31, which harbors 50 intergenic miRNA genes within a limited region of 198 kb. [score:1]
Notably, effects of overexpression of exogenous miR-655 on cell growth were not constant in these cell lines (Fig. 2D), whereas the number of cells that migrated through the uncoated or Matrigel-coated membranes in cell migration or invasion assays, respectively, was significantly decreased in all miR-655-transfectants compared with their control counterparts (Fig. 2E and 2F). [score:1]
Figure S9TaqMan real-time RT-PCR analysis for CDH1/E-cadherin (left) and PAI-1 (right) in KP1N cells 96 hours after transfection of 10 nM of ds- NC or ds- miR-655 (Ambion). [score:1]
Figure S4TaqMan real-time RT-PCR analysis (Upper) and Western blot (Lower) analysis of mRNA and protein levels of CDH1/E-cadherin, respectively, in TE8 and HSC2 cells 96 hours after transfection of 10 nM of ds- NC or ds- miR-655. [score:1]
Furthermore, to evaluate the clinical significance of miR-655 expression in ESCC, we categorized the patients into two groups based on the mean value: a low miR-655 group (n = 18) and a high miR-655 group (n = 11). [score:1]
We investigated the normal human tissue distribution and tumor expression of endogenous miR-655 by TaqMan RT-PCR analysis. [score:1]
Figure S5TaqMan real-time RT-PCR analysis (Upper) and Western blot (Lower) analysis for CDH1/E-cadherin in Panc1, KP1N and MDA-MB-231 cells 96 hours after transfection of 10 nM of ds- NC or ds- miR-655 (Thermo Scientific Dharmacon). [score:1]
Bar graphs show the percentage (%) of miR-655-transfectants migrating (Left) or invading (Right) through uncoated or Matrigel-coated filters, respectively, relative to control-transfectants. [score:1]
C, Kaplan-Meier survival curves for high and low miR-655 groups based on TaqMan real-time RT-PCR. [score:1]
Figure S6 A, The correlations between miR-655 and ZEB1/TGFBR2 on mRNA levels in ESCC/OSCC primary samples. [score:1]
B, The correlations between miR-655 and ZEB1/TGFBR2 on mRNA and protein levels. [score:1]
B, TaqMan real-time RT-PCR analysis and Western blot analysis of ZEB1 (left) and TGFBR2 (right) in Panc1, KP1N and MDA-MB-231 cells 96 hours after transfection with 10 nM of dsRNA mimicking miR-655 (ds- miR-655) or control non-specific miRNA (ds- NC) (Ambion). [score:1]
The results of Western blotting of TGFBR2, Snail, ZEB1, E-cadherin, TGFBR1, Smad2/3 and phosphorylated Smad2/3 in KP1N cells 72 hours after treatment with or without TGF-b (5 ng/ml) and transfection with ds- miR-655 or ds- NC, simultaneously. [score:1]
Left, Schema of putative binding sites of miR-655 in the 3′-UTR region of ZEB1 and TGFBR2. [score:1]
[1 to 20 of 87 sentences]
4
[+] score: 15
PTIP might suppress the expression of miR-655. [score:5]
It has been reported that miR-655 as an EMT-suppressive microRNA suppressed invasion of tumors [24, 25]. [score:5]
Our bioinformatical analysis identified eight potential microRNAs that might be regulated by PTIP, including miR-548k, miR-374b, miR-374a, miR-369-3p, miR-374c, miR-655, miR-4307, miR-570. [score:2]
The qRT-PCR results showed that miR-548k, miR-369-3p, miR-655 and miR-4307 increased in PTIP knockdown HCC cells. [score:2]
We selected 8 potential microRNAs including miR-548k, miR-374b, miR-374a, miR-369-3p, miR-374c, miR-655, miR-4307, miR-570. [score:1]
[1 to 20 of 5 sentences]
5
[+] score: 11
The downregulated PTTG1 -targeting miRNAs (miR-329, miR-300, miR-381, and miR-655) induced PTTG1 expression resulting in the downregulation of p53. [score:11]
[1 to 20 of 1 sentences]
6
[+] score: 10
Considering only the specimen-specific miRNAs, miR-122-5p was the most expressed in plasma exosome samples (median reads = 32,512 reads) while miR-655-5p (median reads = 792 reads), miR-204-5p (median reads = 750 reads) and miR-4741 (median reads = 28 reads) were the most abundantly expressed in stool, urine, and cervical scrapes, respectively (Supplementary Figure 2C). [score:5]
We propose miR-142-5p, miR-655-5p, and miR-196a-1-5p as miRNAs with a high and stable expression in plasma exosome, stool, and urine respectively, while piR-43137, chr6. [score:3]
miR-655-5p and miR-196a-1-5p have never been studied in stool and urine, except for miR-196a reported to be altered in focal segmental glomerulosclerosis [51]. [score:1]
Specifically, the analysis highlighted miR-142-5p, miR-655-5p, and miR-196a-1-5p as potential reference miRNAs in plasma exosomes, stool, and urine, respectively (Figure 4A, 4B). [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 7
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Some miRNAs (miR-129-1-3p; miR-129-2-3p, miR-129-5p, miR181c-5p, miR181d-5p, miR-409a-5p, miR-655 and miR-874-3p) were up-regulated (Fig. 2, Supplementary Fig. S3A), whereas others (miR-296-5p, miR-500-3p and miR-652-3p) were down-regulated only in the chronic phase, while not being significantly altered during latency (Fig. 2, Supplementary Fig. S3B). [score:7]
[1 to 20 of 1 sentences]
8
[+] score: 7
Ingenuity Pathway Analysis of the identified target genes regulated by hsa-miR-655, hsa-miR-134-3p, hsa-miR-4746 showed significant enrichment of several pathways (Supplementary Table S7). [score:4]
hsa-miR-655-3p and hsa-miR-134-3p had a common target gene, DLD (dihydrolipoamide dehydrogenase) which plays an important role in cellular biosynthesis and degradation of amino acid pathways. [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 6
For example, miR-130b [59], miR-150 [60], and miR-655 [61] inhibit EMT by directly targeting ZEB1. [score:6]
[1 to 20 of 1 sentences]
10
[+] score: 5
Although we detected an increase in miR-210 and miR-655 after both KRAS [WT] and KRAS [G12D] overexpression (Supplementary Figure  S1b), their basal expression levels were quite low. [score:5]
[1 to 20 of 1 sentences]
11
[+] score: 4
Our results also suggest the involvement of miR-127, miR-27b, miR-30b, miR-655, miR-95 and miR-495 in skeletal muscle development (S1B Fig. ). [score:2]
miR-655, which seems to be increased during muscle maturation, was not described as being modulated in pig muscle development [35]. [score:2]
[1 to 20 of 2 sentences]
12
[+] score: 1
24885316:− GL894231.1_44092 12,387.7 24,290 auaauacaugguuaaccucuuu 22 hsa-miR-655-3p hsa-mir-655 100.0 7.00E − 17 GL894231.1:23,071.. [score:1]
[1 to 20 of 1 sentences]
13
[+] score: 1
170 hsa-miR-34b2.061.00E-04 hsa-miR-30a-5p−2.130 hsa-miR-34c2.022.00E-04 hsa-miR-95−2.161.00E-04 hsa-miR-4552.063.00E-04 hsa-miR-378−2.081.00E-04 hsa-miR-91.993.00E-04 hsa-miR-218−1.881.00E-04 hsa-miR-2961.933.00E-04 hsa-miR-368−2.002.00E-04 hsa-miR-3012.023.00E-04 hsa-miR-363−1.832.00E-04 hsa-miR-130b1.973.00E-04 hsa-miR-128a−1.904.00E-04 hsa-miR-196b1.934.00E-04 hsa-miR-655−1.946.00E-04 hsa-miR-200a1. [score:1]
[1 to 20 of 1 sentences]