sort by

188 publications mentioning mmu-mir-146b (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-146b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 426
A targeting study demonstrated that miR-146b directly bound to the 3′-UTR of SIRT1 and downregulated SIRT1 at the transcriptional and translational levels. [score:9]
The proposed mechanism by which miR-146b regulates adipogenesis is summarized in Fig 6. Figure 5 through upregulation of SIRT1Knockdown of miR-146b by LNA-miR-146b antagomir (LNA-miR-146b) and the subsequent increase in SIRT1 expression were confirmed through qRT-PCR analysis in the epididymal fat tissue of obese C57BL/6J mice. [score:8]
The proposed mechanism by which miR-146b regulates adipogenesis is summarized in Fig 6. Figure 5 through upregulation of SIRT1Knockdown of miR-146b by LNA-miR-146b antagomir (LNA-miR-146b) and the subsequent increase in SIRT1 expression were confirmed through qRT-PCR analysis in the epididymal fat tissue of obese C57BL/6J mice. [score:8]
Suppression of miR-146b inhibited adipogenesis, whereas miR-146b overexpression induced differentiation even in the absence of adipogenic stimuli. [score:7]
These data suggested that miR-146b was upregulated with subsequent downregulation of SIRT1 in the white adipose tissue of obese mice. [score:7]
Upregulation of miR-146b with subsequent downregulation of SIRT1 was observed in the adipose tissue of obese mice, such as DIO, ob/ob and db/db. [score:7]
Overexpression or inhibition of miR-146b expression was verified by qRT-PCR as described above. [score:7]
Increased miR-146b binds directly to SIRT1 and downregulates SIRT1 expression. [score:7]
Interestingly, miR-146b In did not inhibit adipogenesis in cells in which SIRT1 had been knocked down, despite marked downregulation of miR-146b (Fig 3A, B and Supporting Information Fig S2D). [score:7]
In conclusion, these results suggest that miR-146b is a new SIRT1 inhibitor and potential molecular target for the development of novel therapeutic strategies against obesity. [score:6]
Experiments in which SIRT1 was silenced, inhibited by EX-527, or activated by SA-3 demonstrated that upregulation of SIRT1 abolished miR-146b -induced adipogenesis. [score:6]
Expression of miR-146b and its direct target, SIRT1 in WAT from various obese mice. [score:6]
We identified miR-146b among the miRNAs whose expression levels changed, because it was robustly upregulated in differentiated cells and played a key role in the adipogenesis of 3T3-L1 cells. [score:6]
LNA-miR-146b knocked down miR-146b with subsequent upregulation of SIRT1 in perirenal adipose tissues (Fig 5A). [score:5]
miR-146b regulates adipogenesis via modulation of SIRT-1. Downregulation of SIRT1 is required for the adipogenic effect of miR-146b. [score:5]
: Expression of miRNA-146b, a well-known inhibitor of glioma cell migration, was increased during adipogenesis. [score:5]
miR-146b directly binds and downregulates SIRT1. [score:5]
In order to test the inhibitory effects of LNA-miR-146b, we analysed miR-146b expression in various tissues from LNA-miR-146b -injected mice. [score:5]
Here, we showed that systemic administration of a 16-nucleotide LNA inhibitor complementary to the 5′-end of miR-146b specifically silenced miR-146b expression in vivo without hepatotoxicity. [score:5]
The effect of miR-146b inhibitor (In) on miR-146b expression. [score:5]
Moreover, we observed an in vivo knockdown of miR-146b by LNA-miR-146b reduced body weight and adiposity in obese mice along with upregulation of SIRT1. [score:5]
SIRT1 was inhibited by treating with 10 µM 6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide [EX-527] (Enzo Life Sciences, Framingdale, MI, USA) in 3T3-L1 cells that had been transfected with a miR-146b inhibitor. [score:5]
In contrast, transfection of miR-146b In decreased miR-146b expression and inhibited 3T3-L1 differentiation (Fig 1F and G). [score:5]
Knockdown of miR-146b improved hepatic steatosis via upregulation of SIRT1 in high fat-fed obese mice. [score:5]
Target analysis predicts that SIRT1 is a potential target of miR-146b. [score:5]
: Expression of miRNA-146b, a well-known inhibitor of glioma cell migration, was increased during adipogenesis. [score:5]
Knockdown of miR-146b by LNA-miR-146b antagomir (LNA-miR-146b) and the subsequent increase in SIRT1 expression were confirmed through qRT-PCR analysis in the epididymal fat tissue of obese C57BL/6J mice. [score:4]
Therefore, reduced adiposity through downregulated miR-146b plays a crucial role in attenuating metabolic disorders including insulin resistance and dyslipidemia. [score:4]
Although we found that systemic knockdown of miR-146b effectively reduced body weight and adiposity, further studies are needed to confirm the direct role of miR-146b using adipose tissue-specific knockout of miR-146b. [score:4]
As shown in Supporting Information Fig S4A, B and C, we observed a substantial 3.9-, 1.9- and 3.4-fold upregulation of miR-146b in ob/ob, db/db, and diet -induced obese mice, respectively, in comparison with corresponding control mice. [score:4]
We identified SIRT1 as a direct functional target of microRNA-146b and confirmed signalling through the miR-146b/SIRT1/FOXO1 pathway. [score:4]
Together, these data demonstrated that downregulation of miR-146b ameliorated adiposity and reduced body weight. [score:4]
In contrast to the reduced luciferase activity observed after miR-146b Ac transfection, mutation of the putative binding site within the SIRT1 3′-UTR abolished the inhibitory effect of miR-146b Ac. [score:4]
A miR-146b activator induced acetylation of FOXO1 as a result of SIRT1 downregulation. [score:4]
IMPACT: We show that miR-146b plays an important role in adipogenesis by downregulating SIRT1 and subsequently increasing acetylated FOXO1. [score:4]
IMPACT: We show that miR-146b plays an important role in adipogenesis by downregulating SIRT1 and subsequently increasing acetylated FOXO1. [score:4]
The expressions of adipogenesis related markers were markedly decreased in adipose tissues by knockdown of miR-146b. [score:4]
Upregulation of miR-146b was accompanied by a reduction in SIRT1 levels. [score:4]
We observed the subsequent upregulation of SIRT1 in livers from the LNA-miR-146b injected mice (Supporting Information Fig S7C and D). [score:4]
Silencing of miR-146b ameliorates obesity through upregulation of SIRT1. [score:4]
An antisense oligonucleotide against miR-146b induced upregulation of SIRT1 mRNA and protein in differentiated 3T3-L1 cells (Fig 2D and E). [score:4]
We knocked down miR-146b expression in vivo by injecting a locked nucleic acid (LNA)-miR-146b antagomir (LNA-miR-146b) versus LNA-scrambled negative control (LNA-scramble) in obese mice that were fed a high-fat diet. [score:4]
The effect of miR-146b Ac on expression of SIRT1 protein in undifferentiated 3T3-L1 cells. [score:3]
After 2 d of transfection with miR-146b Ac or miR-Ac CTL, 3T3-L1 cells were maintained in growth medium for 8 d in the presence of 5 µM SA-3. Cells were then stained with Oil red O. The effect of SA-3 on SIRT1 protein expression in the experiment described in (D). [score:3]
Conversely, mir-146b inhibition evoked deacetylation of FOXO1 in differentiated adipocytes. [score:3]
The effect of miR-146b In on expression of SIRT1 protein in differentiated 3T3-L1 cells. [score:3]
Activation of miR-146b increased the expression of acetylated-FOXO1 (Ac-FOXO1) and induced the rise of Ac-FOXO1/FOXO1 ratio (Fig 4A and B). [score:3]
The significant increase in miR-146b expression was maintained during differentiation (Fig 1A). [score:3]
Adipogenic stimuli induce expression of miR-146b. [score:3]
org and found a putative miR-146b binding site in the 3′-untranslated region (UTR) of SIRT1 (Fig 2A and Supporting Information Fig S1). [score:3]
Expression of miR-146b increased when miR-146b Ac was transfected into 3T3-L1 preadipocytes (Fig 1B). [score:3]
Among the miRNAs whose expression levels changed during differentiation of 3T3-L1 cells, miR-146b was dramatically increased by 9.01-fold. [score:3]
Inhibition of miR-146b reduced body weight and fat mass in obese mice. [score:3]
Considering the rapidly increasing prevalence of obesity and the metabolic syndrome, miR-146b is a potential new target for controlling adipose tissue mass and function. [score:3]
Therefore, miR-146b is an attractive target for new therapies aimed at reducing excess fat. [score:3]
C. Administration of LNA-miR-146b inhibitor (LNA-miR-146b) significantly decreased whole body mass (n = 5). [score:3]
3T3-L1 cells were transfected with a mirVana™ miR-146b activator (Ac) or an Ac control (CTL; Life Technologies, Grand Island, NY, USA) and maintained in DMEM supplemented with 10% FBS for 8 d. Alternatively, 3T3-L1 cells were transfected with a mirVana™ miR-146b inhibitor (In) or an In CTL (Life Technologies) 2 d before differentiation according to a standard protocol. [score:3]
Overexpression of miR-146b impedes invasion and migration of U373 (Xia et al, 2009) and U87-MG (Katakowski et al, 2010) glioblastoma cells and MDA-MB-231 breast cancer cells (Hurst et al, 2009). [score:3]
Expression levels of miR-146b and SIRT1 were quantified by qRT-PCR on day 8 of differentiation (n = 3). [score:3]
FOXO1 is a downstream target of the miR-146b/SIRT1 pathway. [score:3]
Thus, miR-146b induced adipogenesis by inhibiting SIRT1 -mediated deacetylation of FOXO1. [score:3]
The effect of miR-146b In on SIRT1 mRNA expression in differentiated 3T3-L1 cells. [score:3]
B. The effect of EX-527 on miR-146b expression in the experiment described in (A). [score:3]
Similarly, decreased expression of miR-146b in the monocytes of obese subjects is associated with inflammation (Hulsmans et al, 2012). [score:3]
Expression levels of two key adipogenic transcription factors, CCAAT/enhancer binding protein alpha (C/EBPα) and PPARγ, and an adipocyte-specific marker, adipocyte fatty acid -binding protein (AP2), were increased after miR-146b Ac transfection (Fig 1E). [score:3]
Treatment with miR-146b Ac decreased SIRT1 mRNA and protein expression in comparison with Ac control -treated 3T3-L1 cells (Fig 2B and C). [score:3]
To study the role of miR-146b in the development of obesity, we compared miR-146b expression levels in adipose tissues from obese mice and matching control mice. [score:3]
To test whether the putative miR-146b binding site in the SIRT1 3′-UTR mediated this repression, we inserted the 3′-UTR transcript or a mutated version of the 3′-UTR into a luciferase expression plasmid and transfected each plasmid into 3T3-L1 cells. [score:3]
We observed a positive correlation between adiposity and expression of miR-146b in obese mice. [score:3]
Treatment with EX-527 did not affect expression of miR-146b but did reduce SIRT1 mRNA levels (Fig 3D and Supporting Information Fig S3B). [score:3]
We searched for a potential miRNA-146b target gene with miRBase and http://microRNA. [score:3]
Conversely, miR-146b In decreased the expression of Ac-FOXO1 and induced the drop of Ac-FOXO1/FOXO1 ratio (Fig 4C and D). [score:3]
Conversely, treatment with SA-3, an SIRT1 activator, eliminated the pro-adipogenic effect of miR-146b Ac without changing miR-146b expression levels (Fig 3E and Supporting Information Fig S3C). [score:3]
C. The effect of SA-3 on miR-146b expression. [score:3]
To confirm the role of miR-146b in adipocyte differentiation, we transfected miR-146b activator (Ac) or miR-146b inhibitor (In) and examined differentiation of 3T3-L1 cells. [score:3]
Figure 6 Adipogenic stimuli induce expression of miR-146b. [score:3]
A. Knockdown of miR-146b by LNA-miR-146b significantly decreased the acetylated FOXO1(Ac-FOXO1)/total FOXO1 ratio of white adipose tissue. [score:2]
Knockdown of miR-146b ameliorated insulin resistance in high fat-fed obese mice. [score:2]
B. Knockdown of miR-146b by LNA-miR-146b reduced white adipose fat mass. [score:2]
Furthermore, we demonstrated that systemic knockdown of miR-146b reduced body weight and fat mass. [score:2]
Therefore, these observations led us to conclude miR-146b/SIRT1 pathway regulates adipogenesis via acetylation of FOXO1. [score:2]
Knockdown of miR-146b by LNA-miR-146b induced hypotrophy of white adipose tissues. [score:2]
The effect of miR-146b knockdown by LNA-miR-146b on FOXO1 acetylation. [score:2]
In summary, our study provides direct evidence that miR-146b induces post-transcriptional SIRT1 silencing, which contributes to adipogenesis. [score:2]
Knockdown of miR-146b by LNA-miR-146b induced weight loss in mice. [score:2]
Furthermore, miR-146b negatively regulates the nuclear factor-kB pathway (Bhaumik et al, 2008) in breast cancer cells. [score:2]
Knockdown of miR-146b by LNA-miR-146b reduced visceral fat volume. [score:2]
In this study, we demonstrate that miR-146b is an upstream negative regulator of SIRT1 during adipocyte differentiation. [score:2]
Knockdown of miR-146b reduced adiposity and whole body mass in high fat-fed obese mice. [score:2]
Expression of miR-146b was compared between mice treated with LNA-miR-146b and those treated with LNA-scrambled negative control (n = 5). [score:2]
We identified miR-146b as a new regulator of adipogenesis and characterized the miR-146b/SIRT1 pathway as a potential target for preventing and treating obesity. [score:2]
To investigate the relevance of miR-146b/SIRT1 signalling to adipogenesis, we knocked down SIRT1 expression in 3T3-L1 cells with a lentiviral -based SIRT1 shRNA (Lenti-shSIRT1). [score:2]
The fasting glucose, insulin and leptin levels were significantly reduced in miR-146b knockdown mice (Supporting Information Table S4). [score:2]
Knockdown of miR-146b was achieved in vivo by administering a LNA-miR-146b antagomir or LNA-scrambled control to obese mice that were fed a high-fat diet for 8 weeks. [score:2]
We searched for miR-146b binding sites in the 5′-UTR of SIRT1 but did not find any potential sites. [score:1]
3T3-L1 cells transfected with miR-146b or miR In CTL were differentiated according to a standard protocol. [score:1]
miR-146b/SIRT1 pathway controls the deacetylation of FOXO1. [score:1]
The increased luciferase activity caused by miR-146b In was also eliminated in cells that were transfected with the mutant plasmid (Fig 2F). [score:1]
3T3-L1 cells were transfected with wild-type or mutant SIRT1 3′-UTR luciferase constructs and with miR-146b Ac, Ac CTL, miR-146b In or In CTL as indicated (n = 5). [score:1]
qRT-PCR analysis of miR-146b during 3T3-L1 differentiation (n = 4). [score:1]
Figure 1qRT-PCR analysis of miR-146b during 3T3-L1 differentiation (n = 4). [score:1]
Undifferentiated 3T3-L1 cells were transfected with miR-146 Ac or miR Ac control (CTL) and maintained in DMEM supplemented with 10% FBS for 8 d. Expression of miR-146b was calculated relative to MOCK (n = 3). [score:1]
The effect of miR-146b Ac on intracellular lipid accumulation in undifferentiated 3T3-L1 cells. [score:1]
Histological examination clearly showed a decrease in adipocyte cell size after treatment with LNA-miR-146b in comparison to LNA-scramble (Fig 5E). [score:1]
Differentiated cells were harvested for analysis or stained with Oil red O. SIRT1 was activated by treating cells with 5 µM SIRT1 Activator 3 (SA-3) (Santa Cruz Biotechnology) after 48 h of transfection with miR-146b Ac. [score:1]
Mice received daily intraperitoneal injections of 25 mg/kg LNA-miR-146b or LNA-scramble dissolved in saline for 3 consecutive days (a total volume of 100 µl). [score:1]
Oil red O staining demonstrated that adipogenesis was induced by miR-146b Ac even in the absence of adipogenic stimuli (Fig 1C and D). [score:1]
Expression levels of miR-146b were measured by qRT-PCR (n = 3). [score:1]
We observed that LNA-miR-146b effectively reduced body weight and white adipose tissue weight (Fig 5C and Supporting Information Fig S5B). [score:1]
Although miR-146b is regarded as a relevant diagnostic marker for certain types of cancer, potential roles in adipogenesis and hypertrophy of adipose tissue have not yet been demonstrated. [score:1]
We propose a pathway in which miR-146b represses SIRT1 -mediated deacetylation of forkhead box O1 (FOXO1) during adipogenesis. [score:1]
Silencing of miR-146b ameliorates obesity. [score:1]
miR-146b negatively modulates SIRT1. [score:1]
The SIRT1 3′-UTR was confirmed to act as a binding site for miR-146b with the pMIR-REPORT™ System (Ambion, Austin, TX, USA). [score:1]
LNA-miR-146b treatment also increased deacetylation of FOXO1 (Fig 5B and Supporting Information Fig S6A). [score:1]
Conversely, an oncogenic role for miR-146b in thyroid cancer (Geraldo et al, 2012) and lung cancers was reported (Patnaik et al, 2011). [score:1]
org, showed alignment between miR-146b and SIRT1. [score:1]
qRT-PCR analysis was performed to measure miR-146b and SIRT1 mRNA expression levels in epididymal adipose tissue (n = 5). [score:1]
In addition, whole body mass and total body fat were significantly decreased after silencing miR-146b (Supporting Information Fig S6C and D). [score:1]
Figure 4 The effect of miR-146b Ac on acetylation of FOXO1 in undifferentiated 3T3-L1 cells. [score:1]
Moreover, glucose- and insulin tolerance test demonstrated the amelioration of insulin resistance by LNA-miR-146b antagomir (Supporting Information Fig S8A and B). [score:1]
Gain- or loss-of-function studies showed that miR-146b promoted adipocyte differentiation. [score:1]
Dyslipidemia and hepatic steatosis were effectively improved by LNA-miR-146b injection (Supporting Information Table S3 and Fig S7A-B). [score:1]
B. Injection of LNA-miR-146b decreased intracellular lipid accumulation in hepatocytes. [score:1]
Furthermore, we demonstrated that SIRT1 was repressed by miR-146b. [score:1]
Increased miR-146b levels were observed in the white adipose tissue of obese mice, such as ob/ob, db/db and diet -induced obesity (DIO) mice. [score:1]
Expression of miR-146b was measured by qRT-PCR (n = 3). [score:1]
The effect of miR-146b In on intracellular lipid accumulation in differentiated 3T3-L1 cells. [score:1]
D. Preadipocytes that were transduced with Lenti-sh NC or Lenti-sh SIRT1 were transfected with miR-146b In or miR In CTL and stimulated to differentiate. [score:1]
Mice were intraperitoneally injected with 25 mg/kg/d LNA-miR-146b or LNA-scramble for 3 consecutive days and sacrificed 72 h after the last injection (n = 5). [score:1]
A. Administration of LNA-miR-146b reduced hepatic hypertrophy (n = 5). [score:1]
Figure 3 Preadipocytes transduced with Lenti-sh NC- or Lenti-sh SIRT1were transfected with miR-146b In or miR In CTL. [score:1]
3T3-L1 cells were transfected with miR-146b Ac or miR-Ac CTL. [score:1]
The effect of miR-146b Ac on acetylation of FOXO1 in undifferentiated 3T3-L1 cells. [score:1]
B, C. Effect of LNA-miR146b injection on AST and ALT, which are biomarkers of liver injury (n = 5). [score:1]
miR-146b promotes adipocyte differentiation. [score:1]
The effect of EX-527 on the anti-adipogenic activity of miR-146b In. [score:1]
We found that administration of LNA-miR-146b resulted in effective silencing of miR-146b (Supporting Information Fig S5A). [score:1]
Schematic representation of the pro-adipogenic effect of miR-146b. [score:1]
B. Insulin tolerance test in LNA-scramble and LNA-miR146b injected mice (n = 6). [score:1]
3T3-L1 cells were co -transfected with Fugene 6 (Roche Applied Science) and 150 ng of the 3′-UTR luciferase reporter or control vector and 150 ng of miR-146b Ac, Ac CTL, miR-146b In or In CTL vector. [score:1]
The miR-146b level increased by 12.9-fold within 48 h of differentiation medium exposure and remained high for the remainder of the differentiation time course. [score:1]
In the present study, we identified a new pro-adipogenic miRNA, miR-146b. [score:1]
Differentiated cells were harvested for analysis or stained with Oil red O. SIRT1 was activated by treating cells with 5 µM SIRT1 Activator 3 (SA-3) (Santa Cruz Biotechnology) after 48 h of transfection with miR-146b Ac. [score:1]
The effect of miR-146b Ac on the mRNA level of SIRT1 in undifferentiated 3T3-L1 cells. [score:1]
The increase in miR-146b and the resulting decrease in SIRT1 are correlated with hypertrophy of adipose tissue from obese mice, such as ob/ob (A), db/db (B) and diet -induced obese mice (C). [score:1]
Next, we investigated the effect of reduced miR-146b expression on body weight and adiposity of fat mice. [score:1]
HOMA-IR, an indicator for insulin resistance, was also effectively decreased by LNA-miR-146b administration. [score:1]
miR-146b induces 3T3-L1 adipocyte differentiation. [score:1]
Expression of miR-146b was calculated relative to MOCK (n = 3). [score:1]
Figure 2 The miR-146b sequence and its predicted binding site for the mouse and human SIRT1 mRNA sequences. [score:1]
Efficacy and toxicity of LNA-miR-146b antagomir. [score:1]
Preadipocytes transduced with Lenti-sh NC- or Lenti-sh SIRT1were transfected with miR-146b In or miR In CTL. [score:1]
A. Glucose tolerance test in LNA-scramble and LNA-miR146b injected mice (n = 6). [score:1]
A. The effect of EX-527 on the anti-adipogenic activity of miR-146b In. [score:1]
SIRT1 mediates the adipogenic effect of miR-146b in 3T3-L1 cells. [score:1]
In addition, systemic silencing of miR-146b reduced weight gain and fat mass and improved hepatic steatosis. [score:1]
The effect of miR-146b In on acetylation of FOXO1 in differentiated 3T3-L1 cells. [score:1]
The miR-146b sequence and its predicted binding site for the mouse and human SIRT1 mRNA sequences. [score:1]
analysis showed LNA-miR-146b administration markedly decreased adipogenesis-related transcription factors and adipocyte markers (Fig 5F). [score:1]
The role of miR-146b has been studied in various cancer cell lines. [score:1]
A. Expression levels of miR-146b were measured by qRT-PCR in various tissues to test the efficacy of LNAmiR-146b antagomir in mice. [score:1]
[1 to 20 of 162 sentences]
2
[+] score: 389
MiR-146 therefore inhibits endothelial activation by coordinately repressing the induction of adhesion molecules (through targeting of TRAF6/IRAK1/2) and by promoting the expression of eNOS, an inhibitor of leukocyte adhesion (through targeting of HuR) (Supporting Information Fig S13). [score:10]
MiR-146a over -expression reduced c-Fos expression, while inhibition of miR-146 enhanced c-Jun expression in response to IL-1β (n = 4). [score:9]
In addition to regulating the NF-κB pathway, miR-146 also controls activation of the EGR and AP-1 pathways, which are known to drive inflammatory gene expression (De Caterina et al, 2010; Hajra et al, 2000), and miR-146 directly targets HuR, which promotes endothelial activation by antagonizing eNOS expression. [score:9]
Interestingly, microRNA target prediction programs (Targetscan and Pictar) suggested that HuR might be a direct target of miR-146 (Fig 7, Fig. S4). [score:8]
MiR-146a over -expression inhibited the IL-1β -mediated induction of EGR-1 and EGR-3, while inhibition of miR-146 enhanced the induction of EGR-3 (n = 3). [score:7]
Consistent with the reduced levels of pERK, we found that miR-146a over -expression inhibited the activation of EGR-1 and EGR-3 mRNA in response to IL-1β, while miR-146 inhibitors enhanced the induction of EGR-3 mRNA (Fig 5D). [score:7]
Finally, the activation of the AP-1 pathway also appeared to be modestly inhibited by miR-146 since the IL-1β -mediated induction of c-Fos was reduced in cells over -expressing miR-146a, while the induction of c-Jun was enhanced when miR-146 was inhibited (Fig 5F). [score:7]
As approaches for enhancing microRNA expression in vivo continue to improve, it may be feasible to target vascular inflammation by modulating the expression of miR-146 in the endothelium. [score:7]
We found that miR-146a over -expression inhibited the IL-1β -mediated induction of an NF-κB -dependent reporter in endothelial cells, while inhibiting miR-146 enhanced NF-κB activity in response to IL-1β treatment (Fig 5A). [score:7]
confirmed that the loss of eNOS protein in response to IL-1β treatment was enhanced by miR-146 inhibition (Fig 4D) and that IL-1β-inducible VCAM-1, E-Selectin and ICAM-1 protein expression was greatly enhanced by miR-146 inhibition (Fig 4E). [score:7]
MiR-146a over -expression inhibited the basal and IL-1β -induced levels of pERK, while miR-146 inhibitor had the opposite effect. [score:7]
Inhibition of the MAP kinase pathway with the MEK inhibitor, U0126, repressed the rapid induction of EGR-3 following a 1 h treatment with IL-1β (Fig 6A) and inhibited the induction of pri-miR-146a and pri-miR-146b at the same early time-point (Fig 6B). [score:7]
Over -expression of miR-146a in HUVEC resulted in decreased expression of TRAF6 (Fig 3A), a known target of miR-146 (Taganov et al, 2006). [score:7]
We confirmed that luciferase constructs containing the HuR 3′ UTR could be repressed by miR-146a (Fig 7B), and also found that levels of HuR mRNA (Supporting Information Fig S5) and protein (Fig 7C) were suppressed or elevated when miR-146 was over-expressed or knocked-down in endothelial cells, respectively. [score:6]
This suggests that miR-146 does not directly target EGR-3, but that it instead represses activation of EGR proteins via inhibition of upstream signal components (i. e., TRAF6/IRAK1/2). [score:6]
IMPACT: Our findings suggest that therapies that augment miR-146 expression in the vascular endothelium may be protective against the development of inflammatory vascular diseases. [score:6]
Such desensitization might serve to prevent chronic activation of inflammation in the vasculature, and we anticipate that miR-146 expression in the endothelium may therefore play a protective role against the development of atherosclerosis, a chronic inflammatory disease. [score:6]
HuR, a novel miR-146 target, controls endothelial activation by regulating eNOS expression. [score:6]
IMPACT:Our findings suggest that therapies that augment miR-146 expression in the vascular endothelium may be protective against the development of inflammatory vascular diseases. [score:6]
Treatment with miR-146 inhibitor elevated the level of the miR-146 target, TRAF6 (Fig 4A). [score:5]
MiR-146a over -expression reduced IL-1β -induced NF-κB -dependent promoter activity, while inhibition of miR-146 enhanced activity. [score:5]
: We find that the miR-146 microRNA family is induced by pro-inflammatory cytokines and acts to inhibit vascular inflammation by repressing the expression of leukocyte adhesion molecules on the surface of endothelial cells, a process known as endothelial activation. [score:5]
MiR-146a was over-expressed in endothelial cells by transfection of miR-146a mimic and levels of a known target of miR-146, TRAF6, were assessed by Western blot. [score:5]
Levels of NOS3 mRNA were assessed by qRT-PCR in control inhibitor and miR-146 inhibitor transfected cells after 24 h of IL-1β treatment (n = 3). [score:5]
MiR-146a was expressed at much higher levels than miR-146b in the heart, and loss of miR-146a did not affect expression of miR-146b, suggesting that miR-146b is likely unable to compensate for loss of miR-146a (Fig 8B). [score:5]
Similar to our findings using miR-146 inhibitors in vitro, we found that levels of HuR mRNA and protein were increased in the hearts of miR-146a [−/−] mice (Fig 8C), suggesting that HuR is also a target of miR-146a in vivo. [score:5]
The activity of a NF-κB promoter-luciferase reporter construct was assessed in endothelial cells transfected with control mimic, miR-146a mimic, control inhibitor or miR-146 inhibitor. [score:5]
Figure 3 MiR-146a was over-expressed in endothelial cells by transfection of miR-146a mimic and levels of a known target of miR-146, TRAF6, were assessed by Western blot. [score:5]
Figure 5The activity of a NF-κB promoter-luciferase reporter construct was assessed in endothelial cells transfected with control mimic, miR-146a mimic, control inhibitor or miR-146 inhibitor. [score:5]
Additionally, miR-146 inhibitor increased the basal levels of VCAM-1 mRNA, and had a potent effect on the IL-1β-inducible expression of VCAM-1, ICAM-1, SELE and MCP-1 (Fig 4B). [score:5]
Expression of miR-146a was >6-fold higher than miR-146b and miR-146b expression was not affected by loss of miR-146a. [score:5]
was performed to measure VCAM-1, E-Selectin and ICAM-1 protein expression in control inhibitor and miR-146 inhibitor transfected cells. [score:5]
: We find that the miR-146 microRNA family is induced by pro-inflammatory cytokines and acts to inhibit vascular inflammation by repressing the expression of leukocyte adhesion molecules on the surface of endothelial cells, a process known as endothelial activation. [score:5]
Over -expression of EGR-3 resulted in robust induction of a miR-146b proximal promoter/reporter construct, and mutation of the conserved EGR binding site in the miR-146b promoter (Fig 6F) eliminated this induction (Fig 6G). [score:4]
Finally, we find that HuR protein levels are reduced at the late stages of endothelial activation (Fig 7C), suggesting that miR-146 up-regulation at this stage may repress HuR, thereby forming a negative feedback loop. [score:4]
Assessment of the primary transcripts (pri-cursors), pri-miR-146a and pri-miR-146b, by qRT-PCR demonstrated rapid transcriptional up-regulation, which mirrored that of other inflammatory genes (n = 5). [score:4]
To assess the contribution of HuR to the enhanced adhesiveness of miR-146 inhibitor -treated endothelial cells, we knocked-down HuR, and were able to block the increase in THP-1 adhesion (Fig 7E). [score:4]
Additionally, it is possible that alterations in the levels of miR-146 may predispose individuals to the development of vascular inflammatory diseases. [score:4]
Similarly, knock-down of EGR-3 by siRNA (Fig 6C) inhibited the rapid transcriptional induction of both pri-miR-146a and pri-miR-146b in response to IL-1β (Fig 6D). [score:4]
HuR knock-down reduced the elevated adhesion of THP-1 to endothelial cells transfected with miR-146 inhibitor. [score:4]
A miR-146b promoter-luciferase reporter was responsive to EGR-3 over -expression (OE) in bovine aortic endothelial cells (BAEC) and mutation of a conserved EGR binding site abrogated this responsiveness. [score:4]
This was in contrast to knock-down of another miR-146 target, TRAF6, which decreased NF-κB activity (Supporting Information Fig S8D), the induction of adhesion molecules and EGR transcription factors (Fig 7F, Supporting Information Fig S9B). [score:4]
HuR protein levels were quantified by Western blot in cells transfected with control or miR-146a mimic (left) or control or miR-146 inhibitor (right). [score:3]
MiR-146a and miR-146b expression is sustained after the removal of IL-1β. [score:3]
In contrast, pERK levels were enhanced in cells treated with miR-146 inhibitor (Fig 5B, bottom). [score:3]
Figure 4 Endothelial cells were transfected with a miR-146 LNA inhibitor (which reduces levels of miR-146a and miR-146b by >80%), and the level of a known target of miR-146, TRAF6, was measured by Western blot. [score:3]
In addition, the decrease in eNOS (NOS3) mRNA that was observed after a 24 h treatment with IL-1β was augmented by miR-146 inhibitor (Fig 4C). [score:3]
The miR-146 targets, HuR and TRAF6, have divergent effects on the induction of inflammatory genes. [score:3]
Induction of pri-miR-146a and pri-miR-146b by IL-1β was reduced in cells pre -treated with the MAP kinase inhibitor, U0126. [score:3]
miR-146 controls the expression of HuR mRNA. [score:3]
We also identify HuR as a novel target of miR-146 and find that HuR acts to promote endothelial activation and leukocyte recruitment in response to IL-1β. [score:3]
These results suggest that miR-146 targets TRAF6/IRAK1/2 and HuR, which cooperate to control endothelial activation through distinct pathways. [score:3]
In addition to reducing the level of mature miR-146a by 81.7 ± 6.5%, this inhibitor also reduced the level of miR-146b by 92.5 ± 2.7% (not shown), likely owing to the limited (two nucleotide) difference in sequence between miR-146a and miR-146b. [score:3]
In addition, miR-146 modulates post-transcriptional pro-inflammatory pathways via targeting of the RNA binding protein HuR. [score:3]
Interestingly, we found that EGR-3 was a predicted target of miR-146 (Fig 5E). [score:3]
TNF-α induces miR-146a and miR-146b expression. [score:3]
Endothelial cells were transfected with a miR-146 LNA inhibitor (which reduces levels of miR-146a and miR-146b by >80%), and the level of a known target of miR-146, TRAF6, was measured by Western blot. [score:3]
While TRAF6 luciferase reporters were highly repressed in response to miR-146a over -expression (Fig 5E), EGR-3 3′ UTR (Supporting Information Fig S3) or concatemer constructs (Fig 5E), were refractory to miR-146 -mediated repression. [score:3]
While the expression of miR-146a and miR-146b is elevated in human atherosclerotic plaques (Raitoharju et al, 2011), the function of miR-146 in the progression of atherosclerosis is not known. [score:3]
Endogenous miR-146 inhibits the endothelial inflammatory response. [score:3]
MiR-146 inhibits endothelial activation by dampening the activation of pro-inflammatory transcriptional programs, including the NF-κB, AP-1 and MAPK/EGR pathways, likely through regulation of IL-1β signalling pathway adaptor proteins (i. e., TRAF6, IRAK1/2). [score:3]
Quantification of miR-146a/b levels revealed that miR-146a was expressed ∼9-fold higher than miR-146b in unstimulated cells, and ∼3-fold higher than miR-146b in IL-1β -treated cells (Fig 1C). [score:3]
***Indicates a significant difference between IL-1β -treated control and miR-146 inhibitor -transfected cells, p < 0.001. [score:3]
We next utilized a miR-146 locked-nucleic acid (LNA) inhibitor to assess the function of endogenous miR-146 in endothelial cells. [score:3]
Despite the rapid transcription of the miR-146a and miR-146b genes, delayed expression of mature microRNAs implies inefficient or delayed processing of miR-146a/b in cytokine-stimulated endothelial cells. [score:3]
Considering the kinetics of miR-146 induction, we posit that miR-146 may play a role in the resolution of vascular inflammation and that the prolonged expression of miR-146 is a molecular marker of inflammatory ‘memory’. [score:3]
Finally, inhibition of miR-146 in endothelial cells enhanced the adhesion of THP-1 monocytes following IL-1β treatment (Fig 4F). [score:3]
To assess the function of elevated levels of miR-146 in endothelial cells, we over-expressed miR-146a via transfection of miR-146a mimic. [score:3]
MiR-146 targets the RNA -binding protein HuR to control endothelial activation. [score:2]
Taken together these data suggest that activation of the MAP kinase/EGR pathway regulates the transcription of the miR-146a/b loci, and that miR-146 can in turn repress the MAPK/EGR pathway; thereby forming a negative feedback loop. [score:2]
Monocyte adhesion assays were performed in control and miR-146 inhibitor transfected endothelial cells. [score:2]
THP-1 adhesion assays were performed with endothelial cells transfected with control or miR-146 inhibitor and control or HuR siRNA. [score:2]
MiR-146b expression was especially long-lived. [score:2]
We also identify a role for EGR-3 in the transcriptional regulation of both miR-146a and miR-146b (Fig 6). [score:2]
Our findings have added miR-146a and miR-146b to this microRNA -mediated NF-κB regulatory network in the endothelium (Supporting Information Fig S13). [score:2]
The induction of pri-miR-146a and pri-miR-146b was also reduced in EGR-3 knock-down cells (n = 5). [score:2]
MiR-146 inhibits the induction of NF-κB, MAPK/EGR and AP-1 pathways. [score:2]
MiR-146 targets TRAF6, IRAK1 and IRAK2 (Hou et al, 2009; Taganov et al, 2006), which are key adaptor molecules of the IL-1β signal transduction pathway. [score:2]
To test whether a miR-146 -mediated negative feedback loop might also involve EGR proteins, we antagonised the EGR pathway to assess if this pathway regulates the transcription of miR-146a/b. [score:2]
The MAPK/EGR pathway regulates the transcription of miR-146a and miR-146b. [score:2]
MiR-146 negatively regulates the NF-κB, AP-1 and MAPK/early growth response (EGR) pathways. [score:1]
The transcription of miR-146a and miR-146b was sustained for the duration of IL-1β treatment. [score:1]
Schematic of a potential miR-146 binding site in the 3′ UTR of HuR. [score:1]
Curiously, the NF-κB (Arenzana-Seisdedos et al, 1995) and EGR pathways (Fig 5C) are only transiently active following induction of inflammation, yet the transcription of miR-146a/b is maintained in the late stages of an inflammatory response (Fig 1D), and in the case of miR-146b, transcription is maintained even in the absence of cytokine (Fig 2C). [score:1]
Levels of miR-146a and miR-146b were quantified by qRT-PCR in hearts from wild-type and miR-146a [−/−] mice (3–4 months of age, n = 3). [score:1]
Perhaps a similar mechanism involving miR-146a and/or miR-146b operates in endothelial cells to restrain inflammation in response to pro-inflammatory cytokines. [score:1]
The genomic regions surrounding the miR-146a and miR-146b transcriptional start sites were assessed for the presence of Evolutionary Conserved Regions (ECRs) using ECR Browser (http://ecrbrowser. [score:1]
However, a conserved EGR site was identified in the miR-146b promoter (858–848 nucleotides upstream of the mature miR-146b sequence; chr. [score:1]
A miR-146b promoter-luciferase reporter was modestly induced in response to IL-1β and this induction was not observed when the EGR site was mutated. [score:1]
The copy numbers of miR-146a and miR-146b were quantified in non-stimulated (NS) and 72 h IL-1β -treated endothelial cells (n = 3). [score:1]
MiR-146a and miR-146b are induced in response to interleukin-1β (IL-1β) treatment of endothelial cells. [score:1]
p = 0.037 for pri-miR-146a and p = 0.010 for pri-miR-146b (t-test). [score:1]
Levels of eNOS protein were measured in control and miR-146 inhibitor transfected cells. [score:1]
Herein we demonstrate that miR-146a and miR-146b are enriched in endothelial cells in vivo and that they are strongly induced in endothelial cells in response to pro-inflammatory cytokines. [score:1]
Furthermore, the miR-146b promoter was moderately responsive to IL-1β stimulation, and this effect was completely abrogated when the EGR binding site was mutated (Fig 6H). [score:1]
Thus miR-146 represses both transcriptional and post-transcriptional activation of the inflammatory program. [score:1]
p = 0.023 for pri-miR-146a and p = 0.013 for pri-miR-146b (t-test). [score:1]
We demonstrate here that miR-146a and miR-146b act to restrain the intensity and duration of endothelial activation in response to pro-inflammatory cytokine stimulation. [score:1]
We find that miR-146 restrains vascular inflammation by repressing the NF-κB and EGR pathways, which play important roles in atherogenesis (Albrecht et al, 2010; Gareus et al, 2008; Harja et al, 2004). [score:1]
Schematic of deletion of the EGR binding site in the miR-146b promoter. [score:1]
This implies that miR-146 may have an even broader anti-inflammatory role than miR-10a, miR-31, miR-17-5p or miR-181b. [score:1]
To define the cis elements that mediate this effect, we examined evolutionarily conserved regions (ECRs) surrounding the miR-146a and miR-146b genes for conserved EGR binding sites. [score:1]
To quantify the number of copies of miR-146a and miR-146b, comparison was made to a standard curve generated by reverse transcribing a known amount of miR-146a or miR-146b mimic (Dharmacon). [score:1]
Schematic of a potential miR-146 binding site in the 3′ UTR of EGR-3 (top). [score:1]
To determine whether miR-146 could directly repress EGR-3 we performed luciferase assays in which a region of the EGR-3 3′ UTR or a concatemer of the predicted miR-146 binding site, were inserted downstream of the luciferase open reading frame (ORF). [score:1]
Schematic indicating a potential EGR binding site (shaded area) in the miR-146b promoter. [score:1]
Schematic of a miR-146 feedback loop that controls endothelial activation. [score:1]
Bioinformatic analysis of miR-146a and miR-146b proximal promoter regionsThe genomic regions surrounding the miR-146a and miR-146b transcriptional start sites were assessed for the presence of Evolutionary Conserved Regions (ECRs) using ECR Browser (http://ecrbrowser. [score:1]
Induction of miR-146a and miR-146b (miR-146a/b) by inflammatory stimuli in endothelial cells. [score:1]
Our findings suggest that strategies to enhance miR-146a or miR-146b in the vasculature may be therapeutically useful to dampen the endothelial response to inflammatory cytokines, and may potentially be used to shut off the reiterative inflammatory loop that drives atherogenesis or to quell the vascular damage associated with cytokine storm in the setting of sepsis. [score:1]
A potential miR-146 binding site in HuR is highly conserved across species. [score:1]
We found that transcription of miR-146a and miR-146b were rapidly (within 1 h) and dramatically (40- and 20-fold, respectively) induced in response to IL-1β (Fig 1D). [score:1]
Endogenous miR-146 appeared to restrain the intensity as well as the duration of the inflammatory response, since these inflammatory genes remained at elevated levels 24 h after IL-1β treatment (Fig 4B). [score:1]
Figure 7Schematic of a potential miR-146 binding site in the 3′ UTR of HuR. [score:1]
Our data suggests that miR-146a and miR-146b may participate in a negative feedback loop in endothelial cells to restrain endothelial inflammation. [score:1]
We previously identified miR-146a and miR-146b as being enriched in endothelial cells isolated from differentiating embryonic stem cells (Fish et al, 2008). [score:1]
MiR-146a is known to be NF-κB-responsive, while miR-146b is not (Perry et al, 2009). [score:1]
The transcription of miR-146a decreased by 24 h after removal of IL-1β, while transcription of miR-146b was sustained in the absence of IL-1β. [score:1]
For analysis of pri-miR-146a and pri-miR-146b, RNA was treated with DNase I (Ambion) to remove traces of genomic DNA. [score:1]
Endogenous miR-146 restrains endothelial activation. [score:1]
Bioinformatic analysis of miR-146a and miR-146b proximal promoter regions. [score:1]
While the levels of pri-miR-146a decreased following the removal of IL-1β, levels of pri-miR-146b remained unchanged, suggesting that the transcription of the miR-146b locus is maintained following the removal of pro-inflammatory cytokines (Fig 2C). [score:1]
The transcriptional start site of pri-miR-146b is ∼700 nucleotides upstream of the miR-146b mature sequence (Taganov et al, 2006). [score:1]
This would place this EGR site in the proximal promoter of miR-146b. [score:1]
Levels of mature miR-146a and miR-146b were assessed by qRT-PCR (n = 3). [score:1]
We also identify a novel transcriptional pathway involving EGR proteins that participates in the induction of miR-146a and miR-146b. [score:1]
[1 to 20 of 126 sentences]
3
[+] score: 315
More than half of the down-regulated transcripts were predicted to be miR-146b targets (table S1), which is consistent with the fact that microRNAs induce target mRNA degradation [27]. [score:8]
Such inhibitory effect of miR-146b microRNAs on a cell's malignant phenotype has been demonstrated for breast cancer and glioblastoma cells in studies that found dramatic effects of miR-146b overexpression or inhibition on cell migration and invasiveness [18], [19], [20], [21]. [score:7]
The March 2011 release of the comprehensive miRWalk database of validated and predicted microRNA targets [25] was searched to find out if any of the differentially expressed transcripts was a predicted target of miR-146b-5p or -3p (table S1). [score:7]
Generation of A549 cell-lines overexpressing miR-146b microRNAsTo study the effect of miR-146b overexpression in lung cancer cells, human A549 lung adenocarcinoma cells were engineered to overexpress the human pre-miR-146b precursor microRNA. [score:7]
It should be noted that 12 (71%) of the 17 up-regulated mRNAs were also predicted to be a miR-146b target. [score:6]
In a study of U373 human glioblastoma cells, invasiveness and migration was decreased by overexpression of the microRNAs and increased by their knockdown using antisense oligonucleotides, and the targeting of transcripts of the MMP16 matrix metalloproteinase gene by miR-146b-5p was identified [18]. [score:6]
A majority of the up-regulated transcripts, too, were predicted to be miR-146b targets (table S1). [score:6]
Overexpression of miR-146b microRNAs has only a minor effect on the A549 cell phenotypeThe A549-derived cell-lines were examined to identify an effect of miR-146b overexpression on the A549 cells. [score:5]
In the variant, the nucleic acid segments corresponding to the miR-146b-5p and - 3p microRNA sequences were swapped (figure 1A) with the idea that the variation might result in a relatively higher expression of miR-146b-3p, since, among human microRNAs, those generated from the 5p arms of pre-microRNAs tend to be expressed more than those from the 3p arms [11]. [score:5]
The expression of miR-146b microRNAs in NSCLC has been associated with prognosis of the disease [3], [4]. [score:5]
Prognostic value of miR-146b expression in stage I NSCLCWe analyzed microarray -based quantifications of miR-146b-5p and -3p in a microRNA expression dataset previously obtained by us for RNA from formalin-fixed, paraffin-embedded tumor tissue from 77 cases of stage IA NSCLC. [score:5]
In the cell-line studies, miR-146b-5p overexpression was achieved using expression vectors for pre-miR-146b, which is also the precursor for miR-146b-3p. [score:5]
Higher expression of miR-146b-5p in human tumors was also found to be associated with poor overall survival in stage I-III NSCLC in a study that focused on the squamous cell variety of the disease but did not examine miR-146b-3p [4]. [score:5]
miR-146b overexpression altered the expression of only a few genes in A549/146b cells. [score:5]
This could be because of opposing effects of miR-146b-5p and -3p overexpression as suggested by the conflicting recurrence-predictive values of the two microRNAs, or because miR-146b expression changes in non-cancerous stroma and not cancerous epithelia of tumors are responsible for the prognostic value of miR-146b. [score:5]
miR-146b overexpression altered the expression of only a few genes in A549/146b cellsA549/vec and A549/146b cells of similar age in culture were concurrently grown to semi-confluence on two different occasions for isolating total RNA. [score:5]
Because of this, the level of miR-146b-3p too gets higher in the overexpressor cells (figure 1C), and this can affect the influence of miR-146b-5p overexpression on the cells. [score:5]
Among human microRNAs, 5p microRNAs tend to be expressed more than 3p ones [11], and we sought to achieve relative overexpression of miR-146b-3p by using a variant pre-miR-146b pre-microRNA in which the segments of the molecule for the 5p and 3p microRNAs were swapped (figure 1A). [score:5]
It might be that the absence of a major effect of miR-146b overexpression on A549 cells reflects the possibility that miR-146b expression does not have a prognostic value in NSCLC of adenocarcinoma histology. [score:5]
High miR-146b-5p expression, low miR-146b-3p expression, and high miR-146b-5p/-3p ratio were associated with hazard ratios of 2.23 (95% confidence interval [CI]  = 1.14–4.34), 3.91 (95% CI = 1.99–7.68), and 2.95 (95% CI = 1.50–5.82), with Mantel-Cox log-rank test P values of 0.02, <0.01, and <0.01, respectively (figure 5B). [score:5]
The ∼2.6-6.6-fold overexpression of the miR-146b microRNAs in this study is, however, similar to or higher than the general degree of overexpression seen when comparing microRNA profiles of NSCLC tumors with different prognoses [3], [4] (figure 5A). [score:5]
uk/enright-srv/microcosm) generated using themiRanda 3.0 algorithm [30], 941 and 943 human transcripts, respectively, are targeted by miR-146b-5p and -3p, with only 75 targeted by both. [score:5]
A549 cells, engineered with lentiviruses to overexpress the human pre-miR-146b precursor microRNA, were examined for proliferation, colony formation on plastic surface and in soft agar, migration and invasiveness in cell culture and in vivo in mice, chemosensitivity to cisplatin and doxorubicin, and global gene expression. [score:5]
Expression levels of miR-146b-5p and -3p microRNAs in human non-small cell lung cancer (NSCLC) are associated with recurrence of the disease after surgery. [score:5]
Because tumors in NSCLC with a poor prognosis have higher miR-146b-5p expression [3], [4], A549 cells overexpressing miR-146b microRNAs were expected to have a more malignant behavior. [score:5]
Examination of gene expression profiles of the A549/vec and A549/146b cells showed that only about 0.3% of the cells' transcriptome was affected by the overexpression of the miR-146b microRNAs (table S1). [score:5]
To study the effect of miR-146b overexpression in lung cancer cells, human A549 lung adenocarcinoma cells were engineered to overexpress the human pre-miR-146b precursor microRNA. [score:5]
It should be noted that the miR-146b microRNAs are expressed well in cells of the hematopoietic system [34], [35], [36]. [score:3]
In A549/v146b, they were respectively an average of 2.6- and 6.5-fold higher, suggesting the variant pre-microRNA expressed by it was processed into mature miR-146b-5p and -3p microRNAs. [score:3]
Lung colony formation by the A549-derived cell-lines, and miR-146b expressions in tumor stroma and epithelia. [score:3]
The A549-derived cell-lines were examined to identify an effect of miR-146b overexpression on the A549 cells. [score:3]
As shown in figure 5A, the expression level of miR-146b-5p was significantly higher (average 1.53-fold; t test P<0.01) among the cases with recurrence than in those without. [score:3]
In conclusion, we found that overexpression of the lung cancer prognostic miR-146b microRNAs diminishes the malignant phenotype of the A549 lung cancer cells. [score:3]
It is possible that the increased levels of these transcripts are a distant effect of miR-146b overexpression or reflect different genomic changes in the A549/vec and A549/146b cells during generation of the engineered cell-lines. [score:3]
We analyzed microarray -based quantifications of miR-146b-5p and -3p in a microRNA expression dataset previously obtained by us for RNA from formalin-fixed, paraffin-embedded tumor tissue from 77 cases of stage IA NSCLC. [score:3]
The expression of miR-146b-5p appears to be ubiquitous in human tissues, though higher levels are seen in lung, thymus and spleen [7]. [score:3]
Overexpression of the miR-146b microRNAs was observed in both A549/146b and A549/v146b cell-lines (figure 1C). [score:3]
In human NSCLC tumors, expression of both miR-146b microRNAs was 7–10-fold higher in stroma than in cancerous epithelia, and higher miR-146b-5p but lower -3p levels were predictive of recurrence. [score:3]
Expression of miR-146b-5p in 293T, BEAS-2B, MCF-7 and ML-2 cells was 23.8-, 0.7-, 0.6- and 2.8-fold of that in A549/vec. [score:3]
Both miR-146b-5p and -3p microRNAs appear to be expressed much more in the stroma than in the cancerous epithelia of NSCLC tumors (figure 4B). [score:3]
The negative association of miR-146b-5p levels and malignant nature of cells seen in this and the other cell-line -based studies appears to contradict the observation of higher miR-146b-5p expression in tumors with poor prognosis [3], [4], [5]. [score:3]
Expression of miR-146b microRNAs is higher in stroma than in epithelia in stage I NSCLCIn the studies in which the miR-146b microRNAs in early stage NSCLC were quantified [3], [4], the analyzed RNA was obtained from whole tumor. [score:3]
EGFR -targeting by miR-146b-5p has also been shown in MDA-MB-231 human breast cancer cells [20]. [score:3]
Prognostic value of miR-146b expression in stage I NSCLC. [score:3]
Overexpression of miR-146b microRNAs has only a minor effect on the A549 cell phenotype. [score:3]
Expression of miR-146b microRNAs is higher in stroma than in epithelia in stage I NSCLC. [score:3]
Expression of miR-146b microRNAs, miR-146b-5p and miR-146b-3p, in the tumors differed significantly between cases that had a recurrence and those that did not, with the mean miR-146b-5p level higher but the mean miR-146b-3p level lower in the former group. [score:3]
Generation of A549 cell-lines overexpressing miR-146b microRNAs. [score:3]
The ratio of miR-146b-5p and -3p expression levels was also significantly different between the two case-groups, it being an average of 1.67-fold higher in cases with recurrence (t test P <0.01). [score:3]
Only a minimal effect of pre-miR-146b overexpression on the malignant phenotype was seen in A549 cells. [score:3]
In all 12 tumors, expression of miR-146b-5p was significantly higher in the stromum than in the epithelium (average and range of 7.0- and 1.8-24.1-fold; t test P<0.01). [score:3]
A549 pre-miR-146b-overexpressors had 3–8-fold higher levels of both miR-146b microRNAs than control cells. [score:3]
0022379.g004 Figure 4Lung colony formation by the A549-derived cell-lines, and miR-146b expressions in tumor stroma and epithelia. [score:3]
In the 11 tumors in which miR-146b-3p was detected in both compartments, expression of miR-146b-3p too was higher in the stromum than in the epithelium (average and range of 10.4- and 0.4–25.1-fold, respectively; t test P<0.01). [score:3]
miR-146b expressions were assessed in microdissected stroma and epithelia of human NSCLC tumors. [score:3]
We attempted to explore the biological bases of this association by studying the functional consequences of miR-146b overexpression on the malignant nature of the A549 lung adenocarcinoma cell-line. [score:3]
To understand this, the effect of miR-146b overexpression was studied in A549 human lung cancer cells. [score:3]
Association of miR-146b-5p and -3p expression in early stage NSCLC with recurrence was analyzed. [score:3]
Expression of miR-146b-5p and -3p in a set of 77 cases of stage I non-small cell lung cancer. [score:3]
To understand the association of the miR-146b microRNAs with lung cancer prognosis, we sought to study the effects of overexpressing the pre-miR-146b precursor microRNA on the malignant phenotype of the A549 lung adenocarcinoma cell-line. [score:3]
0022379.g005 Figure 5Expression of miR-146b-5p and -3p in a set of 77 cases of stage I non-small cell lung cancer. [score:3]
B. Histograms for red fluorescence quantified by flow cytometry of A549 and A549-derived cell-lines stably transduced with lentiviruses bearing constructs engineered for expression of human pre-miR-146b (A549/146b), or its variant shown in A (A549/v146b), or neither (A549/vec). [score:3]
As depicted in figure 5, the prognostic values associated with miR-146b-5p and -3p microRNAs appear to be antagonistic, with higher miR-146b-5p levels but lower miR-146b-3p levels in stage I NSCLC tumors associated with disease recurrence following surgical resection. [score:3]
A. Scatter-plots of microarray signal intensities, relative to that for a reference RNA, for miR-146b-5p or -3p, or their ratio, for RNA from resected tumor tissue from 37 cases with recurrence of the disease, and for 40 cases without recurrence during the ≥32 months of follow-up following surgery [3]. [score:3]
However, an opposite, though minimal, effect of miR-146b overexpression on A549 cells was observed. [score:3]
B. Relative expression of let-7e, miR-30a-5p, and miR-146b-5p and -3p microRNAs in stromal and cancerous epithelial components of stage I non-small cell lung cancer as assessed using reverse transcription followed by PCR. [score:3]
However, the expression level of miR-146b-3p was significantly lower (average 0.84-fold; t test P<0.01). [score:3]
As in the glioblastoma studies, pre-miR-146b overexpression in the cells reduced thier migration and invasiveness [20]. [score:3]
In vitro migration and invasion of another human glioblastoma cell-line, U87-MG, has also been shown to be reduced by miR-146b-5p overexpression [19]. [score:3]
Besides lung cancer, a higher level of miR-146b-5p in tumors is also associated with a more malignant disease in human papillary thyroid carcinoma [5]. [score:3]
The effects on cell migration and invasiveness seen in the other studies could also be because of the higher degree of miR-146b-5p overexpression that was achieved in the other studies. [score:3]
Similar findings were reported in another study which also suggested a role for miR-146b-5p in negatively regulating the nuclear factor-kB (NF-kB) pathway [21]. [score:2]
We now specifically compared the expression of miR-146b-5p and - 3p microRNAs, and their ratio, in patients with recurrence to those without. [score:2]
Compared to A549/vec, miR-146b-5p and -3p expression, normalized to that of the 45 base-long, housekeeping small nucleolar RNA gene RNU6B, were respectively an average of 4.9- and 6.6-fold higher in A549/146b cells. [score:2]
In neither assay was the ability of A549/146b or A549/v146b cells significantly different from that of A549/vec, or each other, indicating a lack of an effect of miR-146b overexpression on migration of A549 cells (t test P values of >0.05; figure 3A and 3B). [score:2]
Among lung cancer cell-lines, A549 cells are considered as highly invasive [26], and it is possible that an effect of miR-146b overexpression on cell migration and invasiveness could not be observed because of this. [score:2]
Like most pairs of 5p and 3p microRNAs, the two miR-146b microRNAs are generated from the opposite strands (the 5′ and 3′ arms) of a double-stranded stem region of a precursor microRNA, pre-miR-146b, which in turn is derived from the primary MIR146B RNA transcript [6]. [score:1]
Complementary, single-stranded DNA oligonucleotides with the human pre-miR-146b sequence (miRBase [22] accession number MI0003129) and restriction enzyme-site overhangs were obtained from Integrated DNA Technologies® (Coralville, IA). [score:1]
Thus, the two miR-146b microRNAs were found to have opposite prognostic values. [score:1]
The 5′ and 3′ ends, nucleotide positions, and segments corresponding to mature miR-146b-5p and -3p sequences (5p and 3p) are indicated. [score:1]
A549 is an adenocarcinoma cell-line whereas in the studies identifying the prognostic value of miR-146b microRNAs in NSCLC, the tumors were either only squamous cell carcinomas [4] or included squamous cell carcinomas and bronchioloalveolar carcinomas besides adenocarcinomas [3]. [score:1]
Small RNA cloning and deep sequencing studies show that the amount of miR-146b-3p in cells is much less than that of miR-146b-5p [8], [9]. [score:1]
Examination of RNA from the human 293T embryonic kidney, BEAS-2B normal bronchial, MCF-7 breast cancer, and ML-2 acute myeloid leukemia cells, indicated that in these cell-lines too, miR-146b-5p is present at a 4–22-fold higher molar excess than -3p (figure 1E). [score:1]
Therefore, miR-146b-3p C [q] values were adjusted by subtracting 3.6 in order to compare the amounts of miR-146b-5p and -3p RNAs. [score:1]
To characterize the expression of miR-146b in the stromal and epithelial components of NSCLC, a section each from 12 stage I tumors was used for microdissecting and separating the components with LCM. [score:1]
A549/v146b cells were generated using the vector with a variant human pre-miR-146b sequence. [score:1]
Furthermore, in internal cross-validations, miR-146b-3p was identified as a frequent constituent of six-microRNA support vector machines classifiers that could predict recurrence with a mean accuracy of 69%. [score:1]
In humans, both miR-146b-5p and -3p microRNAs are products of the same MIR146B gene that is located on chromosome 10 at position q24.32. [score:1]
A549 cells were transduced with viruses for 48 hours and then subjected to selection against 2 µg/ml puromycin for about two weeks to generate cell-lines A549/vec, A549/146b, and A549/v146b, using viruses generated with an empty pLemiR™ vector, or with the vector bearing the natural or the variant pre-miR-146b sequence, respectively. [score:1]
In the studies in which the miR-146b microRNAs in early stage NSCLC were quantified [3], [4], the analyzed RNA was obtained from whole tumor. [score:1]
MicroRNA miR-146b-3p was detectable in both compartments of only 11 tumors. [score:1]
Oligonucleotides were also obtained for a variant sequence in which the segments for the miR-146b-5p and -3p microRNAs were swapped. [score:1]
Thus, the mature microRNA generated from the 5p strand of pre-miR-146b appears to be much more prevalent than the one from the 3p strand, as suggested by other studies [8], [9]. [score:1]
A number of studies have examined the role of miR-146b microRNAs in cancer ceIl-lines. [score:1]
Briefly, an RNA-specific oligonucleotide, and reagents provided with the TaqMan™ MicroRNA Reverse Transcription Kit (Applied Biosystems®) were used to reverse transcribe 10 ng total RNA from cells, or 5 µl of 0.5-2000 fM synthetic mature microRNAs miR-146b-5p and -3p with 5′ phosphate and 3′ hydroxyl terminii obtained from Invitrogen®. [score:1]
MicroRNA miR-146b-5p was identified as a component of the multi-variable predictive classifiers in that study. [score:1]
In all the three A549-derived cell-lines, miR-146b-5p microRNA was present at an amount that was about 4-6-fold higher than that of the -3p microRNA (figure 1E). [score:1]
Increased miR-146b levels did not seem to affect the sensitivity of the cells to either cisplatin or doxorubicin at drug concentrations varying from 0.5 to 2 µg/ml, even though the drugs were clearly cytotoxic to the cells at the highest concentration (figure 2B). [score:1]
C. Comparison of miR-146b-5p and -3p levels (5p and 3p), normalized to that of the RNU6B small nucleolar RNA, in the A549-derived cell-lines as assessed using reverse transcription followed by PCR (RT-PCR). [score:1]
A. Most stable mfold-predicted secondary structures of human pre-miR-146b and a variant pre-microRNA examined in this study. [score:1]
The mfold [23] RNA-folding algorithm predicts that like natural pre-miR-146b, the variant pre-microRNA too has a stem-loop form (figure 1A), with a ΔG of −31.9 kcal/mol which is 5.2 kcal/mol more than that of the natural pre-microRNA. [score:1]
B. Kaplan-Meier plots depicting post-resection recurrence-free survival among the case-groups with values of miR-146b-5p or -3p, or their ratio, lower (low, grey line) or higher (high) than the group median. [score:1]
[1 to 20 of 102 sentences]
4
[+] score: 189
Other miRNAs from this paper: mmu-mir-146a, hsa-mir-146a, hsa-mir-146b, mmu-mir-145b
MiR-146b-5p is amongst the most expressed miRNAs in mature single -positive thymocytes 49, being up-regulated during the double -positive to single -positive thymocyte transition 37, consistent with a mo del whereby TAL1 aberrant expression contributes to leukemogenesis in developing thymocytes in part by downregulating miR-146b-5p. [score:11]
The lentiviral vector for miR-146b-5p inhibition (146b_KD) is the pEZX-AM03 vector (Tebu-bio) and expresses the specific miRNA inhibitor against hsa-miR-145b-5p. [score:7]
Furthermore, the knockdown of TAL1 in a T-ALL cell line resulted in marked up-regulation of pri-miR-146b (Fig. 1B), indicating a strong negative impact of TAL1 on miR-146b expression. [score:7]
NOD/SCID mice were xenotransplanted either with MOLT-4 cells with miR-146b-5p downregulation (146b KD; red) versus scramble transduced cells (SCR; grey) or with CEM cells ectopically expressing miR-146b (146b OE; blue) versus empty vector-transduced cells (Empty; grey). [score:6]
The fluorescence of MOLT-4 cells (n = 30–50) with miR-146b-5p downregulation (A, B) or CEM cells with miR-146b overexpression (C, D) and respective controls was quantified in high-magnification (×63 objective) images. [score:6]
Given that miRNA-146b-5p was shown to be highly up-regulated during the later stages of thymocyte maturation 49, we reasoned that modulation of its expression could have an effect on T-ALL cell differentiation. [score:6]
In summary, we showed that miR-146b-5p downregulation promotes T-ALL by modulating leukemia cell motility, invasion, organ dissemination and consequent disease aggressiveness. [score:6]
Overall, these observations led us to hypothesize that downregulation of miR-146b-5p is functionally relevant in the context of human T-ALL in general and especially in TAL1 overexpressing cases. [score:6]
TAL1 -positive T-ALL cells express low levels of miR-146b-5p and TAL1 silencing upregulates miR-146b-5p primary transcript. [score:6]
In vivo miR-146b-5p behaves as a tumor suppressor, with significant impact on T-ALL disease progression. [score:5]
Alternatively, since miR-146a and miR-146b can also have specific, non-redundant targets and functions 46, one cannot exclude that miR-146b may have a tumor suppressor role in human T-cells that is not embraced by miR-146a. [score:5]
Transduction of T-ALL cells for miR-146b overexpression or knockdown. [score:4]
CEM cells ectopically expressing miR-146b (146b OE) or mock -transduced (Empty) were compared; MOLT-4 cells with downregulation of miR-146b-5p (146b KD) or scramble-transduced (SCR) were compared. [score:4]
Thus, our bioinformatics analyses suggest that miR-146b-5p likely regulates cell motility and migration via multiple target genes. [score:4]
Our current analyses, using GeneCodis 52, extended to miR-146b-5p predicted target genes (n = 250, Table S1) and indicated that several migration-related processes are significantly enriched, including axon guidance, neural crest cell migration or regulation of actin cytoskeleton reorganization (Figure S7). [score:4]
To this end, we stably knocked down miR-146b-5p in TAL1 -negative (DND-41 and MOLT-4) T-ALL cell lines or overexpressed miR-146b-5p in TAL1 -positive (JURKAT and CEM) cells (Figure S1). [score:4]
In the present study, we demonstrated that miR-146b-5p downmodulates motility, migration and invasion of T-ALL cells in vitro and leukemia dissemination and disease progression in vivo. [score:3]
MiR-146b is downregulated in T-ALL. [score:3]
Altogether, these findings are consistent with the negative effect on motility we observed for miR-146b in vitro and with a tumor suppressor role for miR-146b-5p in T-ALL. [score:3]
Notably, overexpression of miR-146b-5p in TAL1 -positive T-ALL cells decreased their invasion ability (Figs 3F and S5), whereas silencing of miR-146b-5p in TAL1 -negative cells had the opposite effect (Fig. 3G), as determined by cell migration through a matrix layer. [score:3]
The vectors for miR-146b overexpression and respective control (pLemiR-146b-OE and pLemiR-empty) were kindly provided by the Sai Yendamuri lab. [score:3]
MiR-146b downregulates cell motility, migration and invasion of T-ALL cells. [score:3]
In agreement, functional annotation analysis, using DAVID 53, returned several gene ontology terms related to cell motility and migration that are significantly associated (p < 0.05) with miR-146b-5p predicted targets genes (Table S2). [score:3]
Moreover, the frequency of leukemic cells in the blood reflected the pattern of leukemia spread, with a clearly lower percentage in the case of miR-146b -overexpressing cells (Fig. 5C). [score:3]
Next, we sought to determine the functional consequences of miR-146b decreased expression in T-ALL. [score:3]
Notably, we also found that T-ALL primary cells and cell lines expressed significantly lower levels of miR-146b-5p than normal hematopoietic control cells, such as T-cells, thymocytes, bone marrow precursors and CD34+ hematopoietic progenitor/stem cells (Fig. 2). [score:3]
From a therapeutic standpoint, it is noteworthy that intra-tumor injection of exosomes derived from miR-146b -expressing mesenchymal marrow stromal cells was shown to reduce glioma xenograft growth in a rat mo del of primary brain tumor 59. [score:3]
Nonetheless, our demonstration that T-ALL cells, irrespectively of their TAL1 status, express significantly lower levels of miR-146b-5p than healthy controls suggests that miR-146b-5p may be modulated by other factors in addition to TAL1. [score:3]
For instance, a minimal infiltration pattern, with isolated cells, was observed for CEM cells with miR-146b overexpression, while empty vector-transduced cells showed a tendency towards the formation of larger foci of 5–10 cells (Fig. 5D). [score:3]
T-ALL cells overexpressing miR-146b also originated less severe leptomeningeal infiltration than control cells (Figs 5E and S6). [score:3]
Moreover, no differences were found in T-ALL cell viability upon modulation of miR-146b expression (Figure S3). [score:3]
Previously, we showed that miR-146b-5p validated targets are enriched in genes involved in biological processes such as inflammation (e. g., NF-kB and IL1/IL1R signaling pathways) and cancer 37. [score:3]
When will these translate into clinical applications can only be speculated, but it is tempting to envisage future administration of miR-146b as a potential means to prevent or decrease CNS involvement, which is a major risk factor in T-ALL. [score:3]
Moreover, the question arises of which miR-146b-5p target(s) may be responsible for the effects we observed in T-ALL cells. [score:3]
Both mature forms of miR-146b are expressed (miR-146b-5p and miR-146b-3p) 50. [score:3]
Our in vivo findings suggest that miR-146b impacts the capacity of T-ALL cells to infiltrate hematopoietic and non-hematopoietic organs, thereby delaying leukemia progression and effectively acting as a tumor suppressor gene. [score:3]
T-ALL cells express lower levels of miR-146b-5p than normal controls. [score:3]
Loss of miR-146a (which differs from miR-146b-5p by two nucleotides) in fetal liver hematopoietic progenitors overexpressing activated Notch does not appear to impact tumor onset in a mouse mo del of Notch -induced T-ALL 16. [score:3]
On the contrary, T-ALL cells overexpressing miR-146b exhibited lower levels of polymerized actin (Fig. 4C,D). [score:3]
We previously showed that miR-146b-5p was downregulated by TAL1 in T-ALL cell lines and that TAL1 -positive T-ALL patients tended to display reduced levels of miR-146b-5p as compared to other T-ALL cases 37. [score:3]
Using time-lapse microscopy, we found that overexpression of miR-146b in TAL1 -positive cells resulted in decreased cell motility (Fig. 3A–C), suggesting that the miRNA negatively affects random cell movement (chemokinesis). [score:3]
In contrast, miR-146b overexpression in CEM T-ALL cells delayed leukemia -associated death of transplanted mice (Fig. 5B), which presented decreased extent of infiltration of secondary organs (other than bone marrow) as compared to controls (Figs 5C–E and S6). [score:2]
In particular, miR-146b-5p has an anti-oncogenic function in the context of PTEN -deficient T-cell leukemia in mice that is mediated by attenuation of TCR signaling through direct repression of TRAF6. [score:2]
We previously showed that miR-146b-5p is negatively regulated by TAL1 37. [score:2]
Nonetheless, in both our xenograft T-ALL mo dels miR-146b modulation is sufficient to affect T-ALL development. [score:2]
MiR-146b inhibits motility, migration and invasion of T-ALL cells. [score:2]
Silencing of miR-146b-5p in T-ALL cells significantly accelerated leukemia -associated death of transplanted mice (Fig. 5A). [score:1]
We transplanted MOLT-4 cells with stable silencing of miR-146b-5p or mock vector into immunocompromised mice. [score:1]
In agreement with the impact of miR-146b on T-ALL cell movement, miR-146b-5p silencing led to increased actin polymerization (Fig. 4A,B). [score:1]
However, our data suggest that miR-146b-5p does not have a similar role on proliferation of human T-ALL cells. [score:1]
How to cite this article: Correia, N. C. et al. MiR-146b negatively regulates migration and delays progression of T-cell acute lymphoblastic leukemia. [score:1]
In addition, our studies using Ki-67 suggest that miR-146b-5p does not significantly affect human T-ALL cell proliferation in vivo (not shown). [score:1]
MiR-146b delays leukemia progression in vivoTo investigate whether miR-146b exerts a tumor suppressor-like role in vivo, we used murine xenograft mo dels of human T-ALL 51. [score:1]
To investigate whether miR-146b exerts a tumor suppressor-like role in vivo, we used murine xenograft mo dels of human T-ALL 51. [score:1]
However, the inability of miR-146a to prevent leukemogenesis might be due to redundancy with miR-146b-5p, which is very abundant in hematopoietic progenitor cells. [score:1]
On the contrary, downmodulation of miR-146b-5p in TAL1 -negative T-ALL cells promoted migration under the same conditions (Figs 3E and S5). [score:1]
In addition, miR-146b reduced directional migration in response to serum, as assessed in transwell assays (Fig. 3D). [score:1]
Modulation of miR-146b appears to clearly affect CNS infiltration in our in vivo mo dels of human T-ALL. [score:1]
In this context, it would be interesting to determine whether plasma levels of miR-146b in T-ALL patients correlate with CNS infiltration, and whether this could be transversal to other acute leukemias. [score:1]
[1 to 20 of 59 sentences]
5
[+] score: 151
Zerumbone inhibited miR-146b expression similar to that observed with miR-146b inhibitor treatment (Figure 4A). [score:7]
Overexpression or inhibition of miR-146b expression was verified by qRT-PCR. [score:7]
Furthermore, the anti-adipogenic effect of zerumbone was abolished in 3T3-L1 cells with SIRT1 knockdown, suggesting that zerumbone induced SIRT1 expression by downregulating miR-146b and increasing the NAD [+]/NADH ratio. [score:7]
We additionally observed miR-146b downregulation and subsequent SIRT1 upregulation in the WAT of zerumbone-supplemented mice. [score:7]
The downregulation of miR-146b observed following zerumbone treatment resulted in increased mRNA and protein expression of SIRT1. [score:6]
The downregulation of SIRT1 in differentiated 3T3-L1 cells was markedly reversed by treatment with zerumbone and the miR-146b inhibitor (P < 0.05) (Figure 4D). [score:6]
Zerumbone also acts as a miR-146b inhibitor and downregulates miR-146b, leading to SIRT1 activation. [score:6]
Conversely, when 3T3-L1 cells were exposed to a miR-146b mimic and zerumbone simultaneously, zerumbone inhibited the upregulation of miR-146b caused by the miR-146b mimic (Figure 4B). [score:6]
A. Effects of zerumbone and miR-146b inhibitor on miR-146b expression in differentiated 3T3-L1 cells. [score:5]
We previously reported that miR-146b functions as a positive regulator of adipocyte differentiation through downregulation of sirtuin 1 (SIRT1) [25]. [score:5]
Zerumbone interfered with the binding of miR-146b to the seed sequence of SIRT1 and thus reduced SIRT1 promoter-derived luciferase activity (Figure 4C) Figure 4 A. Effects of zerumbone and miR-146b inhibitor on miR-146b expression in differentiated 3T3-L1 cells. [score:5]
This increase was clearly inhibited following treatment with zerumbone and the miR-146b inhibitor. [score:5]
To modulate miR-146b expression, we transfected miR-146b-specific inhibitor or activator into 3T3-L1 cells, as previously described [25]. [score:5]
Zerumbone interfered with the binding of miR-146b to the seed sequence of SIRT1 and thus reduced SIRT1 promoter-derived luciferase activity (Figure 4C) Figure 4 A. Effects of zerumbone and miR-146b inhibitor on miR-146b expression in differentiated 3T3-L1 cells. [score:5]
Zerumbone acts as a miR-146b inhibitor, increasing SIRT1 expression followed by deacetylation of FOXO1 and PGC1-α. [score:5]
To investigate the mechanisms by which the downregulation of miR-146b by zerumbone affects SIRT1 and the adipogenic response, we measured the SIRT1 mRNA expression and protein levels in the zerumbone -treated or miR-146b inhibitor -treated 3T3-L1 cells. [score:4]
Previously, we demonstrated that inhibition of miR-146b alleviates diet -induced obesity through SIRT1 regulation. [score:4]
Anti-adipogenic effect of zerumbone is dependent on SIRT1, a direct target of miR-146b. [score:4]
Interestingly, zerumbone treatment effectively reversed the dysregulation of miR-146b expression in WAT from HF and in differentiated 3T3-L1 cells. [score:4]
The 10 most upregulated miRNAs were miR-146b, miR-297b, miR-34a, miR-469, miR-139-3p, miR-21, miR-466E-5p, miR22*, miR-324, and miR-143. [score:4]
In addition, we previously reported that miR-146b promotes adipogenesis and obesity by downregulating SIRT1 [25]. [score:4]
Zerumbone also ameliorated dysregulated miRNA profiles in obese WAT tissues and in mature 3T3-L1 cells, with the most prominent change observed in the expression of miR-146b. [score:4]
Zerumbone induced AMPK phosphorylation and decreased adiposity-related upregulation of miR-146b. [score:4]
miR-146b exhibited the highest upregulation, with a 3.39-fold increase in the WAT of HF mice and an 8.12-fold increase in differentiated 3T3-L1 cells. [score:4]
To evaluate the effect of zerumbone on miR-146b expression, we treated fully differentiated 3T3-L1 cells with zerumbone or miR-146b inhibitor. [score:3]
B. Effect of zerumbone on increased miR-146b expression evoked by treatment with the miR-146b mimic. [score:3]
3T3-L1 cells were differentiated in the presence of zerumbone (10 μM) or miR-146b inhibitor (10 nM). [score:3]
The miR-146b inhibits metastasis in glioma [51] and breast cancer cells [52], rescues hypoxia -induced apoptosis in cardiomyocytes [53], and ameliorates retinal inflammation in diabetes [54]. [score:3]
In this study, we observed a decrease in miR-146b levels and a subsequent increase in SIRT1 expression in zerumbone -treated 3T3-L1 cells. [score:3]
To further investigate the mechanism by which zerumbone regulates the miR-146b/SIRT1 axis to reduce obesity and adipogenesis, we analyzed its effect on the acetylation of FOXO1 and PGC1-α, two downstream targets of SIRT1. [score:2]
These results suggest that zerumbone is a negative regulator of miR-146b in WAT from obese mice and in differentiated adipocytes. [score:2]
Previously, we reported that miR-146b acts as a negative regulator of SIRT1 during adipogenesis [25]. [score:2]
However, chemicals from natural sources that could downregulate miR-146b were not investigated. [score:2]
3T3-L1 cells were incubated in the presence of or miR-146b activator (10 nM) or zerumbone (10 μM) at day 3 for 48 h. * P < 0.05 versus control. [score:1]
In this study, we attempted to identify a new compound involved in the miR-146b/SIRT1 pathway, and found that zerumbone is a candidate for prevention of obesity. [score:1]
C. Effect of zerumbone on binding of miR-146b to the 3′-UTR of SIRT1 in 3T3-L1 cells. [score:1]
The miR-146b has been reported to serve as a prognostic marker for non-small lung cancer [50]. [score:1]
Proposed mechanism through which zerumbone improves diet -induced adiposity in WAT via the AMPK and miR-146b/SIRT1 pathways. [score:1]
[1 to 20 of 38 sentences]
6
[+] score: 136
In thyroid cancer, miR-146b-5p was highly expressed and inhibited Smad4 gene expression, which favored the resistance of tumors to a TGF-β inhibitory signal [41]. [score:9]
At 6 h, 40 miRNAs were upregulated (such as miR-146b-5p, miR-27b-3p and let-7f-5p) and 20 were downregulated (such as miR-127-5p, miR-3094-3p and miR-30c-1-3p) (Figure 3B; Table 1). [score:7]
After bioinformatics analysis, we confirmed the concomitant upregulation of miR-146b-5p and downregulation of Smad4 during this biological event. [score:7]
At 18 h, 71 miRNAs were upregulated (such as miR-3061-3p, miR-466c-5p and miR-146b-5p), and 32 were downregulated (such as miR-3071-5p, miR-34c-3p and miR-1899) (Figure 3A). [score:7]
Based on the findings of Zhao et al. where BMP-2 inhibited cementoblastogenesis [17], one possible role is that the tensile stress could enhance cementoblastogenesis by suppressing the inhibitory effect of BMP-2 by enhancing miR-146b-5p and, thus, reducing Smad4. [score:7]
miR-146b-5p may be involved in a complex network of gene expression regulation that could tissue- and stage -dependently target different mRNA species in each circumstance [41]. [score:6]
Instead, we showed that miR-146b-5p could be significantly upregulated during tensile stress -induced cementoblastogenesis and caused the expression of the Smad4 gene. [score:6]
Furthermore, miR-146b-5p overexpression has been shown to promote migration and invasiveness through the downregulation of ZNRF3 through the modulation of the Wnt/β-catenin signaling pathway [44]. [score:6]
Li Y. Wang Y. Yu L. Sun C. Cheng D. Yu S. Wang Q. Yan Y. Kang C. Jin S. mir-146b-5p inhibits glioma migration and invasion by targeting mmp16 Cancer Lett. [score:5]
Lin F. Wang X. Jie Z. Hong X. Li X. Wang M. Yu Y. Inhibitory effects of mir-146b-5p on cell migration and invasion of pancreatic cancer by targeting MMP16 J. Huazhong Univ. [score:5]
To further confirm the microarray results, we performed qRT-PCR to examine the time -dependent expression levels of miR-146b-5p and its predicted target gene Smad4 in the stretched group. [score:5]
In our experiments, our validation process did not show a direct target of miR-146b-5p to the Wnt/β-catenin signaling pathway. [score:4]
Furthermore, the co-transfection of pmirGLO-Smad4-WT with miR-146b-5p inhibitor (WT + inhibitor) resulted in a significant increase in the relative luciferase activity compared with the negative (WT + N2) or blank controls (WT) (p < 0.05; Figure 4C). [score:4]
In recent years, many studies have shown the expression of miR-146b-5p in the development and progression of different tumors, such as papillary thyroid carcinoma [40, 41], glioma [42], pancreatic cancer [43] and osteosarcoma [44]. [score:4]
Xu et al. [44] found that miR-146b-5p was highly expressed in human osteosarcoma tissues, and it contributing to chemoresistance of osteosarcoma. [score:3]
In contrast, co-transfection of pmirGLO-Smad4-MUT with miR-146b-5p mimics or inhibitor showed no statistically-significant changes in the relative luciferase activity (p > 0.05; Figure 4C). [score:3]
Deng X. Wu B. Xiao K. Kang J. Xie J. Zhang X. Fan Y. mir-146b-5p promotes metastasis and induces epithelial-mesenchymal transition in thyroid cancer by targeting ZNRF3 Cell. [score:3]
Xu E. Zhao J. Ma J. Wang C. Zhang C. Jiang H. Cheng J. Gao R. Zhou X. mir-146b-5p promotes invasion and metastasis contributing to chemoresistance in osteosarcoma by targeting zinc and ring finger 3 Oncol. [score:3]
According to the microarray and bioinformatic analysis, the selected miRNA of miR-146b-5p and its predicted target gene Smad4 were used for real-time reverse transcription polymerase chain reaction (RT-PCR) validation using the method described in Section 4.4. [score:3]
Our data suggest a potential role of miR-146b-5p and its target Smad4 in this biological event. [score:3]
The miR-146b-5p mimic inhibitor used in the present study was synthesized and provided by GenePharm (Table 4). [score:3]
Taken together, these results suggest that Smad4 would be the target gene of miR-146b-5p. [score:3]
Similarly, the contrasting roles could be attributed to the different targets of miR-146b-5p in different cell types. [score:3]
Based on the target prediction programs, we found the 3′ UTR of Smad4 possesses a 7-nt match site to the miR-146b-5p seed region (Figure 4A). [score:3]
Furthermore, we confirmed that the Smad4 3′ UTR was the direct target of miR-146b-5p using a dual-luciferase reporter assay (Figure 4C). [score:3]
The exact role of the miR-146b-5p/Smad4 post-translational modulation mechanisms in the tensile stress -induced cementoblastogenesis requires clarification. [score:3]
Taken together, these results suggested an important involvement of miR-146b-5p and its target gene Smad4 in the cementoblastogenesis of mature cementoblasts. [score:3]
The direct binding of miR-146b-5p to the three prime untranslated region (3′ UTR) of Smad4 was established using a dual-luciferase reporter assay. [score:3]
A synthetic fragment of the Smad4 3′ UTR containing the putative binding site for miR-146b-5p or the mutant site was inserted between the XhoI and Sac I cleavage sites of the pmirGLO reporter vector (Promega, Madison, WI, USA) downstream of the firefly luciferase reporter gene (luc2) to construct the recombinant reporter vectors pmirGLO-Smad4 3′ UTR-wild type (pmirGLO-Smad4-WT) and pmirGLO-Smad4 3′ UTR-mutation (pmirGLO-Smad4-MUT) (Figure 4B). [score:2]
Based on these results, we hypothesized that Smad4 3′ UTR mRNA was a potential target gene of miR-146b-5p and selected miR-146b-5p as the focus of further investigation. [score:1]
We found that the Smad4 3′ UTR possessed a 7-nt seed match site for the screening-identified miR-146b-5p (Figure 4A). [score:1]
A Smad4 3′ UTR segment containing the predicted miR-146b-5p binding site was cloned into the pGL3-control vector (Promega) downstream of the firefly luciferase gene after which the 3′ UTR luciferase reporter was obtained. [score:1]
Further studies should be performed to identify not only this aspect, but also the molecular link between tensile stress and the miR-146b-5p/Smad4 axis. [score:1]
When considering the promoting effect of BMP-7 and TGF-β on cementoblastogenesis, the miR-146b-5p/Smad4 axis could also be a negative feedback to tensile stress -induced cementoblastogenesis. [score:1]
Our study is the first study to suggest a potential role of miR-146b-5p/Smad4 in tensile stress -induced cementoblastogenesis. [score:1]
One limitation of this study is the final identification of the role of the miR-146b-5p/Smad4 axis in tensile stress -induced cementoblastogenesis. [score:1]
The sequences for Smad4 3′ UTR-WT and Smad4 3′ UTR-MUT are listed in Table 4. The mimic was synthesized according to the sequence of miR-146b-5p. [score:1]
The primers used for the real-time PCR analysis are presented in Table 3. A luciferase assay was performed to validate that Smad4 was a target gene of miR-146b-5p in tensile stress-stimulated OCCM-30 cells. [score:1]
Dual-Luciferase Reporter Assay of Direct Binding of miR-146b-5p on the 3′ UTR of Smad4. [score:1]
[1 to 20 of 39 sentences]
7
[+] score: 120
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-155, mmu-mir-1298
Indeed, gene expression analyses using qRT-PCR demonstrated co -expression of miRNA-146b and NCOA4 in colons of C. difficile-infected mice and a negative correlation between expression of miR-146b and its target NCOA4 along with increasing doses of C. difficile, suggesting a potential inhibition of NCOA4 by miR-146b resulting in suppressed PPARγ activity, as measured by suppressed expression of PPAR γ-responsive genes (i. e., CD36 and Glut4) in C. difficile-infected mice. [score:15]
Knowing that miRNA can induce a significant degradation of its target and assuming that evolution progressively selected inverse regulation of expression of mRNAs and their specific miRNAs, we selected nuclear receptor coactivator 4 (NCOA4), a miR-146b target for differential expression testing using qRT-PCR between mice uninfected or mice infected with 107 cfu of C. difficile. [score:10]
Our computational simulation predicts an upregulation of miR-146b, and IL-17 and a down-regulation of NCOA4 and PPARγ in colons of mice after infection with C. difficile (Figure 4B). [score:7]
Our data suggests that overexpression of miRNA-146b in the colon might exacerbate inflammatory responses by suppressing PPARγ activity through a mechanism possibly involving suppression of NCOA4, a co-activator molecule required for activation of PPARγ. [score:7]
Effect of Clostridium difficile infection on the colonic expression of miR-146b and target genes NCOA4, CD36 and GLUT4 mRNA in mice. [score:5]
In order to begin to validate such prediction, co -expression of miRNA-146b and NCOA4 within the colon and differential expression of NCOA4 with increasing doses of infection was assessed by RT-PCR. [score:5]
Potential targets for miR-146b and the regulatory pathways that are expected to be regulated were identified in the literature [42]. [score:5]
0047525.g003 Figure 3Effect of Clostridium difficile infection on the colonic expression of miR-146b and target genes NCOA4, CD36 and GLUT4 mRNA in mice. [score:5]
Functional correlation between the expression of miR-146b and some of its potential targets. [score:5]
Our data showed an upregulation of miR-146b correlating with the dose of C. difficile infection. [score:4]
Also, future studies should examine more direct therapeutic approaches to prevent overexpression of miRNA-146 during CDAD. [score:4]
We focused our efforts on the miRNA-146 family (miRNA-146a/b) in this study since we validated its upregulation in the colon of C. difficile-infected mice by using RT-PCR. [score:4]
In silico simulations show how increasing concentrations of C. difficile increase miRNA-146b levels, thus decreasing NCOA4 and PPAR γ. In line with the experimental data, IL-17 expression also increases with the infection. [score:3]
Three miRNAs were significantly overexpressed within infection: miR-146b, miR-1940, and miR-1298 (FDR P<0.05) (Figure S3). [score:3]
Two small nucleolar RNAs, snoRNA202 and snoRNA234, were used as endogenous normalizers for target miR-146b*. [score:3]
In addition, miRNA-146 is expressed in leukocytes and its function is clearly linked to innate immunity and inflammation [50], [51]. [score:3]
Colonic expression of miRNA-146b (A) as well as NCOA4 (B), CD36 (C) and GLUT4 (D) were assessed by real-time quantitative RT-PCR in mice infected with C. difficile (n = 10). [score:3]
Infected mice overexpress miR-146b. [score:3]
Notably, one of the co-activators facilitating the transcriptional activities of the ligand-activated PPARγ, NCOA4, was a predicted target of miRNA-146b. [score:3]
NCOA4 was computationally predicted as a target of miRNA-146b based on thermodynamics. [score:3]
By comparing miRNA profiles from C. difficile-infected and uninfected mice, we found that miR-146b, miR-1940, and miR-1298 were overexpressed in colons of C. difficile-infected mice. [score:3]
To further understand the role of miRNA-146b during C. difficile infection, a list of mRNA potential targets for such miRNA was retrieved from miRBase [40]. [score:3]
The computational simulations predicted an overexpression of miR-146b following C. difficle infection, resulting in decreased concentrations of NCOA4, which in turn failed to activate PPARγ. [score:3]
Mmu-miR-146b* expression was analyzed with quantitative RT-PCR using TaqMan MicroRNA Assays from Applied Biosystems. [score:2]
Specifically, we applied mathematical and computational mo deling approaches in combination with mouse challenge studies to study the mechanisms underlying the interactions between PPARγ activity and miRNA-146b to regulate colitis during C. difficile infection. [score:2]
miRNA-146 regulatory circuit improves TLR4 and cytokine signaling in response to microbial components and proinflammatory cytokines [52], [53]. [score:2]
We constructed a network mo del with five dynamic variables representing miR-146b, NCOA4, PPARγ, interleukin 17 (IL-17) and IL-10, plus an external input: the infectious dose of C. difficile. [score:1]
We constructed a network mo del with five dynamical variables representing miR-146b, NCOA4, PPARγ, IL-17 and IL-10, plus an external input: the infectious dose of C. difficile. [score:1]
To further integrate and characterize the potential interactions occurring between C. difficile, miR-146b and PPARγ, we developed a computational and mathematical mo del of the colonic gene expression changes occurring in the colon following C difficile infection. [score:1]
The mo del represents the interaction between C. difficile, miRNA-146, nuclear receptor coactivator 4 (NCOA4), peroxisome proliferator-activated receptor γ (PPAR γ), interleukin 10 (IL-10) and interleukin 17 (IL-17) in Systems Biology Markup Language format. [score:1]
In silico simulations of the involvement of miRNA-146b and PPARγ in modulating colonic host responses to C. difficile infection. [score:1]
[1 to 20 of 31 sentences]
8
[+] score: 114
Coexpression of miR-146b-3p mimic, but neither miR-146b-5p mimic nor negative control (NC), significantly suppressed the GLuc luciferase reporter activity of the linked 3′-UTR, indicating that miR-146b-3p suppresses ADA2 expression through miRNA binding [20] sequences in its 3′-UTR (Figure 2(b)). [score:9]
Together, these results suggest that miR-146b-3p suppresses ADA2 expression by binding to the 3′-UTR and that ADA2 is a direct target of miR-146b-3p. [score:8]
We hypothesize that as a negative regulator of ADA2, miR-146b-3p expression may be inversely associated with ADA2 expression or activity and the status of inflammation. [score:6]
The result also shows that miR-146b-3p expression levels were downregulated in the diabetic samples after normalizing with housekeeping HsRNU6. [score:6]
ADA2 expression and TNF- α release were both significantly increased after AGA treatment (Figure 4), whereas expression of miR-146b-3p was significantly decreased after AGA treatment (Figure 4). [score:5]
Our results confirm the hypothesis that miR-146b-3p binds to ADA2 3′-UTR and inhibit its expression and activity. [score:5]
In addition, miR-146b-5p, an miRNA regulated by variable globular adiponectin concentrations and acting as an inhibitor of NF κB-, but not ADA2 -mediated inflammation, is decreased in circulating monocytes of obese subjects with type 2 diabetes [15]. [score:4]
We hypothesize that increased ADA2 production might result from the downregulation of miR-146b-3p. [score:4]
ADA2 Is a Direct Target of miR-146b-3p. [score:4]
To determine whether miR-146-3p is dysregulated in diabetes, we first determined the effect of miR-146b-3p overexpression in PMA-differentiated U937 monocytes. [score:4]
miR-146b-5p and miR-146b-3p are two isoforms from the same gene in human chromosome 10 with different sequences and for the regulation of different gene expression. [score:4]
miR-146b-5p, an miRNA regulated by variable globular adiponectin concentrations and acting as an inhibitor of NF κB -mediated inflammation, is decreased in circulating monocytes of obese subjects with type 2 diabetes [15, 20]. [score:4]
These results suggest a role of miR-146b-3p in the regulation of retinal inflammation in diabetes by suppressing ADA2. [score:4]
It is likely that, in addition to ADA2, there are other genes that are upregulated by miR-146b-3p silencing in diabetes. [score:4]
We identified a role of miR-146b-3p in the regulation of retinal inflammation in diabetes by suppressing ADA2. [score:4]
In contrast to the well-studied miR-146b-5p, the targets of miR-146b-3p involved in diabetes are not well studied. [score:3]
The increased ADA2 activity is also associated with decreased expression of miR-146b-3p in diabetes. [score:3]
Database searches of the TargetScan sites showed that human ADA2 mRNAs have conserved miR-146b-3p recognition sites (Figure 2(a)). [score:3]
We then determined ADA2 activity and miR-146b-3p expression in the vitreous of human donor eyes with (n = 8) and without diabetes (n = 4). [score:3]
RNA was extracted from the treated cells, and expression levels of ADA2 and miR-146b-3p were determined by quantitative (q) RT-PCR. [score:3]
miR-146b-3p may serve as a therapeutic target for early detection and intervention of DR. [score:3]
In the current study, we demonstrate that ADA2 is one of the targets of miR-146-3p. [score:3]
Moreover, ectopic expression of miR-146b-3p decreases the ADA2 activity and TNF- α release in PMA-differentiated U937 monocytes. [score:3]
Taken together, these results suggest that an inverse correlation between miR-146b-3p and inflammation occurs in diabetes and that reduction or dysregulation of miR-146-3p may contribute to diabetic complications. [score:2]
In contrast to miR-146b-5p, genes that are negatively regulated by miR-146b-3p in diabetes have not been identified. [score:2]
3.3. miR-146b-3p Is Dysregulated in Diabetes. [score:2]
An aliquot of 10 [6] U937 cells were pelleted and resuspended in 100  μL electroporation buffer (VCA-1004) containing negative control (NC), miR-146-5p mimic, or miR-146b-3p mimic at a final concentration of 100 nM. [score:1]
Luciferase reporter analysis shows that luciferase activity decreases with cotransfection of miR-146b-3p but not NC or miR-146b-5p. [score:1]
3.4. miR-146b-3p Is Inversely Associated with ADA2 in Diabetes. [score:1]
For miR-146b-3p and miR-146b-5p quantitation, total RNA isolated from cells or vitreous were reverse-transcribed into cDNA using miScript reagents (Qiagen). [score:1]
Evaluation of the cell lysates showed that the miR-146b-3p -transfected cells exhibited reduced ADA2 expression, activity, and TNF- α release (Figure 3). [score:1]
Cells were cotransfected with 100 nM miR-146b-3p mimic, miR-146b-5p mimic, or NC and 1  μg of pEZX-MT05 with or without the 3′-UTR of the human ADA2 gene. [score:1]
PMA -treated cells were transfected with nucleofector technology with negative control (NC), miR-146b-3p mimic, and exposed to AGA. [score:1]
To test this hypothesis, we measured the miR-146b-3p level, ADA2 expression, and tumor necrosis factor (TNF)- α release after AGA treatment of PMA-differentiated U937 monocytes. [score:1]
Our bioinformatics analysis showed that ADA2 mRNA has 3′-UTR site which is complimentary to miR-146b-3p. [score:1]
[1 to 20 of 35 sentences]
9
[+] score: 98
In the LT protocol, a downregulation of WDR12, another putative target of mmu-miR-146b, was also observed. [score:6]
Regulation of apoptosis by miRNAs is expected to occur via NF-κB pathway by inducing the degradation or inhibiting the translation of apoptosis-related mRNA as already described for mmu-miR-146b [63]. [score:6]
The potential targets of mmu-miR-146b, the only miRNA being significantly upregulated throughout the experiment, were also identified (Table 5). [score:6]
We also observed that the mRNA potentially targeted by mmu-miR-223 (Arid4b, Lpin2, see Figure 5) and mmu-miR-146b (Zfp451, Klf13 and Tcfcp2l1) did undergo a downregulation at ST. [score:6]
Inverse correlation with the expression of potential mRNA targets identified mmu-miR-146b, -223, -29b, -29c, -483, -574-5p, -672 and -690 as the best candidates for an active implication in asthma pathogenesis. [score:5]
Therefore, mmu-miR-146b probably controls some aspect of cell proliferation and may participate in the development of subepithelial fibrosis in asthma, by regulating NUMB and WDR12 expression in the NOTCH signalling pathway. [score:5]
Constant upregulation of mmu-miR-146b could also influence changes that occur in the complex IGF1 -dependent regulatory cascades. [score:5]
The inhibition of TNFSF9 by mmu-miR-146b could therefore play a central function in the evolution of the disease. [score:5]
This hypothesis is further reinforced by the demonstration that mmu-miR-146b inhibits the expression of CARD10 (see Figure 4H), a molecular scaffold for the assembly of a BCL10 signalling complex that activates NF-κB [73]. [score:5]
For miR-146b, which was up-regulated at the 3 time-points, and for miR-29b and -29c, which are thought to be regulators of extracellular matrix remo delling and are downregulates at IT and LT, increasing concentrations were tested to evaluate the sensitivity and the specificity of the assays (Figure 4). [score:5]
In our mo del, CFLAR, an NF-κB-inducible anti-apoptotic protein which inhibits caspase 8 -mediated apoptosis, is a putative target of mmu-miR-146b and -223. [score:5]
Mmu-miR-146b was the only miRNA consistently upregulated during the entire time-course of the experiment. [score:4]
In our ST protocol, upregulation of mmu-miR-146b and -223 is predicted to repress SCUBE2 and IL-6, factors that are under the control of IL-1β and TNF-α [74], [75], probably through NF-κB activation. [score:4]
Primers were designed for several miRNAs undergoing regulation at, at least, two time-points (such as mmu-miR-146b, -29c…) and for miRNAs selected on the basis of their abundancy (such as mmu-let-7b, mmu-miR-21, -145…), the magnitude of the observed regulations (such as mmu-miR-574-5p, -672…) and the potential significance of their mRNA targets (see below). [score:4]
Similarly, the continuous overexpression of mmu-miR-146b should reduce the synthesis of CLEC4D and TNFSF9. [score:3]
0016509.g004 Figure 4Transient transfection analysis for luciferase reporter expression with mouse Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel A); mouse Mmp-24 3′UTR in the presence and absence of miR-29b and -29c (Panel B); human Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel C); human Mmp-24 3′UTR in the presence of miR-29b and -29c (Panel D); mouse Col6a2 3′UTR in the presence of miR-29c (Panel E); mouse Ctsk 3′UTR in the presence of miR-29c (Panel F); mouse Scube2 3′UTR in the presence of miR-146b (Panel G); mouse Card10 3′UTR in the presence of miR-146b (Panel H). [score:3]
Transient transfection analysis for luciferase reporter expression with mouse Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel A); mouse Mmp-24 3′UTR in the presence and absence of miR-29b and -29c (Panel B); human Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel C); human Mmp-24 3′UTR in the presence of miR-29b and -29c (Panel D); mouse Col6a2 3′UTR in the presence of miR-29c (Panel E); mouse Ctsk 3′UTR in the presence of miR-29c (Panel F); mouse Scube2 3′UTR in the presence of miR-146b (Panel G); mouse Card10 3′UTR in the presence of miR-146b (Panel H). [score:3]
A statistically significant inverse correlation has been observed with increased mmu-miR-146b and -483 expressions. [score:3]
Predicted mRNA targets of mmu-miR-146b at the 3 time-points. [score:3]
Production of TNFSF9 could be under the control of mmu-miR-146b, thus regulating the T helper cells properties. [score:2]
Taganov et al. [63] showed that miR-146 regulatory circuit fine-tunes TLR and cytokine signalling, rather than totally abrogating the signal, in response to microbial components and proinflammatory cytokines. [score:2]
Some miRNAs underwent a significant modulation (≥1.5-fold, p-value <0.01) at two time-points but only one, mmu-miR-146b, was consistently upregulated at the three investigated time-points (Table 3). [score:2]
MiR-146b is expressed by leukocytes and its function is clearly associated with inflammation and innate immunity [33], [62]. [score:2]
Among the 17 others miRNA-mRNA pairs that were evaluated (Figure 4E-H and Figure 5), significant inhibition was observed in 10 experimental conditions (miR-29c and Ctsk; miR-146b and Scube2; miR-483 and Nola2 or Ube2c; miR-672 and Phb2; miR-223 and Il6 or Lpin2 or Arid4b; miR-690 Fst or Ctse). [score:1]
Another aspect of cell function appeared to be modulated by mmu-miR-146b. [score:1]
MiR-146 is also associated with inflammation and innate immune responses where it regulates the response to a variety of microbial components and proinflammatory cytokines [63]. [score:1]
In silico analysis have also pointed significant correlations between miRNA (mmu-miR-146b, -223 and -690) and modulations of mRNAs related to apoptosis processes. [score:1]
[1 to 20 of 27 sentences]
10
[+] score: 79
Putative targets of nine differentially expressed miRNAs that were validated by RT-qPCR (upregulated: mmu-miR-151-3p, mmu-miR-155-5p, mmu-miR-181a-5p, and mmu-miR-328-3p; and downregulated: mmu-miR-21a-5p, mmu-miR-98-5p, mmu-miR-145a-5p, mmu-miR-146b-5p, and mmu-miR-374b-5p) were obtained from the miRWalk database. [score:11]
MyD88 Plays an Important Role in Regulating the Expression of miRNAs During B. abortus InfectionSince innate immunity is the first line of host immune defense against bacterial pathogens and our group has previously demonstrated the important role of MyD88 adaptor molecule during B. abortus infection (25), we evaluated the influence of MyD88 during differential expression of miRNAs upregulated (mmu-miR-181a-5p and mmu-miR-328-3p) or downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, and mmu-miR-146b-5p) by infection. [score:10]
Differential expression of validated upregulated miRNAs (A) mmu-miR-181a-5p and (B) mmu-miR-328-3p or validated downregulated miRNAs (C) mmu-miR-21a-5p, (D) mmu-miR-98-5p, and (E) mmu-miR-146b-5p were assessed by real-time PCR and normalized to SNORD61 in bone marrow-derived macrophages from C57BL/6 and MyD88 KO mice. [score:9]
According to the expression levels and fold-change comparing Brucella-infected versus NI libraries, we selected four miRNAs that were upregulated (mmu-miR-151-3p, mmu-miR-155-5p, mmu-miR-181a-5p, and mmu-miR-328-3p) and five miRNAs that were downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, mmu-miR-145a-5p, mmu-miR-146b-5p, and mmu-miR-374b-5p) for validation and further analysis. [score:9]
Validated upregulated miRNAs (F) mmu-miR-181a-5p and (G) mmu-miR-328-3p or validated downregulated miRNAs (H) mmu-miR-21a-5p, (I) mmu-miR-98-5p, and (J) mmu-miR-146b-5p were also assessed by real-time PCR in spleens from C57BL/6 and MyD88 KO mice. [score:7]
For further validation, we chose four upregulated (mmu-miR-151-3p, mmu-miR-155-5p, mmu-miR-181a-5p, and mmu-miR-328-3p) and five downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, mmu-miR-145a-5p, mmu-miR-146b-5p, and mmu-miR-374b-5p) miRNAs (Table S6 in) in infected samples by real-time PCR in macrophages. [score:7]
miR-145a-3p and miR-146b-5p were upregulated in B. melitensis-infected Raw264.7 cells and downregulated in B. abortus-infected BMDMs. [score:7]
Since innate immunity is the first line of host immune defense against bacterial pathogens and our group has previously demonstrated the important role of MyD88 adaptor molecule during B. abortus infection (25), we evaluated the influence of MyD88 during differential expression of miRNAs upregulated (mmu-miR-181a-5p and mmu-miR-328-3p) or downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, and mmu-miR-146b-5p) by infection. [score:7]
On the other hand, we observed a dependence of MyD88 for the downregulation of mmu-miR-21a-5p, mmu-miR-98-5p, and mmu-miR-146b-5p during B. abortus infection in macrophages. [score:4]
By contrast, five miRNAs were validated as downregulated: (E) mmu-miR-21a-5p, (F) mmu-miR-98-5p, (G) mmu-miR-145a-3p, (H) mmu-miR-146b-5p, and (I) mmu-miR-374b-5p. [score:4]
Among these 57, 3 miRNAs (miR-145a-3p, miR-146b-5p, and miR-151a-3p) were also identified as differentially expressed in our study. [score:3]
C57BL/6 mice were infected intraperitoneally at 1, 3, or 6 days post-infection, and the relative expression of miRNAs: (A) mmu-miR-151-3p, (B) mmu-miR-155-5p, (C) mmu-miR-181a-5p, (D) mmu-miR-328-3p, (E) mmu-miR-21a-5p, (F) mmu-miR-98-5p, (G) mmu-miR-145a-3p, (H) mmu-miR-146b-5p, and (I) mmu-miR-374b-5p were evaluated in mouse spleens. [score:1]
[1 to 20 of 12 sentences]
11
[+] score: 68
miR-21 was also reported to be up-regulated in squamous cell carcinoma [55] while miR-127, miR-322 and miR-146b are up-regulated during fetal lung development [56], [57]. [score:8]
Importantly, miR-21 over -expression is largely associated with tumor development [49] while miR-146b over -expression was reported for the human lung cancer cell line A549 [50] and in T-cells from patients with severe asthma [51]. [score:6]
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic lung and human lung cancer therefore demonstrating clinical relevance of this particular disease mo del. [score:6]
Moreover, miR-146a and miR-146b have been shown to play a central role in the negative feedback regulation of IL-1b -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [52], [53]. [score:5]
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic mouse lung and human lung cancer thus further validating this mo del as relevant for human lung cancer (Figure 7). [score:4]
Differential miRNA expression was examined by quantitative real time PCR (qRT-PCR) of the eight regulated miRNAs (miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322, miR-433). [score:4]
With the Agilent platform significant up-regulation of, miR-21, miR-184 and miR-146b (borderline significant in male, Table 1) in male and female transgenic animals was observed, although at different levels in the two sexes. [score:4]
Specifically, with the Agilent platform a significant regulation of miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322 was observed whereas for the Affymetrix platform significant regulation of miR-127 and miR-433 could only be evidenced. [score:3]
Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
0078870.g002 Figure 2 Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
0078870.g005 Figure 5The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
Of these five were also significantly regulated in c-Raf transgenic lungs as summarized in Table 4. Moreover, hierarchical clustering depicted in Figure 6 points to a co-regulation of miR-21 and miR-146b. [score:3]
0078870.g006 Figure 6Hierarchical gene cluster analysis evidences co-regulation of miR-21 and miR-146b during organogenesis and in lung cancer. [score:2]
In contrast, the miR-21 and miR-146b were found as significantly regulated on the and by qRT-PCR but not with the Affymetrix platform. [score:2]
The hierarchical clustering depicted in Figure 6 points to a co-regulation of miR-21 and miR-146b. [score:2]
Hierarchical gene cluster analysis evidences co-regulation of miR-21 and miR-146b during organogenesis and in lung cancer. [score:2]
Only the Agilent data for miR-184 and miR-146b, as well as for miR-21 (here female mice), were confirmed by the qPCR. [score:1]
We also analyzed miR-182, whose gene is in proximity to that of miR-96 and miR-183, and miR-146a which differs from miR-146b by only two bases (Table 2). [score:1]
3) 55.6 AACCCATGGAATTCAGTTCTCA −26.0 59.5 −20 54.0 mmu-miR-146b UGAGAACUGAAUUCCAUAGGCU 40 AGCCTATGGAATTCAGTT(C) (−21.5) 41.5 AGCCTATGGAATTCAGTTCTCA −26.2 47.4 −20.2 39.2 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG 48 CGGTGTGAGTTCTAC(C) (−19.9) 62.9 CGGTGTGAGTTCTACCATTGCCAAA −31.9 62.9 −17 58.8 mmu-miR-183 UAUGGCACUGGUAGAAUUCACU 40 AGTGAATTCTACCAGTGC(C) (−23.2) 44.7 AGTGAATTCTACCAGTGCCATA −26.3 46.3 −20.3 40.0 mmu-miR-184 UGGACGGAGAACUGAUAAGGGU 50 ACCCTTATCAGTTCTCCGTCC(A) (−31.9) 57.0 ACCCTTATCAGTTCTCCGTCCA −31.9 57.0 −30.3 56.2 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA 40 TCCAAAACATGAATTGCTGCTG −23.1 37.7 TCCAAAACATGAATTGCTGCTG −23.1 37.7 mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU 54 ACACCGAGGAGCC(C) (−20. [score:1]
Similarly, miR-146a differs by only one base from miR-146b and therefore was analyzed as well while miR-15a and miR-34a were included in the assay for not being regulated in c-Raf transgenic mice and thus served as controls. [score:1]
Prefabricated TaqMan MicroRNA Assays (containing microRNA-specific forward and reverse PCR primers and microRNA-specific Taqman MGB probe) were used to determine expression of miR-21 (ABI P/N 000397), miR-146b-5p (ABI P/N001097), miR-127 (ABI P/N000452), miR-433-3p (ABI P/N001028), miR-322 (ABI P/N001076), miR-184-3p (ABI P/N000485), miR-183 (ABI P/N002269), miR-96 (ABI P/N000186), miR-15a-5p (ABI P/N000389), miR-34a-5p (ABI P/N000426), miR-146a-5p (ABI P/N000468) and miR-182-5p (ABI P/N002599). [score:1]
[1 to 20 of 22 sentences]
12
[+] score: 58
Both miR-146b, which has previously been shown to be up-regulated in macrophages and miR-455 were also up-regulated in this experiment, however their p values were 0.16 and 0.10 respectively. [score:7]
We show here that miR-155, miR-146a, miR-146b, miR-125a and miR-455 can be up-regulated by the TLR4 agonist LPS as well as by heat killed C. albicans which most likely signals via a combination of TLRs and the C-type lectin dectin-1 [24], [25]. [score:4]
Heat killed C. albicans also caused a modest up-regulation of miR-125a, mirR-146a and miR-146b (Fig. 2A). [score:4]
Both the LPS and heat killed C. albicans stimulated transcription of pri-miR-155, pri-miR-455, pri-miR-146a and pri-miR-125a as well as the LPS induced transcription of pri-miR-146b were reduced by pretreatment with the IKKβ inhibitors, suggesting that IKKβ plays a critical role in the induction of these miRNAs (Fig. 7A and B). [score:3]
LPS induced pri-miR-146b expression was however slightly reduced by SB203580 and greatly reduced by PD184352 (Fig. 6A). [score:3]
The transcription of miR-455 and miR-125a has not previously been studied in immune cells, while miR-146 has been reported to be an NFκB target gene. [score:3]
miR-146 and miR-155 are reported to target proteins that are involved in inflammatory signaling, including IRAK1, Traf6 and Myd88, which would suggest that these miRNAs serve to limit the inflammatory capacity of the macrophages. [score:3]
For instance, miR-146 can target IRAK1 and Traf6, key components in linking TLRs to their downstream signaling cascades [6], [8], as well as STAT1 and IRF5, transcription factors implicated in pro-inflammatory cytokine production [9]. [score:3]
However, for pri-miR-125a and pri-miR-146b the situation is less clear, as IKKβ is involved in the activation of ERK1/2 in response to LPS, and induction of these miRNAs is reduced by inhibitors of the ERK1/2 pathway (Fig. 6). [score:3]
Effect of MAPK inhibitors on the transcription of miR-155, miR-455, miR-146 and miR-125a. [score:3]
Effect of IKKβ inhibitors on the transcription of miR-155, miR-455, miR-146 and miR-125a. [score:3]
To extend the results from the array experiment, the transcriptional regulation of miR-125-5p and 3p, miR-155, miR-146a, miR-146b and miR-455 by either heat killed C. albicans or LPS was examined using Taqman qPCR based methods, in samples from BMDMs generated independently from those used for the array studies. [score:2]
Stimulation of BMDMs with LPS resulted in a gradual increase over 24 h in the levels of mature miR-125a-3p and 5p, miR,-146a, mir-146b and miR-155 following LPS stimulation (Fig. 1A). [score:1]
miR-146b is located in the 1 [st] intron downstream of the distal 1 [st] exon (Fig. 3A). [score:1]
miR-155 is located in the exon of the non-protein coding BIC gene, while miR-146b and miR-455 are encoded in the introns of Tmem180 and Col27a1 respectively. [score:1]
A) BMDMs were stimulated with either 100 ng/ml IL-10, 100 ng/ml LPS or a combination of both IL-10 and LPS for 1 or 6 h. Total RNA was isolated, and the levels of pri-miR-155, pri-miR-455, pri-miR-146a, pri-miR-146b, pri-miR-125a were determined by Q-PCR. [score:1]
0013669.g002 Figure 2Heat killed Candida albicans stimulates the transcription of miR-155, miR-455, miR-146 and miR-125a. [score:1]
Of the miRNAs tested, IL-10 alone was able to induce pri-miR-125a, pri-miR-146a and pri-miR-146b, however there was no synergy with LPS. [score:1]
Both pri-miR-146a and pri-miR-146b could be induced by IL-10 alone, however there was no major synergistic effect with LPS (Fig. 8A). [score:1]
The induction of miR-155, miR-146a and miR-146b has been shown previously in response to viral and bacterial mimics that stimulate via a variety of TLRs [6], [7], [8], [10], [11], however this is the first study to look at their induction by fungal ligands. [score:1]
miR-146b is potentially located within the Tmem180 gene in mice. [score:1]
Heat killed Candida albicans stimulates the transcription of miR-155, miR-455, miR-146 and miR-125a. [score:1]
More recent reports have however shown that miR-146 can be induced by viral stimuli [7], [8], [9]. [score:1]
LPS stimulates the transcription of miR-155, miR-455, miR-146 and miR-125a. [score:1]
While there was a trend for a small increase in pri-miR-146b, this did not reach statistical significance (p>0.05, 2 tailed students t-test). [score:1]
0013669.g008 Figure 8 A) BMDMs were stimulated with either 100 ng/ml IL-10, 100 ng/ml LPS or a combination of both IL-10 and LPS for 1 or 6 h. Total RNA was isolated, and the levels of pri-miR-155, pri-miR-455, pri-miR-146a, pri-miR-146b, pri-miR-125a were determined by Q-PCR. [score:1]
For both miR-155 and miR-146, their most likely role in macrophages is to act as a negative feedback mechanism to limit inflammatory signaling. [score:1]
miR-146b, mir-155, miR-455 and miR-125a are located in annotated genes. [score:1]
The levels of pri-miR-155, pri-miR-455, pri-miR-146a, pri-miR-146b and pri-miR-125a were determined by Q-PCR. [score:1]
[1 to 20 of 29 sentences]
13
[+] score: 50
Other miRNAs from this paper: mmu-mir-146a, hsa-mir-146a, hsa-mir-146b
Taganov et al. have proposed a mo del of miR-146 negative feedback regulation of NF-κB signaling in which the activated NF-κB pathway leads to induction of miR-146 expression, which targets IRAK1 and TRAF6 and results in the attenuation of NF-κB signaling [31]. [score:6]
These findings are significant and imply that manipulating the function of HSCs by targeting either NF-κB signaling or miR-146 expression may provide a novel method of treating hepatic schistosomiasis. [score:5]
Meanwhile, we found that miR-146b was only up-regulated significantly on day 42 post-infection (Fig. 6B). [score:4]
Furthermore, miR-146 was significantly up-regulated in the livers of mice infected by S. japonicum [21]. [score:4]
Importantly, our data revealed that miR-146 appeared to be an important negative regulator of NF-κB signaling in HSCs, and acts by targeting TRAF6. [score:4]
In addition, we speculate that as the typical granulomas begin to form only on day 42 post-infection, by which time NF-κB signaling has been attenuated, miR-146 appears to be a critical negative regulator of the granulomatous process that operates via targeting NF-κB signaling. [score:4]
Expression levels of miRNA-146 in HSCs in hepatic schistosomiasis. [score:3]
0104323.g006 Figure 6Expression levels of (A) miR-146a and (B) miR-146b in total RNAs detected by real-time PCR, and (C, D) Band pattern and TRAF6 levels in total protein detected the by western blot. [score:3]
Expression levels of (A) miR-146a and (B) miR-146b in total RNAs detected by real-time PCR, and (C, D) Band pattern and TRAF6 levels in total protein detected the by western blot. [score:3]
The expression of ALB, CD31, p65, Ccl2, Ccl3, Ccl5, Cxcl1, Col1α1, α-SMA, miR-146a and miR-146b was determined using the SYBR Green Master Mix kit. [score:3]
We report that HSCs appear to play an important role in linking the process of hepatic granulomatous to hepatic fibrosis via NF-κB signaling, with miR-146 potentially modulating this process by targeting TRAF6, a key adapter molecules in the TLR4/NF-κB pathway. [score:3]
Recent studies have revealed the importance of several miRNAs, especially the miR-146, in the regulation of NF-κB signaling [17]. [score:2]
MiR-146 expression in HSCs post-infection. [score:2]
Studies have shown that miR-146 is a negative regulator of NF-κB signaling through its effects on IRAK1 and TRAF6, two key adapter molecules in the TLR4/NF-κB pathway [31]. [score:2]
Taken together, the results of our study indicate that HSCs play an important role in the progression of hepatic schistosomiasis by linking liver inflammation to fibrosis via NF-κB signaling, and suggest that miR-146 appears to be a critical for regulating this process. [score:2]
[1 to 20 of 15 sentences]
14
[+] score: 45
At 40 weeks of age, the expression of miR-216, miR-217, miR-223, miR-141, miR-483-3p (p-value = 0.031), miR-195, Let-7b (p-value = 0.063) and miR-96 were significantly downregulated; on the other hand, the expression of miR-21, miR-205, miR-146b (p-value = 0.031), and miR-34c (p-value = 0.063) were upregulated in KC mice compared to the control animals (Figure 2C). [score:10]
At 30 weeks of age, the expression of miR-216 (p-value = 0.016), miR-217 (p-value = 0.0078), miR-150 (p-value =0.023), Let-7b (p-value = 0.031,) and miR-96 were significantly downregulated, whereas the expression of miR-146b (p-value = 0.0078), miR-205, (p-value - 0.0078), miR-21, miR-195 (p-value = 0.031), and miR-34c (p-value = 0.063) were significantly upregulated in KC animals compared to control animals (Figure 2B). [score:10]
We have shown that in tumor samples compared to normal samples, the majority of miRNAs (miR-216, miR-217, miR-100, miR-345, miR-141, miR-483-3p, miR-26b, miR-150, Let-7b, Let-195 and miR-96) were downregulated, and few were upregulated (miR-146b, miR-205, miR-31, miR-192, miR-194 21, miR-379, miR-431, miR-541, and miR-199b). [score:6]
The analysis for the KC animals compared to controls revealed that miR-150, miR-494, miR-138, miR-148a*, miR-216a, and miR-217 (p-value = 0.01) were significantly downregulated (Table 1), whereas, miR-146b, miR-205, miR-31, miR-192, and miR-21 (p-value = 0.01) were significantly upregulated (Table 2). [score:6]
We observed downregulation of miR-146b, miR-34c, and miR-223 at 10 weeks of age; however, their expression increased with the progression of PC in KC animals compared to control animals (Figure 2A– 2D). [score:5]
The expressions of miR-216 and miR-217 were also progressively reduced in KC mice, but the expressions of miR-21, miR-205, miR-146b, miR-34c, and miR-223 progressively increased (Figure 1A, 2A– 2D). [score:5]
On the other hand, miR-146b, miR-34c, miR-223, miR-195 (p-value = 0.031) and miR-216 (p-value = 0.063) were downregulated in KC mice compared to control littermates. [score:3]
[1 to 20 of 7 sentences]
15
[+] score: 43
Breast cancer metastasis suppressor 1 up-regulates miR-146, which suppresses breast cancer metastasis. [score:8]
Moreover, under regulation of miR-146, NASH alleviation was achieved after HDMCP downregulation in both in vivo and in vitro, according to the declination of steatosis and inflammation related markers. [score:5]
Regulation of miR-146 on HDMCP expression. [score:4]
MiR-146 was finally chosen for its utmost fold change and the regulation of miR-146 on HDMCP was confirmed by dual luciferase detection. [score:2]
Regulation of miR-146 on HDMCP level. [score:2]
Fourthly, the HDMCP-3’UTR could not fully represent HDMCP, which impaired the deduction of regulator role of miR-146 on HDMCP. [score:2]
NASH severity change was recorded after RNA interference while the regulatory role of miR-146 on HDMCP was confirmed by dual luciferase report system. [score:2]
We previously reported a panel of significantly decreased miRNAs in NASH rat mo del [20], where miR-146, miR-29b and miR-10a were predicted to regulate HDMCP through bioinformatics method (Fig 5A). [score:2]
The regulatory role of miR-146 on HDMCP was tested with dual luciferase report system. [score:2]
Besides, since previous study reported the regulation of FOXP3 on miR-146/ NF-kB negative feedback loop[34], it is worthy studying such pathway in NASH. [score:2]
In summary, we reported a miR-146-HDMCP-downstream effector pathway in NASH, which may provide novel mechanism and treatment option for NASH. [score:1]
Therefore, it would be meaningful to study the effect of miR-146 in fibrosis and cirrhosis stages of NAFLD. [score:1]
Thirdly, the miR-146 mimics were synthesized and cotransfected both BRL-3A and L02 cells with pmirGLO-HDMCP-3’UTR using lipofectamin 2000 (Invitrogen, The USA). [score:1]
The miR-146-HDMCP-ATP/H [2]O [2] pathway may provide novel mechanism and treatment option for NASH. [score:1]
Based on our microarray data of NASH rat mo del [20] and bioinformatics prediction (Fig 5A), we selected miR-146, miR-29b and miR-10ato detect their levels in NASH mo del. [score:1]
Therefore, we investigated the expression level and therapeutic effect of miR-146-HDMCP-ATP/H [2]O [2] pathway in NASH mo del, aiming to provide novel concept for NASH pathogenesis and therapy. [score:1]
In this step, subjects were divided into four groups as followings: blank cell group, pmirGLO-HDMCP-3’UTR group, negative control miRNA+pmirGLO-HDMCP-3’UTR group and miR-146+pmirGLO- HDMCP-3’UTR group. [score:1]
Since miR-146 had the highest degree of declination, we further chose it to test its ability in binding with HDMCP by dual luciferase detection method. [score:1]
MiRNA-146 declination in NASH and its ability in HDMCP regulation. [score:1]
Secondly, only miR-146 was selected in this study for its utmost fold change. [score:1]
These results indicated the capacity of miR-146 in binding with HDMCP and called for further study in the effect of miR-146 in NASH pathogenesis and progress. [score:1]
As shown in Fig 5B, both miR-29b and miR-146 levels were significantly lower in HFFA treated group while miR-10a level was decreased but not reached statistical significance. [score:1]
[1 to 20 of 22 sentences]
16
[+] score: 37
The miR-146 family was initially described as NF-κB target genes through a microarray study to identify miRNAs that were upregulated upon lipopolysaccharide (LPS) stimulation in THP1 cells (Taganov et al., 2006). [score:6]
In non-hematopoietic cells, miR-146a can be upregulated by the transcription factor Snail in colorectal cancer stem cells (Hwang et al., 2014), and miR-146b is directly induced by transcription factor STAT3 in breast epithelial cancer cells (Xiang et al., 2014). [score:5]
NF-kappaB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. [score:5]
The expression of miR-146a or miR-146b has not been as extensively studied in human hematopoietic cells. [score:3]
STAT3 induction of miR-146b forms a feedback loop to inhibit the NF-kappaB to IL-6 signaling axis and STAT3 -driven cancer phenotypes. [score:3]
In contrast, miR-146a and miR-146b expression differs in mature myeloid (Mac1+), erythroid (Ter119+), and lymphoid (CD4+ and CD8+) cells. [score:3]
Three miRNAs, miR-146, miR-155 and miR-132, showed significantly increased expression following LPS simulation. [score:3]
The expression pattern of miR-146a and miR-146b overlaps within certain mouse hematopoietic lineages. [score:3]
MicroRNA-146 represses endothelial activation by inhibiting pro-inflammatory pathways. [score:2]
DISCOVERY OF THE miR-146 FAMILY. [score:1]
There is also a large knowledge gap in the function of miR-146b that shares an identical seed sequence and differs in only two nucleotides within the mature sequence. [score:1]
In humans, miR-146a resides on chromosome 5q33.3 and miR-146b resides on chromosome 10q24.32, while in mice, miR-146a resides on chromosome 11 and miR-146b on chromosome 19. [score:1]
miR-146a and miR-146b are two miRNAs of the same family. [score:1]
[1 to 20 of 13 sentences]
17
[+] score: 30
The expression of miR-146b that was induced both early after induction of mesenchymal stem cell differentiation as well as after reaching a growth arrest in NIH/3T3 fibroblasts, was also significantly up-regulated upon HFD-treatment in wild-type mice as well as mutant animals. [score:6]
Recently it has been shown that miR-146b expression could suppress breast cancer metastasis [26], supporting our finding of its involvement in growth regulation rather than adipogenesis. [score:6]
Among those, were miR-7a, miR-7b, miR-146b, miR-199a and miR-199b* that were regulated at very early time-points after induction of MSCs and show the same direction of up- or down-regulation in the NIH/3T3 mo del. [score:6]
Only miR-146b is found to be moderately up-regulated, and none of the other seven miRNAs is significantly changed in this study. [score:4]
Among those, let-7i, miR-146b, miR-152, miR-155, miR-214*, miR-299 and miR-411 are similarly regulated in differentiating MSCs, whereas miR-421, miR-702 and miR-703 were oppositely regulated in MSCs. [score:3]
Five of these eight miRNAs (miR-199a, miR-7, miR-146b, miR-7b, and miR-199b*) were similarly regulated early during the adipogenesis process of MSCs, indicating that their regulation was due to cell cycle arrest rather than adipogenesis. [score:3]
A direct involvement of miR-146b in adipogenesis has not yet been described to our knowledge. [score:2]
[1 to 20 of 7 sentences]
18
[+] score: 30
Several expression patterns are evident: miR-146 is highest in Th1 cells and low in naïve T cells and Th2 cells; miRNAs 142s and 26a are expressed at higher levels in the precursor naïve T cells; miR-27a is equivalently expressed in both the precursor naïve T cells and the differentiated Th1 and Th2 cells; and miR-223 is very poorly expressed in all these T cell types. [score:9]
miR-146 showed a Th1-skewed expression pattern: it's levels increased in Th1 cells and decreased in Th2 cells relative to it's expression in naïve T cells. [score:5]
For example, T-bet directs Ifnγ expression, and may also activate transcription of pri-miR-146. [score:4]
miR-146 was a clear exception to this pattern, being up-regulated in Th1, but not Th2 cells. [score:4]
miR-146 is also notable, since it is upregulated in Th1, but not Th2 cells. [score:4]
Three very different patterns are observed, exemplified by: miR-146 and 142s, which are expressed at essentially equivalent (low) levels in both the Pu. [score:3]
In this respect, miR-146 joins a group of Th1 -associated genes that include cytokines (Ifnγ, Tnfα), chemokine receptors (Cxcr3, Ccr5), and transcription factors (Tbx21, Hlx) [6, 24, 25]. [score:1]
[1 to 20 of 7 sentences]
19
[+] score: 26
The signaling network summarizing our current and previous results was developed using Cytoscape v3.4.0 [18] to assess interactions between the mRNA results found in TLR4 signaling pathways [7] and the known targets for miR-155-5p, miR-200a-3p, miR-21a-5p, and miR-146b-5p, trying to find the role of those miRNAs on the development of murine lupus-like disease. [score:6]
Interestingly, six of these miRNAs showed similar behavior in the three conditions tested, three of them were downregulated (miR-142a-3p, miR-146b-5p, and miR-155-5p) and three were overregulated (miR-21a-5p, miR-125a-5, and miR-200a-3p). [score:5]
Using the database of the Cancer miRNA Regulatory Network [19] and Cytoscape v3.4.0 [18], a signaling network was developed to find relationships among miR-155-5p, miR-200a-3p, miR-21a-5p, and miR-146b-5p and their own targets, which allowed us to highlight only miR-155-5p and miR-200a-3p of the original four miRNAs selected. [score:4]
Six of them were down- (miR-142a-3p, miR-146b-5p, and miR-155-5p) or upregulated (miR-21a-5p, miR-125a-5p, and miR-200a-3p) in the three lupus-like murine mo dels while the other six were affected in two or only one of them (Figure 2(b)). [score:4]
The other five miRNAs common on the three mo dels (miR-21a-5p, miR-125a-5p, miR-142a-3p, miR-146b-5p, and miR-342-3p) also have important immunological activities (Table 1) that would together favor antibody production and development of the murine disease. [score:4]
The PCR amplification was run as described by the TaqMan Universal PCR Master Mix manual (Applied Biosystems) for the following differentially expressed miRNAs, as determined by PCR array analysis: miR-21a-5p, miR-125a-5p, miR-142-3p/5p, miR-146b/5p, miR-155-5p, and miR-200a-3p. [score:3]
[1 to 20 of 6 sentences]
20
[+] score: 25
MiRNAs significantly dysregulated in the mid-phase of infection (dpi 30), such as mmu-miR-146b and mmu-miR-155, may relate to the regulation of hepatic inflammatory responses, whereas miRNAs exhibiting a peak expression in the late phase of infection (dpi 45), such as mmu-miR-223, mmu-miR-146a/b, mmu-miR-155, mmu-miR-34c, mmu-miR-199, and mmu-miR-134, may represent a molecular signature of the development of schistosomal hepatopathy. [score:6]
The expression of mmu-miR-146b and mmu-miR-155 was continently up-regulated in the late phase of infection, when the SEA -induced hepatic granulomatous pathology associated with fibrosis became more profound [5]. [score:6]
Based on the observation of temporal changes of the cellular composition in the liver of S. japonicum-infected mice [5], the upregulation of mmu-miR-146b and mmu-miR-155 at this time point may reflect the recruitment and activation of B and T lymphocytes to the periphery of granulomas in response to the stimuli of antigens secreted by the eggs. [score:4]
However, several miRNAs, such as mmu-miR-146b, mmu-miR-155, mmu-miR-223, mmu-miR-142-3p, mmu-miR-15b, and mmu-miR-126-5p, were observed to be up-regulated significantly in the mid-phase of infection (30 dpi) (Table 2 and Figure 3). [score:4]
More importantly, miR-155, miR-146, and miR-223 have been suggested to regulate the inflammatory responses after the recognition of pathogens by the Toll-like receptors (TLRs) [30], [31]. [score:2]
Several studies have revealed that co-activation of miR-146 and miR-155 is regulated by NF-κB signaling pathway and may facilitate a negative-feedback loop that will protect the host from an excessive TLR4 response [31], [32]. [score:2]
The dramatic expanding of mmu-miR-146b and mmu-miR-155 in the late phase of infection indicated that a similar role may be exerted by these miRNAs to subtly control the extent of hepatic immunopathology of schistosomiasis. [score:1]
[1 to 20 of 7 sentences]
21
[+] score: 23
Although the mechanism of miR-146 -mediated tumor suppression is still unclear, EGF-R was identified as a target of this miR [42]. [score:5]
Increased miR-146 and a subsequent decline of EGF-R expression are associated with decreased proliferation, and inhibited invasion and migration of tumor cells in breast, pancreatic and gastric cancer [43, 44]. [score:5]
The rejuvenating effects of miR-146 on fibroblasts are associated with inhibition of IL-6 expression [40], a key mediator of the senescence -associated secretory phenotype [41]. [score:5]
Mouse miR-146 knockout mo dels strongly support a role for miR-146 as a tumor suppressor for myelo-lymphoid cells [45]. [score:4]
Meanwhile, miR-146 may appears to act as a tumor suppressor for many solid and hematological malignancies [42]. [score:3]
Both IL-6 and EGF-R were negatively modulated by CDC-EVs in our study, supporting the simplistic idea that CDC-EVs may act as a source of miR-146 as one possible anti-oncogenic mechanism. [score:1]
[1 to 20 of 6 sentences]
22
[+] score: 22
Other miRNAs from this paper: mmu-mir-130a, mmu-mir-146a, hsa-mir-130a, hsa-mir-146a, hsa-mir-146b
Our study corroborates other reports that ectopic expression of miR-146-5p inhibits in vitro pro-inflammatory cytokines production by decreasing the expression levels of IRAK1 and TRAF6 and by inactivation of NF-κB 24, 25. [score:7]
Taganov KD Boldin MP Chang KJ Baltimore D NF-kappaB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responsesProc. [score:5]
Compared with negative control, miR-146a-5p was up-regulated in the mice liver tissues and primary HSCs in miR-146-5p treatment group (Fig.   6a). [score:3]
Park H Huang X Lu C Cairo MS Zhou X MicroRNA-146a and MicroRNA-146b regulate human dendritic cell apoptosis and cytokine production by targeting TRAF6 and IRAK1 proteinsJ. [score:3]
Xie YF MicroRNA-146 inhibits pro-inflammatory cytokine secretion through IL-1 receptor -associated kinase 1 in human gingival fibroblastsJ. [score:2]
These results collectively suggest that miR-146-5p negatively regulates irradiation and LPS induced TLR4 pathway activation. [score:2]
[1 to 20 of 6 sentences]
23
[+] score: 22
These include on the one hand the up-regulated miRNAs: mmu-miR-342-3p, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-674 and mmu-miR-379; and on the other hand the down-regulated ones after HFD -induced obesity: mmu-miR-122, mmu-miR-133p, mmu-miR-1, mmu-miR-30a, mmu-miR-192 and mmu-miR-203. [score:7]
Taking into account the up-regulation of mmu-miR-21, mmu-miR-146a and mmu-miR-146b after HFD -induced obesity in the present study, these miRNAs are suggested as a research subject for future studies in obesity. [score:4]
The following miRNAs were found to be up-regulated in WAT after HFD feeding: mmu-miR-342-3p, mmu-miR-222, mmu-miR-221, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-647* and mmu-miR-379. [score:4]
The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379. [score:3]
Mmu-miR-146a, which shares 91% homology with mmu-miR-146b in a length of 22 nt [33], is mainly implicated in inflammatory response by being induced by NFκB [34] and by targeting interferon gamma (as revealed by miRWalk in this study). [score:3]
In contrast with mmu-miR-21 for which there are studies describing it to increase during adipocyte differentiation [35], [36], no reference is available regarding mmu-miR-146a, mmu-miR-146b and obesity. [score:1]
[1 to 20 of 6 sentences]
24
[+] score: 21
Although we did not predict all miRNAs that were upregulated in PTC, we did identify the four mostly highly upregulated, based on their analysis, miR-146, miR-221, miR-222, miR-21 (upregulated 19.3 fold, 12.3 fold, 10.9 fold and 4.3 fold respectively) (Table 1). [score:10]
Those miRNAs highlighted in blue (miR-221, miR-222, and miR-146) are predicted to be upregulated in PTC, from visual inspection of the plots. [score:4]
MiR-146, miR-221 and miR-222, are an order of magnitude more upregulated than any of the other miRNAs. [score:4]
For example, there are no confirmed targets of miR-146 in miRecords. [score:3]
[1 to 20 of 4 sentences]
25
[+] score: 20
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-223, mmu-mir-449a, mmu-mir-449b
Furthermore, we suggested that two miRNAs (miR-146a and miR-146b-5p) are involved in this gefitinib -dependent suppression of HSP70 translation; this was based on our observations that (i) the introduction of the 3' UTR of hsp70 into a luciferase reporter plasmid caused a gefitinib -dependent decrease in luciferase activity, (ii) the gefitinib -dependent suppression of HSP70 translation was not observed in cells transfected with siRNA for Dicer1, and (iii) gefitinib increased the levels of miR-146a and miR-146b-5p, both of which have the ability to decrease the level of HSP70. [score:9]
These results suggest that a gefitinib -dependent increase in the levels of miR-146a and miR-146b-5b is involved in gefitinib -dependent inhibition of HSP70 translation. [score:5]
Furthermore, transfection of cells with siRNA for Dicer1 suppressed this gefitinib -dependent increase in the levels of these miRNAs (miR-146a, miR-146b-5b) (Fig. 4B) and transfection of cells with synthesized miR-146a and miR-146b-5b mimic RNA fragments decreased the level of HSP70 (Fig. 4C and D) but not that of hsp70 mRNA (Fig. 4E). [score:3]
Six candidate miRNAs were found (miR-146a, miR-146b-5b, miR-223*, miR-561, miR-449a and miR-449b). [score:1]
The siRNA for Dicer1 and the miRNA mimic RNA fragments for miR-146a and miR-146b-5p were purchased from Qiagen. [score:1]
revealed that among these miRNAs, the levels of miR-146a and miR-146b-5b clearly increased after treatment of cells with 1 µM gefitinib (we used experimental conditions of real-time RT-PCR under which only fully processed miRNA could be detected) (Fig. 4A). [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 20
Our results showed that in Omp25 -expressing PAMs, the levels of miR-130a-3p, miR-146a, miR-181a, miR-181b, and miR-301a-3p were upregulated, while miR-125a-5p, miR-125b-5p, and miR-146b were downregulated compared to controls (Figure 4A). [score:8]
In mouse RAW264.7 cells, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p were upregulated, while miR-125a-5p and miR-146b were downregulated (Figure 4B). [score:7]
In PAMs and mouse RAW264.7 cells, we examined the 17 miRNAs expression profiles by Q-PCR assay, some of which have been reported to regulate NF-κB signaling, including miR-146a, miR-146b, miR-155, and miR-351-5p. [score:3]
MiR-146 and miR-125 in the regulation of innate immunity and inflammation. [score:2]
[1 to 20 of 4 sentences]
27
[+] score: 19
Four out of the six miRNAs undergoing validation exhibited congruence between miRNA profiling and qRT-PCR results, ranging from ~2-fold down-regulation to ~2-fold up-regulation [Table 1 and Figure 3; miR27a: t [(10)] = 2.848, p = 0.0173; miR146b: t [(10)] = 3.448, p = 0.0063; miR505: t [(10)] = 10.471, p = 0.0001; miR202-5p: t [(10)] = 3.222, p = 0.0091]. [score:7]
miR name miR changemiR Log [2] value Gene miRSVR score mRNA change mmu-miR-146b ↓ −0.3362 Gripap1 −0.6473 ↓ ↓ Fstl1 −0.4896 ↓ ↓ Dlgap1 −0.4727 ↓ ↓ Vps26a −0.2555 ↓ ↓ Gosr2 −0.1763 ↓ ↓ Gprasp1 −0.1232 ↓ ↓ Zfand6 −0.1105 ↓ ↓ Serpini1 −0.1097 ↓ mmu-miR-27a ↓ −0.3670 ↓ Ppp1r9a −0.8020 ↓ ↓ Ubqln1 −0.7975 ↓ ↓ Rps6ka5 −0.7940 ↓ ↓ Gosr2 −0.7700 ↓ ↓ Canx −0.7310 ↓ ↓ AI593442 −0.5274 ↓ ↓ Nsf −0.4902 ↓ ↓ Dgkb −0.4384 ↓ ↓ Dlgap1 −0.3411 ↓ ↓ Atp2b2 −0.2743 ↓ ↓ Zfand6 −0.1456 ↓ ↓ Nufip1 −0.1278 ↓ mmu-miR-505 ↑ 1.1166 Sap25 −1.2974 ↑ ↑ Parp11 −1.0018 ↑ ↑ Srbd1 −0.6136 ↑ ↑ Dicer1 −0.3529 ↑ ↑ Txnip −0.2797 ↑ ↑ Phf17 −0.1855 ↑ ↑ Ccnf −0.1480 ↑ Green up arrow: up-regulated in morphine vs. [score:4]
MicroRNA-146a and microRNA-146b regulate human dendritic cell apoptosis and cytokine production by targeting TRAF6 and IRAK1 proteins. [score:4]
At baseline (saline treated) expression level of miR27a and miR146b were significantly greater in D2 mice compared to the B6 mice while miR505 was equivalent and miR202-5p was significantly less than the B6 mice [miR27a: t [(8)] = 8.411, p = 0.0001; miR146b: t [(8)] = 3.448, p = 0.0007; miR505: t [(8)] = 0.261, ns; miR202-5p: t [(8)] = 3.000, p = 0.0171]. [score:2]
COA does not alter miRNA in these non-tolerant D2 providing increased support to these particular miRNA as high value candidates (miR27a; miR146b; miR505; miR202-5p, all ns). [score:1]
miR name miR changemiR Log [2] value mRNA miRSVR score mRNA change mmu-miR-146b ↓ −0.3362 Enpp5 −1.0510 ↑ ↓ Pet112l −1.0474 ↑ ↓ Afmid −1.0327 ↑ ↓ Ccna2 −0.6094 ↑ ↓ Baiap2l1 −0.3049 ↑ ↓ Phf17 −0.2832 ↑ ↓ Pcbp2 −0.1396 ↑ ↓ Dicer1 −0.1357 ↑ ↓ C86695 −0.1061 ↑ mmu-miR-202-5p ↑ 4.0723 Dlgap1 −1.2131 ↓ ↑ AI593442 −1.0566 ↓ ↑ Rps6ka5 −0.9715 ↓ ↑ Meis1 −0.7075 ↓ ↑ Fstl1 −0.6275 ↓ ↑ Atp2b2 −0.4273 ↓ ↑ Rab6b −0.2834 ↓ ↑ Ubqln1 −0.1476 ↓ ↑ Ppp1r9a −0.1379 ↓ ↑ Ralgps1 −0.1185 ↓ mmu-miR-27a ↓ −0.3690 Fmn2 −0.7565 ↑ ↓ Dicer1 −0.7044 ↑ ↓ Rufy3 −0.6805 ↑ ↓ Dusp9 −0.3455 ↑ ↓ Baiap2l1 −0.2262 ↑ mmu-miR-505 ↑ 1.1166 Meis1 −1.2283 ↓ ↑ Serpini1 −0.8085 ↓ ↑ Ralgps1 −0.4115 ↓ ↑ Canx −0. [score:1]
[1 to 20 of 6 sentences]
28
[+] score: 19
From Figure 4, it can be seen that miR-21, -25, -27b, -100, 140, -142-3p, -181c, 187, -194, -214 and -224 were significantly up-regulated at two time points whilst the level of miR-223 was significantly increased at 1, 3 and 6 h. Unlike the LPS -induced response in THP-1 cells and mouse macrophages, we failed to observe up-regulation of miRNA-146 or -155 [38, 39]. [score:7]
In contrast to previous cell based studies [39] that showed up-regulation of only 3 miRNAs (miR-132, miR-146 and miR-155) following LPS stimulation of the monocytic THP-1 cell line, we observed LPS -induced expression of 46 miRNAs at 3 h. Although these differences could be related to the sensitivity of the methodology used to measure miRNA levels, we believe that this is most likely ascribable to the differences between the in vitro and in vivo milieus. [score:4]
Interestingly, since two of the predicted targets for miR-146, TRAF6 and IRAK1 are known to be involved in LPS signalling, these authors speculate that miR-146 might regulate inflammation via a classical negative feedback pathway [39]. [score:4]
Little is known of the role of miRNAs in the innate immune response although recent reports have shown that this is associated with increased miR-146 and miR-155 expression in monocytic cell lines and murine macrophages [38, 39]. [score:3]
Future studies might therefore measure miRNA-146 and miRNA-155 expression during chronic inflammatory responses and/or at doses that result in lung injury. [score:1]
[1 to 20 of 5 sentences]
29
[+] score: 18
DEGs expression heat map was shown in Figure  4. Table 1 One hundred and thirty‐one differentially expressed genes (DEGs) were identified between IR + NS and IR + Zymosan‐A groups Up‐regulated gene Down‐regulated gene Stfa2 Ecm1 Egr1 Herpud1 Ccrl2 Zc3h12a Ier3 Irak2 Hbb‐b1 Stfa3 Mir5109 Atf3 Gramd1a Xcl1 Socs3 Lfng H2‐K1 Beta‐s BC100530 F630028O10Rik Ptafr Lpl Bpgm Ier5 Cyth1 Cxcl2 Slc4a1 BC117090 Gstm1 Bcl3 Ptgs2 H2‐Q4 Tnf Niacr1 Tnfsf13b Mir21 2010005H15Rik Ear1 Rasal3 Phf1 H2‐Q5 Erdr1 Txnip Mir22 Hba‐a2 Stfa1 Mt1 Smox Skil Rasl11b Nfkbia H2‐Ab1 H2‐Eb1 Hba‐a1 Gm5483 Rn45s Amica1 Cd74 Fmnl2 Mir24‐2 H2‐T22 Zfp36 Hbb‐b2 Stfa2 l1 Ear12 Neurl3 Nfkbid Cables1 Relb Nfkbiz Nfkb2 Hbb‐bt Saa3 Ear3 Ier2 Hmox1 Mir1901 Tnfaip3 H2‐T9 Ppp1r15a Mirlet7i Mt2 Ear7 5430421N21Rik Klf2 Tmcc2 Fn1 Junb Smim5 Gpnmb Marco Ear6 Bbc3 Jund H2‐Q6 H2‐Q10 Phlda1 Gabbr1 Mir146b Ggt1 Acvrl1 Irg1 H2‐Aa H2‐Q8 Thbs1 Gm15441 Mir1198 Prok2 Ceacam10 Rnf167 Tgif1 H2‐Q9 Nfkbie Jun Dusp2 Lars2 Ctsg Pik3ap1 Tgm2 H2‐Q7 Gadd45b Zmpste24 Antxr2 Steap4 Ear2 Sh2b2 Sertad1 Alas2 Ptger4 Basp1 Ninj1 John Wiley & Sons, Ltd Figure 4 Identification of differentially expressed genes (DEGs) between IR + NS and IR + Zymosan‐A groups. [score:9]
DEGs expression heat map was shown in Figure  4. Table 1 One hundred and thirty‐one differentially expressed genes (DEGs) were identified between IR + NS and IR + Zymosan‐A groups Up‐regulated gene Down‐regulated gene Stfa2 Ecm1 Egr1 Herpud1 Ccrl2 Zc3h12a Ier3 Irak2 Hbb‐b1 Stfa3 Mir5109 Atf3 Gramd1a Xcl1 Socs3 Lfng H2‐K1 Beta‐s BC100530 F630028O10Rik Ptafr Lpl Bpgm Ier5 Cyth1 Cxcl2 Slc4a1 BC117090 Gstm1 Bcl3 Ptgs2 H2‐Q4 Tnf Niacr1 Tnfsf13b Mir21 2010005H15Rik Ear1 Rasal3 Phf1 H2‐Q5 Erdr1 Txnip Mir22 Hba‐a2 Stfa1 Mt1 Smox Skil Rasl11b Nfkbia H2‐Ab1 H2‐Eb1 Hba‐a1 Gm5483 Rn45s Amica1 Cd74 Fmnl2 Mir24‐2 H2‐T22 Zfp36 Hbb‐b2 Stfa2 l1 Ear12 Neurl3 Nfkbid Cables1 Relb Nfkbiz Nfkb2 Hbb‐bt Saa3 Ear3 Ier2 Hmox1 Mir1901 Tnfaip3 H2‐T9 Ppp1r15a Mirlet7i Mt2 Ear7 5430421N21Rik Klf2 Tmcc2 Fn1 Junb Smim5 Gpnmb Marco Ear6 Bbc3 Jund H2‐Q6 H2‐Q10 Phlda1 Gabbr1 Mir146b Ggt1 Acvrl1 Irg1 H2‐Aa H2‐Q8 Thbs1 Gm15441 Mir1198 Prok2 Ceacam10 Rnf167 Tgif1 H2‐Q9 Nfkbie Jun Dusp2 Lars2 Ctsg Pik3ap1 Tgm2 H2‐Q7 Gadd45b Zmpste24 Antxr2 Steap4 Ear2 Sh2b2 Sertad1 Alas2 Ptger4 Basp1 Ninj1 John Wiley & Sons, Ltd Figure 4 Identification of differentially expressed genes (DEGs) between IR + NS and IR + Zymosan‐A groups. [score:9]
[1 to 20 of 2 sentences]
30
[+] score: 18
Of these 15 miRNAs, we selected six miRNAs, miR-451, miR-126, miR-145, miR-146b-5p, miR-491-5p, and miR-107, which were previously reported to have a tumor suppressor role because our previous studies revealed that some tumor suppressor miRNAs in plasma were significantly down-regulated in cancer patients compared with healthy volunteers 30, 32, 33, and the down-regulation of tumor suppressor miRNAs in the blood stream might be related to tumor progression and poor prognostic outcomes [32]. [score:12]
We selected six down-regulated tumor suppressor miRNAs (miR-451, miR-126, miR-145, miR-146b-5p, miR-491-5p, and miR-107) in plasma through a comprehensive miRNA array -based approach. [score:6]
[1 to 20 of 2 sentences]
31
[+] score: 18
Small RNA sequencing revealed several transcripts to be slightly regulated: miR-15 (log2 fold change 1.5), miR-383–5p (log2 fold change of 1.3) and miR-146b-5p (log2 fold change of 1.1) were top upregulated candidates, while Gm24706 (log2 fold change of 1.4), miR-7046–3p (log2 fold change of 1.1) and miR-203–5p (log2 fold change of 0.9) were top downregulated transcripts. [score:8]
Most highly downregulated candidates were Gm5878, aldehyde dehydrogenase 1 family member A3 and solute carrier family 14 (urea transporter), member 2. Small RNA sequencing revealed miR-15, miR-383-5p and miR-146b-5p as top upregulated candidates. [score:7]
Interestingly, miR-15 is described to play a role in apoptosis by targeting Bcl2 in chronic lymphocytic leukemia (CLL) [32] and mir-146b-5p was found to be induced in AKI and fibrosis [33]. [score:3]
[1 to 20 of 3 sentences]
32
[+] score: 17
For example, miR-146b and miR-34a were up-regulated in the liver tissues of patients with non-alcoholic steatohepatitis [11], while in the CCl [4] induced liver fibrosis, miR-199a-5p and miR-199a-3p were positively and significantly correlated to the progression of liver fibrosis [12]. [score:4]
To identify miRNAs that reflected the schistosome infections and PZQ chemotherapy, six miRNA candidates (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) were selected for analysis in serum that were commonly deregulated in human liver diseases. [score:4]
The expression levels of miR-34a, miR-223, miR-122, miR-146b, miR-199a-5p, miR-199a-3p were determined using the SYBR Green Master Mix kit (TaKaRa, Dalian, China). [score:3]
Expression levels of serum miR-223 (B), miR-122 (C), miR-34a (D), miR-199a-5p (E) miR-199a-3p (F), and miR-146b (G) were detected in the three groups of mice. [score:3]
We analyzed the serum levels of six selected candidate miRNA molecules (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) from mice, rabbits, buffalos and humans infected with Schistosoma japonicum using qPCR. [score:1]
Conversely, levels of serum miR-199a-3p, miR-199a-5p, and miR-146b in mice decreased after infection (Figure  1E-G). [score:1]
To test this hypothesis, we selected six candidate serum miRNAs for analysis (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) in the murine mo del of human schistosomiasis and then performed validation in other host species including rabbits, buffalos and human patients infected with S. japonicum. [score:1]
[1 to 20 of 7 sentences]
33
[+] score: 17
It is important to note that only 9 miRNAs (miR-100-5p, miR-130a-5p, miR-146b-3p, miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p, miR-301a-3p, and miR-495-3p) were significantly upregulated or downregulated in both lungs infected with either wild type w81 or the mouse-adapted ma81 strain at all time points (Tables  1 and 2). [score:7]
Twenty-seven and 20 differentially expressed miRNAs identified to be commonly presented at 1 and 3 dpi were presented in Tables  3 and 4. Of these, only miR-100-5p, miR-130a-5p, miR-146b-3p, miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p, miR-301a-3p, and miR-495-3p were commonly upregulated at both 1 and 3 dpi. [score:6]
It is noteworthy that only 9 miRNAs (miR-100-5p, miR-130a-5p, miR-146b-3p, miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p, miR-301a-3p, and miR-495-3p) were significantly upregulated in both lungs infected with either wild type w81 or the mouse-adapted ma81 strain at both time points. [score:4]
[1 to 20 of 3 sentences]
34
[+] score: 16
Moreover, our miR expression data (Fig. 1d) confirm the findings of Xie (2009) [56] and Knelangen [57] that miR-221 and miR-125b-5p are down-regulated during differentiation of 3T3-L1 cells, whereas miR-103 and miR-146b are up-regulated. [score:9]
As proof of the integrity of our miR expression assay data, the expression levels of three putative adipogenesis-relevant miRs (miR-103, miR-146 and miR-221) and five highly regulated miRs (miR-29a, miR29b, miR-365, miR93 and miR96) were analysed by RT-qPCR (S1 and S2 Figures; the corresponding expression values are summarised in the Supporting information S3 and S4 Tables). [score:7]
[1 to 20 of 2 sentences]
35
[+] score: 16
By contrast, miR-146b, a developmentally increased microRNA, was significantly upregulated after injury, possibly due to expression in infiltrating macrophages 18, 19. [score:7]
Thus, in addition to EGR2 repression of antecedent gene expression programs via NAB corepressors [46], EGR2 induction of miR-138, and potentially miR-338 and miR-146b, may be a second mechanism by which EGR2 carries out or reinforces the repression. [score:3]
Thus, EGR2 is either directly or indirectly upstream of miR-138, miR-338, and miR-146b in vivo. [score:3]
Indeed, the expression of some candidates, such as miR-338 and miR-146b, was reduced in the P5 Egr2 [−/−] sciatic nerve. [score:3]
[1 to 20 of 4 sentences]
36
[+] score: 15
NF-κB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. [score:5]
Expression of miR-155 (UUAAUGCUAAUUGUGAUAGGGGU), miR-21(UAGCUUAUCAGACUGAUGUUGA), miR-223 (UGUCAGUUUGUCAAAUACCCCA) and miR-146 (UGAGAACUGAAUUCCAUGGGUU) was examined in hippocampi of the injured (ipsilateral) and the uninjured (contralateral) hemisphere from the same animals at 1, 3, 7 and 14 days after moderate CCI and in naïve controls (Figure 1D). [score:3]
Expression of miR-146 was not altered by CCI at the time points examined by two way ANOVA (P = 0.16). [score:3]
Four of these miRNAs, miR-155, miR-21, miR-223 and miR-146 were differentially expressed in at least one miRNA profiling experiment performed in rodent mo dels of TBI (Lei et al., 2009; Re dell et al., 2009; Hu et al., 2012; Liu et al., 2014; Sun et al., 2014; Meissner et al., 2016). [score:3]
Among these are miR-155 (O’Connell et al., 2007), miR-21 (Löffler et al., 2007), miR-146 (Taganov et al., 2006), and miR-223 (Ceppi et al., 2009). [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 14
NF-kappaB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. [score:5]
In addition, miR-146 inhibition may not be an ideal therapeutic as it could elicit the so-called “Janus phenomenon,” wherein pro-arteriogenic therapies also promote atherosclerosis (Epstein et al., 2004). [score:3]
As such, we could confidently determine miR-146a expression but could not confidently detect miR-146b due to this cross-reactivity. [score:3]
MicroRNA-146 represses endothelial activation by inhibiting pro-inflammatory pathways. [score:2]
Of note, miR-146a-5p differs in mature sequence from miR-146b-5p by only two nucleotides at their 3′ ends and they share identical seed sequences. [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 14
Other miRNAs from this paper: mmu-mir-146a
The CRISPR -mediated knockout of miR-146 led to a 2.9-fold increase in the protein expression of Syk (Figure 4H), increased cell proliferation (Figures 4I and S3B), reduced apoptosis (Figure S3C), and enhanced c-Kit expression (Figure S3D), mirroring the phenotype of H/M cells. [score:6]
To further test whether miR-146a affects Syk expression, we knocked out miR-146 using CRISPR/Cas9 by transducing H cells with a lentiviral miR-146-specific CRISPR construct (ΔmiR-146) that reduced miR-146a expression by 75% in a polyclonal cell population (Figure 4G) or isolated myeloid progenitor cells from B6/miR-146a [−/−] mice and transduced them with Hoxa9. [score:6]
Finally, mice transplanted with miR-146 knockout H cells exhibited accelerated leukemia development compared with mice transplanted with H cells (Figure 4J). [score:2]
[1 to 20 of 3 sentences]
39
[+] score: 13
Other miRNAs from this paper: hsa-mir-146b
Xia H. Qi Y. Ng S. S. Chen X. Li D. Chen S. Ge R. Jiang S. Li G. Chen Y. microRNA-146b inhibits glioma cell migration and invasion by targeting MMPs Brain Res. [score:5]
Xiang M. Birkbak N. J. Vafaizadeh V. Walker S. R. Yeh J. E. Liu S. Kroll Y. Boldin M. Taganov K. Groner B. STAT3 induction of miR-146b forms a feedback loop to inhibit the NF-kappaB to IL-6 signaling axis and STAT3 -driven cancer phenotypes Sci. [score:3]
Recently miR146b has been reported to specifically degrade Stat3β in normal mammary luminal cells [50], suggesting this as a normal mode of regulation. [score:2]
Loss of miR146b gene (deletion of 10q24–26) has been reported in glioma [51], which supports this possibility. [score:1]
Our antibodies likely will prove extremely useful in studies designed to examine the relationship between miR146b and Stat3β in cancer cells. [score:1]
In addition, levels of miR146b negatively correlated to nuclear pStat3 in 24 invasive breast tumor specimens [52, 53]. [score:1]
[1 to 20 of 6 sentences]
40
[+] score: 13
Other miRNAs from this paper: mmu-mir-146a
As shown in Fig. 4, the proteins level of TRAF6 and IRAK1 were dramatically upregulated in the BMDMs of miR-146 KO mice (Fig. 4b), a tendency that was consistent with the observed change in gene expression assessed via qRT-PCR (Fig. 4a). [score:6]
Increased expression of NALP3 inflammasome components in MSU -induced BMDMs of miR-146 KO mice. [score:3]
Additionally quantitative RT-PCR and western blot demonstrated that TRAF6 and IRAK1 were dramatically upregulated in BMDMs from miR-146 KO mice compared to those from WT mice. [score:3]
As expected, the ratio of BMDMs producing TNF-a was higher in miR-146 KO mice than in the WT control (Fig. 3f). [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 13
Thus, superior GVHD control may be acquired by increasing Treg fitness by upregulating miR-155 or reducing miR-17 or miR-146b expression. [score:6]
By contrast, miR-146b impedes human Treg homeostasis (65), offering a potential therapeutic target that could be exploited to augment Treg fitness and survival. [score:3]
The potential of miRNA therapeutics in human Treg cellular therapy was demonstrated by ex vivo inhibition of miR-146b that enhanced in vitro tTreg function and, upon adoptive tTreg transfer, superior in vivo xenogeneic GVHD lethality compared with scrambled miR control treatment (65). [score:2]
miR-146b antagomir treatment of Treg enhanced TRAF6 and the TRAF6–NF-κB–Foxp3 axis, resulting in improved Treg survival and proliferation (65). [score:1]
miR-10b, miR-99a, miR-130a, miR-146b, miR-150, and miR-320 were amongst those found to drive Treg differentiation. [score:1]
[1 to 20 of 5 sentences]
42
[+] score: 13
In addition, developmental upregulation of some miRNAs identified in our screen was observed in differentiating oligodendrocytes in vitro, including miR-146, miR-23b, miR-24, and miR-27b in one study [13] and miR-204, miR-27b and miR-100 very recently in another study [20]. [score:5]
All miRNAs analyzed were significantly downregulated in Dicer [fl/fl] Dhh-Cre [+] nerves at p4: p≤0.0001 (miR-34a, miR-146b, miR-338-3p, miR-204, miR-27b, miR-140, miR-138, miR-30a), p = 0.0002 (miR-195). [score:4]
Furthermore, miRNAs were confirmed to be upregulated upon myelination: p≤0.0001 (miR-34a, miR-146b), p = 0.04 (miR-338-3p), p = 0.003 (miR-204), p = 0.0007 (miR-27b), p = 0.005 (miR-140), p = 0.0002 (miR-138), p = 0.01 (miR-195), p = 0.0004 (miR-30a). [score:4]
[1 to 20 of 3 sentences]
43
[+] score: 13
[24] MiR-146 is upregulated in monocytes in response to LPS and downregulates genes involved in the signal transduction pathway of TLR4 signaling,[15] and miR-203 is enhanced in skin of patients with psoriasis. [score:7]
Based on these results, antagomirs were created against the top-4 upregulated miRNAs in this colitis-transfer mo del (miR-142-5p, miR-146b, miR-203, and miR-223; experiment #2). [score:4]
Several miRNAs were induced in the colon during colitis development, most significantly miR-223, miR-142-5p, miR-146B and miR-203. [score:2]
[1 to 20 of 3 sentences]
44
[+] score: 13
Figure 6Expression of experimentally validated miR-146a target genes and proteins in response to CPZ exposure in wild-type and miR-146 -deficient mice. [score:5]
Figure 7Expression of cytokines, cytokine receptors, and chemokines in the corpus callosum during experimental demyelination and remyelination in miR-146 -deficient mice. [score:3]
Figure 2Expression of miR-146 in different organs during cuprizone (CPZ) treatment and during physiological postnatal myelination. [score:3]
In our study, miR-146 deficiency had no effect on remyelination and did not influence the number of OPCs during remyelination. [score:1]
Figure 4Cuprizone (CPZ) -induced demyelination and remyelination in miR-146 -deficient mice. [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 12
In the human study 10 miRNAs were extracted, and the change in their expression level varied significantly between F0 and F3 (F0miR-146b, 199a, 199a*, 200a, 200b, 34a, and 34b, F0>F3: hsa-miR-212, 23b, and 422b). [score:3]
5 extracted miRNAs had an expression level that was significantly different between F1 and F2 (F1miR-146b, F1>F2: hsa-miR-122, 197, 574, and 768-5p). [score:3]
The expression level of 6 miRNAs was significantly different between F0 and F2 (F0miR-146b, 200a, 34a, and 34b, F0>F2: hsa-miR-122 and 23b). [score:3]
The expression level of 9 miRNAs changed significantly between F1 and F3 (F1miR-146b, 150, 199a, 199a*, 200a, and 200b, F1>F3: hsa-miR-378, 422b, and 768-5p). [score:3]
[1 to 20 of 4 sentences]
46
[+] score: 12
Expression of 6 selected miRNAs, including let-7b, let-7g, miR-1, miR-146, miR-16, and miR-17-5p, was validated using TaqMan MicroRNA Assays according to the manufacturer's instructions (Applied Biosystems, Foster City, CA, USA) and normalising data to U6 small nuclear RNA (RNU6; Applied Biosystems) expression. [score:4]
Another miRNA highly expressed during lactation and early involution, miR-146b, has been associated with the regulation of innate immune response and inflammation. [score:4]
It is an intriguing possibility that miR-146 might be involved in abrogating the Th2 bias in cytokine expression that continues during gestation and lactation, to facilitate a switch back to a Th1 environment upon involution. [score:3]
It further included miR-146b, miR-210 and multiple members of the miR-148 and miR-181 families. [score:1]
[1 to 20 of 4 sentences]
47
[+] score: 12
NF-kappaB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. [score:5]
This study Previous studies miRNA Sample Lower/Higher Sample Lower/Higher Target miR-132 Plasma of 3xTg-AD and WT mice of 2–3 and 14–15 months − AD brain −Cogswell et al., 2008 p250-GAP AD neocortex −Hébert et al., 2013 AD CSF −Burgos et al., 2014 miR-138 − AD CSF −Burgos et al., 2014 APT1 miR-139 − AD CSF −Burgos et al., 2014 miR-146a − AD CSF/plasma −Kiko et al., 2014 IRAK-1 TRAF6 AD CFS −Müller et al., 2014 AD hippocampus ± miR-146b − AD CSF −Cogswell et al., 2008 AD brain − miR-29a − AD cortex −Hébert et al., 2008 BACE1 AD serum −Geekiyanage et al., 2011 AD CSF +Kiko et al., 2014 miR-29c − AD cortex −Hébert et al., 2008 The table contains data obtained from this study (left) and collected from others (right). [score:3]
age-matched WT mice, we detected a significant lower abundance of miR-132, miR-138, miR-139, miR-146a, miR-146b, miR-22, miR-24, miR-29a, and miR-29c as well as a higher abundance of miR-346 (Figure 4, Supplementary Table 4). [score:1]
old 3xTg-AD mice, we identified a particular group of miRNAs integrated by miR-132, miR-138, miR-146a, miR-146b, miR-22, miR-24, miR-29a, miR-29c, and miR-34a which show significant differences in plasma levels only in the transgenic group, raising the possibility of age-related changes that specifically occur in the 3xTg-AD mice (Figure 3, Supplementary Table 3). [score:1]
Levels of miR-146a and miR-146b have been reported diminished in brain, CFS and plasma of AD patients (Cogswell et al., 2008; Kiko et al., 2014; Müller et al., 2014). [score:1]
In addition, we found some miRNAs involved with an inflammatory response such as miR-146a and miR-146b that display altered levels in plasma of both groups of old mice. [score:1]
[1 to 20 of 6 sentences]
48
[+] score: 12
Overexpression of miR-377 had no effect on the luciferase activity of the mutant reporter (Figure 1C); miR-132 and miR-146b, which have been demonstrated to target the 3′-UTR of SIRT1 were used as positive controls [8, 15]. [score:5]
Specifically, in TNFα -treated adipocytes, miR-146b, miR-130 and miR-155 were upregulated. [score:4]
In HFD -induced obese mice, miR-146b knockdown ameliorated insulin-resistance [8]. [score:2]
Several miRNAs, such as miR-132 [15], miR-155 [16], miR-130 [17], miR-145 [18], miR-146b [19], and miR-29 [20] have been indentified in obesity -associated inflammation and insulin-resistance in adipocytes. [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 12
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-16-1, mmu-mir-16-2
miR-146 has been found previously to be up-regulated in OSCC [29], [30], [33]. [score:4]
Up-regulation of miR-146 has been found in HNSCC, squamous cell carcinoma (SCC) of the cervix, SCC of the lung, melanoma, gastric carcinoma and thyroid carcinoma [13], [14], [28]– [34]. [score:4]
High miR-146b expression has been shown to define a poor prognosis in patients with SCC of the lung [34]. [score:3]
There was also a decreased β-galactosidase activity levels in these stable cells after transfection with the miR-146a reporter plasmid (Fig. 2B, Lower), suggesting the presence of exogenous miR-146 activity. [score:1]
[1 to 20 of 4 sentences]
50
[+] score: 12
The miR-146 levels were downregulated, and the upregulation of miR-146 expression may be of neuroprotective value in AD, whereas the levels of its target proteins IL-1 receptor -associated kinase-1 and NF-κB increased in the microglial cells of PS-2 knockout mice [51]. [score:12]
[1 to 20 of 1 sentences]
51
[+] score: 12
NF-kappaB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. [score:5]
Cultured human ECs treated with miR-146 inhibitors, as well as miR-146a [-/-] mice, have an enhanced magnitude and duration of the EC inflammatory response; thus indicating the functional importance of this microRNA in repressing vascular inflammation (Cheng et al., 2013). [score:3]
MicroRNA-146 represses endothelial activation by inhibiting pro-inflammatory pathways. [score:2]
MicroRNA-146 inhibits thrombin -induced NF-kappaB activation and subsequent inflammatory responses in human retinal endothelial cells. [score:2]
[1 to 20 of 4 sentences]
52
[+] score: 12
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
The miR146b-5p [61] and miR-335 [62] miRNAs have been shown to be metastasis suppressors in breast and colon cancers, facilitating the metastatic phenotype at reduced levels [63]. [score:3]
[1 to 20 of 2 sentences]
53
[+] score: 12
In fact, miR-222 has been found to be upregulated in 10 different myopathies: a study by Eisenberg et al. [31] reported that a large number of miRs were differentially expressed in various muscular pathologies and, that, in particular, the expression of five miRs (miR-146b, miR-221, miR-155, miR-214, miR-222) was altered in all the analyzed syndromes. [score:8]
Among these miRs, five (miR-146b, miR-221, miR-155, miR-214, and miR-222) were found to be consistently dysregulated in the different analyzed diseases [31]. [score:4]
[1 to 20 of 2 sentences]
54
[+] score: 11
For those miRNAs down-regulated by H9N2, the NA segment greatly increased the expression of miR-181b1; however, unlike the H9N2 virus treatment, the HA treatment significantly rose the expression of miR146, miR375, and miR-29c, (Figure 1B). [score:8]
TRAF6, a target of miR-146, is important for NF-kB activation [32]. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 11
Recent studies have reported that TRAIL suppresses chemokine (C-X-C motif) receptor 4 (CXCR4) -mediated human breast cancer cell migration by up -regulating miR-146a expression through NF-κB signaling [46], and that miR-146 regulates epigenetic regulator UHRF1 and modulates gastric cancer invasion and metastasis [47], showing the important roles of miR-146 in inhibiting cancer metastasis by interfering chemokine and epigenetic regulator. [score:11]
[1 to 20 of 1 sentences]
56
[+] score: 11
Similar reduction was not observed in expression levels of (B) miR-146b in the kidney tissues. [score:3]
No alterations were seen in HRECs incubated with 25mM L-glucose (LG) or (B) miR146b expression levels in these conditions. [score:3]
MiR-146 upregulation prevents structural and functional changes in the kidneys and retina of diabetic animals. [score:3]
Furthermore, there were no changes in miR-146b Levels (Fig 1A and 1B). [score:1]
Such reduction in levels was absent in (B) miR146b. [score:1]
[1 to 20 of 5 sentences]
57
[+] score: 10
The differentially expressed miRNAs in earlier studies appeared consistently in mouse skeletal muscle from our study; for example, the expression pattern of miR-146a-5p, miR-146b-5p, miR-434-3p, miR-127-3p, and miR-148a-3p are similar to previous studies. [score:5]
The array uncovered the induction of 117 miRNAs with the signal intensity ≥500 (the fluorescence amount of each miRNA probe is measured by a photo multiplier tube or charge-coupled device and signal scaled across the range of detection for the platform) in GA muscle (Table 1, Fig. 1A and 1B), including the highly downregulated miRNAs (≥1.5-fold) miR-194-5p, miR-101b-3p, miR-148a-3p, miR-199b-5p, miR-335-5p, miR-127-3p, miR-379-5p, miR-541-5p, miR-382-5p, miR-329-3p, miR-299-5p and miR-434-3p, and the highly up-regulated miRNAs (≥1.5 fold), miR-146b-5p and miR-146a-5p (Fig. 1C). [score:5]
[1 to 20 of 2 sentences]
58
[+] score: 10
Other miRNAs from this paper: mmu-mir-146a, hsa-mir-146a, hsa-mir-146b
In terms of the relevance of IL-1β to breast cancer cell aggressiveness, breast cancer metastasis suppressor 1 has been shown to up-regulate miR-146, which targets key IL-1 receptor signaling molecules, including IRAK1 and TRAF6, and suppresses the metastasis of breast cancer cells [26]. [score:10]
[1 to 20 of 1 sentences]
59
[+] score: 10
For the miRNAs down-regulated by H9N2, the PB1 segment also mostly reduced their expression, especially for miR339, miR375, and miR146 (Figures 2A,B). [score:6]
MicroRNA-146a and microRNA-146b regulate human dendritic cell apoptosis and cytokine production by targeting TRAF6 and IRAK1 proteins. [score:4]
[1 to 20 of 2 sentences]
60
[+] score: 10
Network of miRNA–mRNA interactions identified by IPA for (A) dystromiRs up-regulated in mdx muscle (miR-21, miR-31, miR-34c, miR-146b and miR-206), and (B) the dystromiR miR-29c, which is down-regulated in mdx muscle. [score:7]
Focusing on a subset of DMD -associated miRNAs (dystromiRs), miR-21, miR-29c and miR-146b were found to be partially restored towards wild-type expression levels in the treated mice. [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 10
miR-155 is required for inhibiting the expression of Socs1, a negative regulator of Jak-Stat signaling [24]– [26], while miR-146 inhibits the expression of Stat1 [27]. [score:10]
[1 to 20 of 1 sentences]
62
[+] score: 9
miR-146b could be inferred as a negative regulator of innate immunity and its down-regulation in the AD brain provides support for an induction of Toll like receptor (TLR) signaling in AD [21]. [score:5]
miR-146b is down-regulated in AD mice and has been reported to be consistently altered in both hippocampus and medial frontal gyrus in AD mouse mo dels [21]. [score:4]
[1 to 20 of 2 sentences]
63
[+] score: 9
In contrast, miR-146b was upregulated by flutamide but downregulated by hyperoxia [61]. [score:7]
A statistically significant effect of flutamide was observed for seven of these miRNAs (miR-26b-3p, let-7b-3p, miR-465c-3p, miR-669h-3p, miR-3058-5p, miR-146b, miR-1843-5p), and a trend toward a statistically significant effect was observed for another miRNA (miR-130b-5p) (Fig.   2b, c). [score:1]
Eleven miRNAs were randomly selected for qPCR analysis for each age: GD 17.0 miR-1843-5p, miR-485-3p, miR-711, miR-3962, miR-3067-3p, miR-212-3p, miR-669i, miR-877, miR-26b-3p, miR-465c-3p, let-7b-3p; GD 18.0 miR-1843-5p, miR-485-3p, miR-3473d, miR-132-5p, miR-3074-1-3p, miR-128-2-5p, miR-130b-5p, miR-490-5p, miR-669h-3p, miR-3058-5p, miR-146b. [score:1]
[1 to 20 of 3 sentences]
64
[+] score: 8
Breast cancer metastasis suppressor 1 up-regulates miR-146, which suppresses breast cancer metastasis. [score:8]
[1 to 20 of 1 sentences]
65
[+] score: 8
Three microRNAs had decreased expression in the bleomycin treated lungs (miR-26a, miR-151-3p and miR-676) while eight microRNAs had increased expression in the bleomycin treated lungs (miR-146b, miR-199a-5p, miR-21, miR-34a, miR-335-5p, miR-207, miR-301a and miR-449a). [score:5]
Using a mo del of intraperitoneal delivery of bleomycin, Cushing et al. [30] reported the altered expression of additional microRNAs common to the present work, miR-449a and miR-146b, further to their evidence of miR-21, miR-34a within the fibrosis microRNA profile at 10 and 28 days following bleomycin administration. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 8
Other miRNAs from this paper: mmu-mir-146a
These results imply that miR-146 is able to directly bind to TRAF6 or IRAK1 regulatory sequences in their 3′UTRs, decreasing their expression in H/R -induced macrophages. [score:5]
These data suggest that IRAK1 and TRAF6 may be important targets of miR-146 in the reduction of proinflammatory cytokines release. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 8
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-155
1 is known to upregulate multiple miRNAs, including miR-146 and miR-155, which in turn negatively regulate innate sensing through the regulation of TRAF6, IRAK4, and STAT1, for example (Ghani et al., 2011, Jurkin et al., 2010). [score:6]
1 might be needed to induce mir146 and limit anti-microbial responses. [score:1]
Indeed, Ly6C [+] monocytes from mir146 [−/−] mice are hyper-responsive to microbial stimulation (Etzrodt et al., 2012). [score:1]
[1 to 20 of 3 sentences]
68
[+] score: 8
It is unclear whether miR-146 is an inhibitor of immune response and might be protective in neurodegenerative diseases [57]. [score:5]
The increased expression of miR146 in the hippocampus (miR146a-5p) and neocortex (miR146b-5p) correlates with the presence of clusters of iba1 -positive microglia in these brain regions. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 8
Other miRNAs from this paper: mmu-mir-140, mmu-mir-146a
[26] However, other studies showed that miR-146 may contribute to OA pathogenesis by promoting VEGF expression and impairing the TGF- β signaling pathway through targeting of Smad4. [score:5]
Our study provides the first in vivo evidence that inhibiting the levels of miR-146 can alleviate cartilage degeneration in OA. [score:3]
[1 to 20 of 2 sentences]
70
[+] score: 8
Two miRs, miR-630 and miR-150-5p, are up- and down-regulated respectively, in all JMML molecular subtypes more than 2 fold, while miR-1260, miR-146b-5p and miR-4454 were downregulated in both KRAS and NRAS mutants only. [score:7]
01  hsa-let-7a-5p MIMAT0000062 0.010 −2.98  hsa-miR-4454 MIMAT0018976 0.021 −2.64  hsa-miR-148a-3p MIMAT0000243 0.030 −2.31  hsa-miR-146b-5p MIMAT0002809 0.009 −2.12  hsa-miR-342-3p MIMAT0000753 0.010 −2.11  hsa-let-7f-5p MIMAT0000067 0.021 −2.03  hsa-miR-26a-5p MIMAT0000082 0.034 −2.01  hsa-let-7d-5p MIMAT0000065 0.038 −2.01  hsa-miR-30b-5p MIMAT0000420 0.019 −1.96  hsa-miR-29b-3p MIMAT0000100 0.044 −1.94  hsa-miR-29a-3p MIMAT0000086 0.024 −1.70Significant deregulated microRNAs in JMML patients compared to Healthy Donors controls (P<0.05; see paragraph in Matherials and Methods section). [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 8
Ingenuity Pathway Analysis (IPA) software was used to identify molecular networks and targets of the miRNAs miR-146b, miR-21, miR-142-3p miR-142-5p, miR-145 and miR-149, which were differentially expressed in all three time points post infection and were significantly correlated both with changes in parasitemia and QTc interval. [score:5]
0003828.g006 Fig 6 In silico analysis done using the IPA software (Qiagen, USA) showing a biological network built with 4 miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p) from the 6 (miR-146b, miR-21-5p, miR-142-3p, miR-142-5p, miR-145-5p and miR-149) uploaded for the analysis. [score:1]
In silico analysis done using the IPA software (Qiagen, USA) showing a biological network built with 4 miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p) from the 6 (miR-146b, miR-21-5p, miR-142-3p, miR-142-5p, miR-145-5p and miR-149) uploaded for the analysis. [score:1]
In addition, six (out of nine) microRNAs were significantly correlated with changes in both parasitemia and QTc interval: miR-146b, miR-21, miR-142-3p miR-142-5p (positive correlation) and miR-145-5p and miR-149-5p (negative correlation) (Fig 5). [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 8
For example, the expression levels of miRNA-181a, miR-155, miR-150, miRNA-221, miR-106a, miRNA-221, miR-146a and miR-146b were increased in OVA -induced mouse mo del of asthma [15– 18]; the miR-126, miR-145 and miR-106a expression levels were increased in house dust mite (HDM) -induced experimental asthma mo del [19– 21]; and miR-21 was up-regulated in lung-specific interleukin (IL)-13 -induced asthma mo del [22]. [score:8]
[1 to 20 of 1 sentences]
73
[+] score: 8
Finally, the remaining 24 miRNA exhibited differential expression between tumor and parenchyma in both the absence and presence of cigarette smoke exposure, including 2 miRNA (mmu-miR-135b-5p, mmu-miR-1198-5p), whose expression levels increased in parenchyma but remained stable in tumor tissue following MS exposure, 5 miRNA (mmu-miR-21-5p, mmu-miR-31-5p, mmu-miR-146b-5p, mmu-miR-665-3p, mmu-miR-744-5p) that remained more highly expressed in tumors compared to parenchyma, and 17 miRNA with lower expression levels in tumors than in parenchyma, even upon cigarette smoke exposure (Figure 8). [score:8]
[1 to 20 of 1 sentences]
74
[+] score: 7
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-99a, mmu-mir-126a, mmu-mir-132, mmu-mir-141, mmu-mir-181a-2, mmu-mir-185, mmu-mir-193a, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-34c, mmu-let-7d, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-22, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-34a, mmu-mir-200c, mmu-mir-212, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-378a, mmu-mir-451a, mmu-mir-674, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-26b, bta-mir-99a, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-193a, bta-let-7d, bta-mir-132, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-423, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-23b, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-34a, bta-mir-141, bta-mir-146b, bta-mir-16a, bta-mir-185, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-29b-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, mmu-let-7j, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285t, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2284ab, bta-mir-2284ac
For example, miR-146b-5p and miR-378a-3p were highly expressed in mouse but they were present at a low level of expression in bovine; inversely, miR-199b-5p, miR-423-5p and miR-193a-5p were weakly expressed in mouse but highly in bovine (Table S2). [score:7]
[1 to 20 of 1 sentences]
75
[+] score: 7
The ten most up-regulated miRNAs included mmu-miR-205-5p, mmu-miR-222-3p, mmu-miR-205-3p, mmu-miR-146b-5p, mmu-miR-21-5p, mmu-miR-21-3p, mmu-miR-221-3p, mmu-miR-140-3p, mmu-miR-142-5p, and mmu-miR-140-5p and the ten most down-regulated miRNAs comprised mmu-miR-211-5p, mmu-miR-3096-5p, mmu-miR-711, mmu-miR-466h-5p, mmu-miR-130b-3p, mmu-miR-3082-5p, mmu-miR-1199-5p, mmu-miR-669b-5p, mmu-miR-1187, and mmu-miR-1224-5p (Table 1). [score:7]
[1 to 20 of 1 sentences]
76
[+] score: 7
The macrophage inflammation responses to microbial infection involve the upregulation of miR-146 27. [score:4]
MiR-146 exhibits a high expression level on Th1 cells, but not on Th2 cells, relative to the acceleration of Th1 cytokines, thus suggesting that Th1-specific miRNA is related to the acceleration of Th1 cytokines in the immune response 28. [score:3]
[1 to 20 of 2 sentences]
77
[+] score: 7
Over -expression of miR-146b inhibits glioma cell invasion by targeting matrix metalloproteinases (MMPs) [10]. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
miR-522, miR-139-3p, miR-520c-5p, miR-518d-5p, miR-146b-5p, miR-34a, miR-526a, miR-193a-3p, miR-221, miR-4674 were significantly upregulated and miR-760 was downregulated in ECSCs (Figure 2A). [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
Other miRNAs from this paper: mmu-mir-146a, hsa-mir-146a, hsa-mir-146b
Specifically, γδT17 cells were recently found to selectively express high levels of microRNA miR-146, which targets Nod1 to suppress IFN-γ production (65). [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 7
NF-kappaB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. [score:5]
MicroRNA-146 represses endothelial activation by inhibiting pro-inflammatory pathways. [score:2]
[1 to 20 of 2 sentences]
81
[+] score: 6
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-146a, mmu-mir-155, mmu-mir-145b
Taganov KD Boldin MP Chang KJ Baltimore D NF-kappaB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responsesProc. [score:5]
The raw sequencing data of WT, miR-146 [−/−], miR-155 [−/−] and D KO BMMs before and 8 h after LPS stimulation have been deposited in GEO database under the accession number GSE88791. [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 6
The miR-146 expression could be rapidly induced in human acute monocytic leukemia THP-1 cells upon exposure to LPS. [score:3]
Indeed, the first miRNA identified to be modulated by TLR signaling, miR-146, targets TLR signaling molecules IRAK1 and TRAF6. [score:3]
[1 to 20 of 2 sentences]
83
[+] score: 6
Of note, miR-146, which is involved in Th1/Th2 differentiation and is a putative negative regulator of inflammatory conditions [47], was found to be down-regulated late in effector but not central CD8 T cells. [score:5]
In converse, differentiation in the presence of IL-2 down-modulated (green squares) miR-150 and miR-146, albeit the effect on miR-146 was late. [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 6
not significant Many Th1- and Th2-type inflammation-linked miRNAs, including miR-155, miR-146, and miR-324-5p, appear to be conserved in both mouse and human macrophages and are induced by LPS or IL-4, suggesting that the regulation of miRNA expression and function during classic or alternative macrophage activation is conserved [15, 18, 20, 24, 75]. [score:4]
Several miRNAs, such as miR-155, miR-21, and miR-146, are induced in macrophages in response to LPS, suggesting that they have a role in the regulation of macrophage activation and M1-type polarization [14– 18]. [score:2]
[1 to 20 of 2 sentences]
85
[+] score: 6
In contrast, the most significant canonical pathways reflecting the 180 genes predicted to be downregulated by the inflammation related miRNAs (miR-155, miR-146a, miR-146b and miR-15b) are primarily involved in differentiation of myeloid cells and organismal injury. [score:4]
Some of the induced miRNAs included miR-146a, miR-146b and let-7g; all previously reported to be deregulated as part of an acute inflammatory response to infection [39– 41]. [score:2]
[1 to 20 of 2 sentences]
86
[+] score: 6
Furthermore, miR-203 was identified by Steinhilber and colleagues as part of a signature of three miRNA (miR-181a, miR-146b-5p and miR-203) significantly regulated by the C/EBPβ transcription factor, which is specifically overexpressed in ALK(+) ALCL cell lines and shown to promote tumoral cell proliferation and survival (Table 2 and Table 3). [score:4]
In addition, this miRNA is one of the three miRNA (miR-181a, miR-146b-5p and miR-203) regulated by the C/EBPβ transcription factor. [score:2]
[1 to 20 of 2 sentences]
87
[+] score: 6
COPS8 is the only subunit targeted directly by miR-146, but since alteration in the amount of the individual subunits has been shown to affect the amount of other subunits [35, 36], we examined how transfection with miR-146a affected expression of all COP9 signalosome components. [score:6]
[1 to 20 of 1 sentences]
88
[+] score: 6
Analysis revealed significantly increased expression of miR-21-5p, miR-100-5p and miR-146-5p, and decreased expression miR-126-5p, in SIVE. [score:5]
Additionally, we also found two other miRNAs to increase at much lower levels of change and significance, miR-100-5p and miR-146-5p, and one miRNA to be decreased, miR-126-5p. [score:1]
[1 to 20 of 2 sentences]
89
[+] score: 6
To confirm the down-regulation of immune effectors at the protein level we used ELISAs to determine IL-6 and GM-CSF (CSF2) levels upon TLR stimulation in miR-146 over -expressing cells. [score:6]
[1 to 20 of 1 sentences]
90
[+] score: 6
Budd E Andrés MCD Sanchezelsner T Oreffo ROC MiR-146b is down-regulated during the chondrogenic differentiation of human bone marrow derived skeletal stem cells and up-regulated in osteoarthritisSci. [score:6]
[1 to 20 of 1 sentences]
91
[+] score: 6
Moreover, 2 of the miRNA that appeared downregulated after the SOCS3-siRNA therapy (miR-146b and 126) have been previously involved in asthma disease [32], [33]. [score:6]
[1 to 20 of 1 sentences]
92
[+] score: 6
The downregulation of miR-143 and miR-146b has been shown in all types of prostate tumors, which is consistent with our results [31]. [score:4]
In this research, we found 39 microRNAs that were dysregulated after the treatment of morin including miR-143, miR-146b, and miR-155. [score:2]
[1 to 20 of 2 sentences]
93
[+] score: 6
Resolvin D1 upregulates several micro RNAs (miRNAs; e. g., miR-146, miR-219, miR-208) that are involved in NFκB and IL-10 expression in resolution. [score:6]
[1 to 20 of 1 sentences]
94
[+] score: 5
Unlike miR155 and miR146, which have been reported to be aberrantly expressed in many autoimmune diseases [31], little has been reported regarding miR34a. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 5
Furthermore, significantly increased aortic expression of miR-26a, miR-21, miR-126a, miR-132, miR-146 and miR-155 and decreased expression of miR-20a and miR-92a were observed in the vehicle -treated ApoE [−/−] mice. [score:5]
[1 to 20 of 1 sentences]
96
[+] score: 5
Other miRNAs from this paper: mmu-mir-146a, hsa-mir-146a, hsa-mir-146b
Recently, the miRNA-146b, which shows sequence similarity with miR-146a has been shown to inhibit glioma growth in vitro through modulation of its target EGFR [63]. [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
Other miRNAs from this paper: mmu-mir-146a
Additionally, since miR-146a-/- mice still express miR-146b, which shares most of the targets with miR-146a, we cannot discard that miR-146b has a compensatory effect in the setting of atherosclerosis mo del [32]. [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
Other miRNAs from this paper: mmu-mir-125b-2, mmu-mir-146a, mmu-mir-155, mmu-mir-125b-1
Taganov et al. indicate that miR-146 in control of Toll-like receptor and cytokine signaling through a negative feedback regulation loop involving down-regulation of IL-1 receptor -associated kinase 1 and TNF receptor -associated factor 6 protein levels 16. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 5
Recent studies have suggested important regulatory roles for miRNAs such as miR-21, miR-216, miR-217, miR-181b, miR-31b and miR-34a, which were confirmed to be upregulated in senescing HUVECs (Menghini et al., 2009), and miR-146, miR-142-3p, miR-223 and miR-29 family members, which were significantly increased in whole aortas of aged mice (Zhao et al., 2010). [score:5]
[1 to 20 of 1 sentences]
100
[+] score: 5
Other miRNAs from this paper: mmu-mir-146a, hsa-mir-146a, hsa-mir-146b
FOXP3 was found to inhibit tumor cell growth, serving as an important repressor for breast cancer oncogene SKP2 and HER2 [10, 11], and FOXP3–miR-146–NF-kB Axis has been suggested in leading to apoptosis during tumor initiation and tumor suppression in prostate cancer [36]. [score:5]
[1 to 20 of 1 sentences]