sort by

11 publications mentioning bmo-let-7

Open access articles that are associated with the species Bombyx mori and mention the gene name let-7. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 315
lin-4 inhibits the translations of lin-14 and lin-28 by base-pairing to partially complementary sites in the 3'-UTRs of their mRNAs [15, 16], and let-7 has been confirmed to inhibit lin-41's expression in a similar fashion through binding to complementary sites in its 3'UTR [17]. [score:9]
bmo-let-7 was highly expressed at day 1 and day 2, relatively lowly expressed at day 3 and day 5, then again highly expressed at the end of the fifth instar. [score:7]
Ecdysone and the Ecd-inducible gene BR-C are required in the upregulation of some microRNAs including let-7 as well as the downregulation of other microRNAs [22]. [score:7]
When the cells were treated with 3 μM ecdysone, bmo-let-7 was initially up-regulated, then reached a plateau shared by the control at 72 h. Lower level of ecdysone, such as 1 μM, seems to exert diverse influence on bmo-let-7, down -regulating it slightly before 24 h, up -regulating it distinctly from 24 h to 48 h, then down -regulating it again (Fig. 11A). [score:7]
The bmo-let-7 was very lowly expressed in ova harvested from newborn unmated female adult and in individuals from the first molt to the early third instar, highly expressed after the third molt, and the most abundant expression was observed after mounting, particularly after pupation. [score:7]
Seven of ten shared positions are located at the 5' end of the mature sequence, and the other three at the 3' end, consistent with the proposal that the 5' end of the functional small RNA is crucial for the stability and proper loading of let-7 into the miRISC complex though both ends are required for downregulation of a target gene [37]. [score:6]
However, the latest studies showed that lin-4 and one of its target genes, lin-14, also regulate life span in the adult of C. elegans [10], and that let-7 can even be found in the 3 [rd ]instar larvae of C. elegans [11, 12], and may be a master temporal regulator of late larval development in C. elegans [13]. [score:6]
The diverse expression patterns of let-7 family in various species may be responsible for its important role in developmental regulation [19- 21]. [score:5]
Lines of evidence confirmed that bmo-let-7 is temporally and spatially expressed in the silkworm and the expression is in response to the pulse of ecdysone, and might be related to a number of biological processes such as cell proliferation, histogenesis, histolysis, organogenesis and apoptosis. [score:5]
Cell line culture experiments were then carried out in order to test whether ecdysone is required to sustain the expression of bmo-let-7 and how the concentrations of ecdysone are influencing its expression. [score:5]
bmo-let-7 is wi dely expressed in tissues/organs of female and male individuals of the fifth-instar day-3 larvae bmo-let-7 was moderately expressed in female and male individuals at the fifth instar day-3 (Fig. 7B). [score:5]
Different expression profiles in various tissues from the silkworm indicate that bmo-let-7 might not only function in triggering transitions of temporal stages, but more broadly in a variety of metabolisms because each microRNA can control hundreds of target genes [50]. [score:5]
To correlate expression domains with the functions, we determined the tissue specificity of bmo-let-7 expression in various tissues of larvae in day-3 of the fifth instar. [score:5]
Although bmo-let-7 expression is generally response to ecdysone pulse in various tissues as well as in developmental stages, more precise time points and tissues will be investigated to further determine if the expression of bmo-let-7 is directly induced by ecdysone in the silkworm. [score:5]
let-7 was very highly expressed in body wall and fat body, but very lowly expressed in silk gland of the newborn pupa, suggesting that let-7 functions in the histogenesis of body wall and fat body on the basis of the conclusion that lin-4 and let-7 control the timing of cell differentiation and proliferation [50, 56]. [score:5]
As shown in D. melanogaster, let-7 is wi dely expressed in a variety of tissues from prepupae, such as brains, imaginal discs, fat bodies, salivary glands, and Malphigian tubules, with relatively higher levels in fat bodies and imaginal discs, and it was also detected in adult ovaraies and carcasses, suggesting that it could regulate diverse metamorphic processes, such as the terminal differentiation of imaginal discs and apoptosis of salivary glands and fat bodies [14]. [score:4]
During the development of silkworm, ecdysone peak comes several hours before the beginning of each molt, and a fall occurs at ecdysis [38], slightly ahead of scheduel of the expression profile peak of bmo-let-7 in our tests, well supporting the proposal that bmo-let-7 may be induced by the pulse of ecdysone. [score:4]
It could be speculated that ecdysone might be only one of the factors regulating bmo-let-7, and some higher upstream components of the heterochronic pathway could also contribute to its expression. [score:4]
Although no signals were detected during embryonic development and first larval instar stages, the expression of bmo-let-7 was observed from the first molt, suggesting that it might also function at early larval stage of the silkworm. [score:4]
bmo-let-7 was slightly upregulated in the presence of 1 μM ecdysone and most effectively induced by 3 μM ecdysone. [score:4]
Effect of ecdysone change on the expression of bmo-let-7 in cultured cellsThe expression of bmo-let-7 has been systematically investigated in the whole body and tissues or organs during the development of silkworm. [score:4]
The overt roles of lin-4 and let-7 in switching the transition of metamorphosis in other organisms raise the question of whether similar regulatory RNAs are involved in the control of metamorphosis development of B. mori and how the temporal identity conferred by the heterochronic genes is related to the major developmental landmarks that define the silkworm life cycle. [score:4]
Approximately, the general dynamic changes in bmo-let-7 levels is also close to the pulse of Broad-Complext (BR-C) transcriptional factor of silkworm, which is hardly detectable before the fourth instar, lowly expressed in the fifth instar, and largely induced during cocooning and pupation when the ecdysone titer increases [39- 41]. [score:3]
Effect of ecdysone change on the expression of bmo-let-7 in cultured cells. [score:3]
Therefore, the Ecd -induced microRNA, bmo-let-7, is highly expressed in pupae. [score:3]
On the contrary, bmo-let-7 was highly expressed in the female hemocyte but lowly in male hemocyte. [score:3]
The silkworm ovary itself has been confirmed to express bmo-let-7 (Fig. 9), and ovarian cell line BmN-SWU1 was also validated to produce this small RNA even if no ecdysone was added into the culture medium (Fig. 11). [score:3]
Thus, the expression profile of bmo-let-7 in tissues from just mounting to day-3 pupae may reflect its association with histolysis and apoptosis. [score:3]
Figure 8Detailed expression profile of bmo-let-7 during B. mori pupa metamorphosis. [score:3]
bmo-let-7 is wi dely expressed in tissues/organs of female and male individuals of the fifth-instar day-3 larvae. [score:3]
The let-7 temporal expression alterations are in synchronization with the pulse of ecdysone [14], as was further confirmed by our northern blotting results (Figs. 6, 7). [score:3]
The whole larval duration from the first to the fifth instars could be divided into two parts with the boundary at the third instar on the basis of expression level of bmo-let-7 (Figs. 6 and 7), in accordance with the division determined by the pulse of ecdysone in the first four instars [38]. [score:3]
In midgut, however, the expression level of bmo-let-7 reached the maximum at just mounting, and then decreased. [score:3]
This suggests that the expression of bmo-let-7 might be induced by low-level ecdysone but repressed by high-level ecdysone. [score:3]
Figure 9 bmo-let-7 expression profile in tissues from females and males of fifth-instar day-3 larvae. [score:3]
It would be interesting to look at whether the expression of bmo-let-7 RNA could be observed when the embryo cell line would have been incubated for certain length of time in the presence of ecdysone. [score:3]
The individuals at just mounting expressed large amount of bmo-let-7 small RNA (Fig. 8A), but the body wall at this period only showed very weak signal (Fig. 10). [score:3]
A new candidate member (bmo-let-7) of let-7 family in the silkworm (B. mori) was identified by computational approach and its expression was profiled by Northern blotting. [score:3]
Very low-level expression of let-7 can even be observed in the npr [6 ]mutants of Drosophila, which are unresponsive to the ecdysone pulse at the end of the last larval stage (L3) due to the lack of four BR-C isoforms [14]. [score:3]
The distinct differences in the expression of bmo-let-7 imply that some unknown mechanisms responsible for its transcription might be functioning differently in fat body and hemocyte of female and male silkworm. [score:3]
The unfertilized egg (ova) before oviposition removed from the female abdomen gave a weak signal of this microRNA (Figs. 6, 7A-T2), probably due to the slight induction by maternity genes or/and by large amount of free ecdysone in the adult organ, oviduct, which overly expressed bmo-let-7 (Fig. 7A-T1). [score:3]
The expression profile of bmo-let-7 fell at day 7 pupa in female group, and at day 8 in male group, when the ecdysone is also lowly produced [45, 46], then resumed to the maximum just before adult emergence corresponding to the rising ecdysone [46]. [score:3]
During the culture periods, the untreated cells are very likely to produce ecdysone, so we cannot rule out the possibility that the endogenetic and adscititious ecdysones are functioning together in inducing or repressing the expression of bmo-let-7 RNA. [score:3]
Furthermore, various tissues from human also express let-7 RNA, including brain, heart, kidney, liver, lung, trachea, bone marrow, colon, small intestine, spleen, stomach, and thymus, and the lowest level of human let-7 is observed in bone marrow likely due to a large proportion of immature cell in it [8]. [score:3]
Figure 11The effect of concentrations of ecdysone on the expression of bmo-let-7 in cultured cells. [score:3]
It is shown from the cell culture experiment that induction or repression effects of ecdysone on the expression of bmo-let-7 are concentration -dependent. [score:3]
Figure 10 bmo-let-7 expression in male tissues from just mounting to day-3 pupa. [score:3]
The tissue-specificity and the timing of let-7 expression are conserved in invertebrates, suggesting that it could exert wi dely in mediating diverse metamorphic processes [8]. [score:3]
For a better understanding of the conservation and functions of let-7, we seek to explore how it is expressed in the silkworm (Bombyx mori). [score:3]
Probably, it is not the conjugated ecdysteroid but the free ecdysone that functions in inducing the expression of bmo-let-7 and only when the amount of free ecdysone is over a threshold can function properly. [score:3]
In the case of bmo-let-7, we observed a wide expression profile by using of fifteen stage-specific samples across the lifespan of the silkworm (Figs. 5, 6). [score:3]
The high level expression of bmo-let-7 in fat body and other tissues is very likely to be resulted from the ecdysone induction, considering the evidence that the programmed autophagy in the Drosophila fat body is induced by ecdysone [57, 58]. [score:3]
They exert the opposite effects on the expression of temporal miRNA genes, such as mir-34, mir-100, mir-125 and let-7 [22]. [score:3]
After studying the general expression profile of bmo-let-7 across the whole lifespan (Fig. 5) with fifteen samples (Fig. 6), we further investigated its expression patterns at the turning point of each stage. [score:3]
Ecdysone and Broad-Complex are required for the temporal expression of let-7 in Drosophila melanogaster. [score:3]
It is detectable in the silkworm from the early first molt to the adult, suggesting that bmo-let-7 might even function in early larval stages of silkworm let-7 is notably induced at the last larval stage in C. elegans, promoting the transformation from the larva to the adult [9, 11], and highly expressed in the late third instar larvae of D. melanogaster when a pulse of the ecdysone triggers puparium formation and onset of metamorphosis [14]. [score:3]
bmo-let-7 is stage- and tissue-specifically expressed in the silkworm. [score:3]
There was no expression difference between the beginning and the end of spinning stage, implying that bmo-let-7 is unlikely related to the process of spinning. [score:3]
For example, the expression levels of bmo-let-7 were higher at the early first and fourth molts than those at the late first and fourth molts, respectively (Figs. 6, 7A, B). [score:3]
The expression of bmo-let-7 started at the early first molt, remained at low levels until the early third instar, and rapidly reached high level at the early third molt, still increased gradually to the maximum at pupa and imago. [score:3]
At this time, high level expression of let-7 was detected in silk gland and testis; moderate level was observed in midgut and fat body, and a weak signal appeared in head and body wall, suggesting that let-7 also promotes the apoptosis of silk gland and the maturation of testisis, as demonstrated during the metamorphosis in D. melanogaster [14]. [score:3]
bmo-let-7 was moderately expressed in female and male individuals at the fifth instar day-3 (Fig. 7B). [score:3]
As a step towards a better understanding of roles of let-7, we seek to explore whether they exist in silkworm genome and how they are expressed during the life cycle of this insect. [score:3]
Using cultured ovary cell line, BmN-SWU1, we examined the effect of altered ecdysone levels on bmo-let-7 expression. [score:3]
Since bmo-let-7 is undetectable during the development of silkworm's embryo (Figs. 6, 7), the embryo cell line is also unlikely to produce detectable bmo-let-7 RNA. [score:2]
The coordinated changes imply that the developmental transitions of silkworm are more likely to be triggered by the cooperation of ecdysone, BR-C, bmo-let-7 and many other downstream genes. [score:2]
lin-4 and let-7, the two founding members of heterochronic microRNA genes, are firstly confirmed in Caenorhabditis elegans to control the proper timing of developmental programs in a heterochronic pathway. [score:2]
The expression of bmo-let-7 has been systematically investigated in the whole body and tissues or organs during the development of silkworm. [score:2]
Figure 6General profile of bmo-let-7 accumulation during development of silkworm. [score:2]
In Drosophila, let-7 RNA first appears at the end of the third larval instar, a few hours before puparium formation, and reaches high levels during pupal development stage [9, 14]. [score:2]
lin-4 has long been thought to regulate the transition from the first to the second larval stages in C. elegans [5- 7], and let-7 was also confirmed to be undetectable until the last larval stage and functions as a temporal switch promoting the transition from larval to adult stages [8, 9]. [score:2]
Taken together, each upsurge occurs at the turning point between developmental stages before maturing, suggesting that bmo-let-7 is required for the transformation of larval stages. [score:2]
The let-7 small RNA of 22 nt or 23 nt was present in all tissues studied (Fig. 9). [score:1]
For the control cells (0 μM ecdysone), bmo-let-7 RNA level increased straightly during the whole culture time, with a gentle inflexion at 48 h (Fig. 11A ). [score:1]
Although a bevy of let-7 family members exist in various organisms, their dos-a-dos in B. mori has not been described experimentally [31]. [score:1]
let-7 small RNA of silkworm is 22 nt or 23 nt long, and the precursor is 87 nt or 72 nt long. [score:1]
To confirm the reproducible and consistent results, parallel tests were conducted using probes of bmo-let-7 and bmo-let-7*, one of which with only an additional nucleotide at the 3'end. [score:1]
The antisense probes of bmo-let-7 and bmo-let-7* brought out the same results in our sequential and parallel blotting experiments. [score:1]
Eighteen tissues were harvested from females and males of day-3 5 [th ]instar larvae bred at 25°C and 85% H. R. The two antisense probes(anti-bmo-let-7 and anti-bmo-let-7*) were firstly hybridized on different blots, respectively, with equal amount of small RNAs on all loading wells. [score:1]
A new cell line of Bombyx mori, BmN-SWU1, was used to examine the effect on bmo-let-7 caused by different concentrations of ecdysone. [score:1]
5srRNA and U6 were used as the loading controls and levels of bmo-let-7 RNA are quantified relative to U6. [score:1]
The relative levels of let-7 transcript were presented as the ratio of let-7 and U6 or 5srRNA radioactive signals normalized to a 0~1 scale. [score:1]
High level of ecdysone is required to induce some heterochronic genes before molt, and let-7 was also confirmed to be induced by pulse of ecdysone in D. melanogaster [22]. [score:1]
One homology of let-7 in the silkworm genome. [score:1]
Both sequence homology search and miRscan program were used to identify the orthologs of the let-7 gene in the silkworm genome as reported [60, 61]. [score:1]
The wide-range emergence implies that bmo-let-7 not only controls the metamorphosis from late laval stage to the pupa, as do the other members in let-7 family confirmed in C. elegans [9, 13] and D. melanogaster [8, 14], but might even function in the early larval stages of silkworm. [score:1]
The small RNAs were harvested and two probes for bmo-let-7 were used in the detection of Northern blot. [score:1]
The extending let-7 family shares common "miRNA seed" and represents restricted species diversitiesThere have been over 90 members so far in let-7 family that contains about 30 different mature sequences, ranging in length from 19 nt to 22 nt. [score:1]
C. briggsae, C. elegans, B. mori, D. melanogaster, D. pseudoobscura and A. gambiae are Ecdysozoa, Protostomia, and all let-7 precursors of them are clustered in the same clade (Fig. 4). [score:1]
Twelve positions exhibit exchangeable if the mature seqence of cel-let-7, 5'-UGAGGUAGUAGGUUGUAUAGUU-3' (MIMAT0000001), is used as the reference, U at 5' end being position 1. For example, it is A at position 1 in five let-7d members, G at position 10 in three let-7e members, and U at position 10 in three other let-7d members. [score:1]
Sequences from 5' to 3' ends: bmo-let-7 antisense, TACTATACAACCTACTACCTCA; bmo-let-7 sense, TGAGGTAGTAGGTTGTATAGTA; bmo-let-7* antisense, TACTATACAACCTACTACCTCAA; bmo-let-7* sense, TTGAGGTAGTAGGTTGTATAGTA; cel-lin-4 antisense, TCACACTTGAGGTCTCAGGGA cel-lin-4 sense, TCCCTGAGACCTCAAGTGTGA U6 antisense, GCAGGGGCCATGCTAATCGTCTCTGTATCG; 5srRNA antisense, GTACTGACCACGCCCGATGTTGCTTGACTT Both sequence homology search and miRscan program were used to identify the orthologs of the let-7 gene in the silkworm genome as reported [60, 61]. [score:1]
The mature sequence, either bmo-let-7 or bmo-let-7*, is on the 5' arm of the foldback precursor (Fig. 1). [score:1]
Ninety known let-7 members together with bmo-let-7 were aligned using the CLUSTAL × program, then were submitted to logo analysis by using the WebLogo program available [66]. [score:1]
Levels of bmo-let-7 are quantified relative to the loading control, 5srRNA. [score:1]
U6 and 5srRNA hybridizations were used as loading controls and levels of let-7 RNA are quantified relative to U6. [score:1]
It is detectable in the silkworm from the early first molt to the adult, suggesting that bmo-let-7 might even function in early larval stages of silkworm. [score:1]
Figure 2Sequence logo of known let-7 family members. [score:1]
For example, ssc-let-7 is three nucleotides shorter than the control sequence and twenty-two members are one nucleotide shorter than the norm sequence (Figs. 2, 3). [score:1]
However, the mechanism of how bmo-let-7 responds to ecdysone and Broad-Complex pathways in the silkworm is worthy of further study. [score:1]
Both let-7 and ecdysone may be crucial for the transformation of larval stages [14]. [score:1]
The extending let-7 family might have evolved from a common ancient precursor. [score:1]
By using of BLASTN based on sequence homology, we identified one orthologue of let-7 in the silkworm genome, which was named bmo-let-7 according to a common criterion (Bombyx mori, bmo-) [31]. [score:1]
let-7 RNA is consistently detectable in samples from diverse animal phyla, including chordates, hemichordates, echinoderms, mollusks, annelids, and arthropods, but cannot be found in basal metazoans, such as cnidarians and poriferans, as well as in plants and unicellular organisms [8, 18]. [score:1]
Two small noncoding RNAs, lin-4 and let-7, are essential components of the heterochronic pathway dictating temporal decisions of cell fate from one stage to the next [4]. [score:1]
Twenty-six of all known let-7 members were selected in terms of sequence- and species-specific and aligned against each other by a Smith-Waterman algorithm. [score:1]
The results suggested that bmo-let-7 generally responds to the pulse of ecdysone. [score:1]
bmo-let-7 was undetectable in diapause eggs (data not shown) because of very low free ecdysteroid fraction [42]. [score:1]
U6 and 5srRNA hybridizations were used as loading controls and levels of let-7 RNA are quantified relative to 5srRNA. [score:1]
Figure 7Detailed profile of bmo-let-7 accumulation from ova to the late fifth instar. [score:1]
Figure 1 Stem-loop structures of alternative forms of bmo-let-7 precursor. [score:1]
However, after treated with 5 μMecdysone, bmo-let-7 RNA level was almost always stable during the whole examined span of 72 h, and dramatically decreased in the presence of 10 μM. [score:1]
let-7 has been thought to trigger the onset of adulthood across animal phyla. [score:1]
DNA oligonucleotides complementary to predicted candidate bmo-let-7, cel-lin-4, U6 RNA and 5srRNA were synthesized (Sangon, Shanghai). [score:1]
Homo sapiens, Fugu rubripes, Danio rerio, Xenopus tropicalis, Bos taurus belong to Chordata Deuterostomia, and let-7 precursors of them, except for has-let-7 and ssc-let-7, are clustered in one clade. [score:1]
The mature let-7 sequences of C. elegans and D. melanogaster were downloaded from the miRbase [62], and were used as query sequences to BLASTN against the silkworm genome in NCBI with default parameters and a non-stringent cutoff of E > 1.8 [60]. [score:1]
In order to be convenient for analysis, we selected 26 representative let-7 precursors. [score:1]
The extending let-7 family shares common "miRNA seed" and represents restricted species diversities. [score:1]
Figure 4 Phylogenetic tree based on the selected precursors of let-7 family members. [score:1]
Figure 3Sample clusters of known precursors of let-7 family members based on sequence similarity. [score:1]
One homology of let-7 in the silkworm genomeBy using of BLASTN based on sequence homology, we identified one orthologue of let-7 in the silkworm genome, which was named bmo-let-7 according to a common criterion (Bombyx mori, bmo-) [31]. [score:1]
Sequences from 5' to 3' ends: bmo-let-7 antisense, TACTATACAACCTACTACCTCA; bmo-let-7 sense, TGAGGTAGTAGGTTGTATAGTA; bmo-let-7* antisense, TACTATACAACCTACTACCTCAA; bmo-let-7* sense, TTGAGGTAGTAGGTTGTATAGTA; cel-lin-4 antisense, TCACACTTGAGGTCTCAGGGA cel-lin-4 sense, TCCCTGAGACCTCAAGTGTGA U6 antisense, GCAGGGGCCATGCTAATCGTCTCTGTATCG; 5srRNA antisense, GTACTGACCACGCCCGATGTTGCTTGACTT Shiping-Liu conceived the study, reared and harvested all the samples, carried out the Northern blotting experiments, performed the computational prediction and drafted the manuscript. [score:1]
5srRNA and U6 were used as the loading controls and levels of bmo-let-7 RNA are quantified relative to 5srRNA. [score:1]
There have been over 90 members so far in let-7 family that contains about 30 different mature sequences, ranging in length from 19 nt to 22 nt. [score:1]
B. mori belongs to Insecta, Arthropoda, and bmo-let-7 precursor is clustered with those of other insects, accordingly. [score:1]
The conserved fragments on both arms of the precursors and the variations in loop regions support the hypothesis that an ancient precursor of the let-7 genes may have been common to the earliest animal lineages [18]. [score:1]
The extending let-7 family might have evolved from a common ancient precursor C. briggsae, C. elegans, B. mori, D. melanogaster, D. pseudoobscura and A. gambiae are Ecdysozoa, Protostomia, and all let-7 precursors of them are clustered in the same clade (Fig. 4). [score:1]
Twenty-six selected let-7 members and the sequences of their precursors were aligned into phylogenetic tree by using MEGA v3.0 [67]. [score:1]
One member of let-7 family has been identified in silkworm computationally and experimentally. [score:1]
[1 to 20 of 128 sentences]
2
[+] score: 36
Our results show that miRNAs display a wide variety of expression profiles over the whole life of the silkworm, including continuous expression from embryo to adult (miR-184), up-regulation over the entire life cycle (let-7 and miR-100), down-regulation over the entire life cycle (miR-124), expression associated with embryogenesis (miR-29 and miR-92), up-regulation from early 3 [rd ]instar to pupa (miR-275), and complementary pulses in expression between miR-34b and miR-275. [score:18]
miR-100 and let-7 were up-regulated from 1 [st ]instar to 3 [rd ]molt, maintained over the 4 [th ]and 5 [th ]larval stages (Additional file 7), and highly expressed from early to late 4 [th ]instar larvae and fifth-instar day 2 and day 7 larvae (Figure 3C). [score:6]
Simultaneous expression of miR-125 and let-7 during Drosophila development is synchronized with the high- titer ecdysone pulses that initiate metamorphosis [62]. [score:4]
In contrast, both microarray and analyses confirmed that let-7 and miR-100 were coordinately up-regulated, gradually accumulating from late 1 [st ]molt until the 3 [rd ]molt stage (Figure 1A, C, Additional file 4). [score:4]
In contrast, miR-100 and let-7 were initially expressed in late 2 [nd ]instar larvae, and accumulated to high levels in late 3 [rd ]molt larvae, with obvious fluctuations during the early larval stages. [score:3]
Small and large miRNA transcripts were detected in pre-laid eggs and embryos, and were identified as miR-8, miR-252 and let-7 (indicated with a red arrow in Figure 2B). [score:1]
[1 to 20 of 6 sentences]
3
[+] score: 22
Liu et al. (2010a) were the first to report spatial expression patterns of nearly 100 miRNAs in multiple normal tissues of female and male B. mori using microarray and northern-blotting analyses, in which only 10 miRNAs were detected to express in universal tissue types of the B. mori, such as bmo-let-7 and bmo-bantam, whereas the majority were distributed exclusively or preferentially in specific tissues, such as bmo-miR-275 and bmo-miR-1. Other experimental protocols commonly used to detect miRNA expressions are polymerase chain reaction (PCR) technology, polyacryla-mide gel electrophoresis (PAGE)/northern blotting, and real-time PCR (qPCR). [score:7]
Using a dual luciferase reporter gene assay, they then predicted and verified that let-7 had target sites on the respective 3-UTRs of Ras1, Ras2, and Ras 3. To verify the regulation function of Bmo-miR-9a on the expression of Bm-ase gene, Song et al. (2013) constructed a Bmo-miR-9a over -expressing vector and Bm-ase 3'UTR fused firefly lucif-erase gene reporter plasmid, respectively. [score:7]
Cloning of let-7 target genes and inducing of ecdysone on bmo-let-7 in silkworm cell lines. [score:3]
Autoregulation of microRNA biogenesis by let-7 and Argonaute. [score:2]
Liu et al. (2012) combined the Ras 3-UTR with reporter gene vectors, which were co -transfected in Sf9 cells together with let-7 mimics. [score:1]
Based on the online software RNAhybrid and MirTif, screening for the predicted binding sites, Liu et al. (2012) obtained predictions about the binding site of let-7 in the Ras 3'-UTR and found in Ras 1, Ras 2 and Ras 3 there were two, two, and five binding sites, respectively. [score:1]
Functional study of bmo-let-7 in the pupation of silkworm, Bombyx mori. [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 21
For instance, in Drosophila melanogaster, mir-3, mir-4, mir-5, and mir-6 are down-regulated in the transition from embryo to larva, whereas mir-100, mir-125, and let-7 are up-regulated from larva to pupa [39]. [score:7]
Since lin-4 and let-7 were found to regulate development in C. elegans [15], [16], ample reports have suggested that miRNAs play significant regulatory roles under physiological (such as development) and pathological (such as cancers) conditions in plants, flies, fishes, and mammals [14], [17], [18], [19], [20], [21]. [score:5]
This result also coincides with the expression pattern of bmo-let-7 reported previously [74], which revealed that the expression level of bmo-let-7 is higher at the beginning of each molt than at other periods. [score:5]
Similar to lin-4 and let-7 of Caenorhabditis elegans, the majority of miRNA genes are transcribed as independent transcriptional units [4], [8], [9] albeit a few of them were found in introns of pre-mRNAs and co-expressed with their host genes [5], [10], [11], [12], [13]. [score:3]
We also discovered six pairs that are organized as clusters; bmo-miR-1/bmo-miR-133, bmo-let-7/bmo-miR-100, bmo-miR-12/bmo-miR-283, and bmo-miR-275/bmo-miR-305 are separated by less than 20 kb apart and in the same orientation; bmo-miR-9b overlaps with bmo-miR-79 on the opposite strand; and bmo-miR-2 is adjacent to bmo-miR-13 but on the reverse strand in a tail-to-tail orientation about some twenty basepairs away. [score:1]
[1 to 20 of 5 sentences]
5
[+] score: 17
The most abundantly expressed miRNAs in B. mori are also highly conserved miRNAs e. g, miR-1, miR-8, miR-10, let-7, miR-263a, miR276a, and miR-306 and were expressed in all four stages, albeit their expression levels vary across different developmental periods. [score:8]
Differential expression of let-7 family members during development. [score:4]
Our sequence analysis revealed the expression of at least eight members of the let-7 family (let-7a, -7b, -7c, -7d, -7e, -7f, -7 g and -7j) in B. mori (Table 3). [score:3]
Since let-7 family is represented by eight members in the silkworm, each of which differed by one nucleotide, which makes distinguishing difficult by the hybridization -based approach. [score:1]
It includes miR-1, the entire family of miR-2, the miR-9 family (miR-9 and miR-9b), the let-7 family (let-7a, let-7j), miR-10b, miR-31, miR-71, miR-79, miR-87, miR-98, miR-100, miR-252, miR-263a, miR-275, miR-279, miR-317 and miR-1274b (Table 3 and Figure 4a). [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 15
Experiments with alternative probes on females and males confirmed upregulation of let-7 in the body wall, silk glands and fat body, but some fluctuations in the midgut; its expression changes in these tissues further support its potential roles in histolysis and histogenesis [29]. [score:6]
The first members of the miRNA family discovered in invertebrates, lin-4 and let-7, are expressed in Caenorhabditis elegans at distinct stages of development and regulate the timing of larval transition through cell-fate decisions [8, 10]. [score:5]
In all, only 10 miRNAs were universally distributed (including bmo-let-7 and bmo-bantam), while the majority were expressed exclusively or preferentially in specific tissue types (e. g., bmo-miR-275 and bmo-miR-1). [score:3]
However, only the spatial expression patterns of let-7 have been extensively characterized in the silkworm to date [29]. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 8
We also detected that let7 family miRNA Bmo-let-7-5p was significantly up-regulated. [score:4]
As it is wi dely recognized that let7 can regulate the embryonic development, Bmo-let-7-5p may be a regulator in the termination of diapause process. [score:4]
[1 to 20 of 2 sentences]
8
[+] score: 6
The let-7 miRNA family contains the most members; 77 let-7 family members were identified in miRBase [see Figure S3 of Additional file 1]. [score:1]
Figure 3 shows the multi-alignment of the members of miRNA let-7 family. [score:1]
Of the 355 Arthropod miRNAs that have been identified, only 21 are B. mori miRNAs that were predicted computationally; of these, only let-7 has been confirmed by. [score:1]
Sequence analyses have shown that some mature miRNAs are phylogenetically conserved, particularly in the first 8 residues at the 5' end in species of the same kingdom (let-7 miRNAs are present in the human, mouse, rat, cow, dog, pig, chimpanzee, monkey, fish, and various insects, including Bombyx mori (B. mori)) [21]. [score:1]
The first miRNA genes, lin-4 [5] and let-7 [6], were identified in Caenorhabditis elegans about a decade ago. [score:1]
Of the 355 Arthropod miRNAs identified, 21 are B. mori miRNAs that were predicted computationally by our research group [19]; of these, only let-7 has been confirmed by [35, 36]. [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 3
The contrary results were found among bmo-let-7, bmo-miR-1, bmo-miR-100, bmo-miR-124, bmo-miR-137, bmo-miR-14, bmo-miR-252, bmo-miR-275, bmo-miR-305, bmo-miR-307, bmo-miR-34, and bmo-miR-279c, where the literature -based collections showed higher expression levels (Additional file 12: Table S7). [score:3]
[1 to 20 of 1 sentences]
10
[+] score: 3
Among these, several conserved miRNAs such as bmo-bantam and bmo-let-7 were highly abundant suggesting that these conserved miRNAs may have important regulatory roles in Bombyx mori. [score:2]
Further analysis suggested that conserved miRNAs such as bmo-bantam, bmo-let-7, bmo-miR-31, bmo-miR-8 were in general highly abundant. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 1
Since the discovery of first miRs, lin-4 and let-7 from Caenoharbditis elegans [1, 2, 3] hundreds of miRs have been identified to date [4]. [score:1]
[1 to 20 of 1 sentences]