sort by

2 publications mentioning bta-mir-487a

Open access articles that are associated with the species Bos taurus and mention the gene name mir-487a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 10
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-27a, bta-mir-320a-2, bta-mir-99a, bta-mir-125a, bta-mir-181a-2, bta-mir-27b, bta-mir-10a, bta-mir-139, bta-mir-140, bta-mir-181b-2, bta-let-7d, bta-mir-124a-1, bta-mir-181c, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-154a, bta-mir-181d, bta-mir-184, bta-mir-206, bta-mir-29d, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-486, bta-mir-495, bta-mir-95, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2286, bta-mir-2300a, bta-mir-2300b, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2319a, bta-mir-2319b, bta-mir-2284n, bta-mir-2284g, bta-mir-2329-1, bta-mir-2329-2, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2396, bta-mir-2285c, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2443, bta-mir-2284h, bta-mir-2450c, bta-mir-2450b, bta-mir-2450a, bta-mir-2404-2, bta-mir-2284o, bta-mir-2484, bta-mir-2284e, bta-mir-320a-1, bta-mir-2887-1, bta-mir-2887-2, bta-mir-2284w, bta-mir-3431, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-574, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-503, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac, bta-mir-3432b, bta-mir-2450d
In addition, miR-206, miR-1, and miR-320 were up-regulated during MDSC differentiation; miR-495, miR-133b, and miR-487 were down-regulated in MDSC-D1 and upregulated in MDSC-D3. [score:10]
[1 to 20 of 1 sentences]
2
[+] score: 2
18; v) bta-miR-487a, bta-miR-487-b, bomiR-382 and bomiR-409 on Chr. [score:1]
04.152:123191: 123211:1 [h] Intronic bomir-C1931-5p 23 gma-miR1523 1 +CCUGCUGAUCUCACAUUAAUUCA26:12405838: 12405860:1 [h] Intergenic bomir-A2143-3p 18 oan-miR-181c* 1 +CGGCAGAUGAAGUCCAUC16:47801336: 47801353:1 [h] Intronic bomir-F2422-5p 20 hsa-miR-659 1 +GGUGGGAGGGUCCCACCGAG18:53584142: 53584161:1 [h] Intragenic bomir-F2531-3p 18 ppt-miR1030i 3 +UGGUGGAGAUGCCGGGGA8:77307661: 77307678:1 [g] Intergenic bomir-G2511-3p 18 bmo-miR-92 1 +AGGCGGGCCGGGGUUGGA18:41190536: 41190553:1 [h] Intergenic bomir-E2664-3p 20 mml-miR-638 1 -AGGGCGGGCGGCGACUGGAA18:64361001: 64361020:-1 [h] Intragenic bomir-D3011-3p 21 mml-miR-650b 1 +CCGAGUGCUCCCGCGAGCGCU18:39424938: 39424958:1 [g] Intragenic bomir-A3341-1-3p 22 bta-miR-487a 1 +GUGGCUGUCCCUGGAGGUGGG3:124988008: 124988028:1 [h] IntergenicUn. [score:1]
[1 to 20 of 2 sentences]