sort by

31 publications mentioning bta-mir-17

Open access articles that are associated with the species Bos taurus and mention the gene name mir-17. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 62
It was hypothesized that the elevated expression observed for miR-17-5p in serum samples collected from acutely as well as persistently infected cattle could indicate that this miRNA was either induced by FMDV infection to benefit virus replication, or, induced as a consequence of the host response aiming to suppress virus infection. [score:5]
Of the miRNAs that were significantly up- or down-regulated, five were shared between acutely and persistently infected cattle (bta-miR-17-5p, bta-miR-144, bta-miR-497, bta-miR-22-5p, and bta-miR-1281). [score:4]
The miRmap algorithm reported that 6 of the 19 miRNAs dysregulated in bovine serum in response to FMDV could potentially target different regions of the FMDV A24 Cruzeiro RNA genome: bta-miR-17-5p, bta-miR-497, bta-miR-146a, bta-miR-1224, bta-miR-31, and bta-miR-150. [score:4]
The up-regulated miRNA species included bta-miR-17-5p, bta-miR-146a, bta-miR-144, bta-miR-34a, bta-miR-369-3p, bta-miR-497, and bta-miR-22-5p (Table  2 and Fig.   2a). [score:4]
The three most up-regulated miRNAs were bta-miR-17-5p (+35.88 fold increase), bta-miR-146a (+34.36 fold increase), and bta-miR-144 (+28.78 fold increase) (Table  2). [score:4]
Only one of the immune modulatory miRNAs was shared between the two sets: bta-miR-17-5p, which was significantly upregulated during both acute and persistent FMDV infection. [score:4]
From these findings, it could be inferred that the induction of miR-17-5p in vivo might manipulate the cellular environment such that it favors FMDV replication, while miR-1281 is down-regulated due to an antagonistic effect. [score:4]
As with the bioinformatics analysis conducted to identify prospective gene targets for miR-17-5p and miR-1281, a consensus target gene for miR-455-3p was not found to further investigate (Additional file 2: Table S1). [score:3]
Of the miRNA species detected, miR-17-5p and miR-1281 were selected as they were among the 5 miRNA that showed similar differential expression in two different animal sets: acutely infected cattle (Table  2 and Fig.   2) and persistently infected cattle (Table  3 and Fig.   2). [score:3]
Additionally, miR-17-5p has been implicated in T-cell activation, B-cell and monocyte maturation as well as with suppression of TLR signaling and hampering of the IFN response [16, 57, 58], which are important functions of the host anti-viral response. [score:3]
bta-miR-17-5p was highest expressed during acute infection, whereas bta-miR-31 was the highest during FMDV persistence. [score:3]
miR-17-5p was included in the second experimental set in panel b to confirm the non-effect seen in panel a In a separate experiment, we investigated the potential impact of one of the down-regulated miRNAs that was common to both acutely and persistently infected cattle, miR-1281, on the progression of FMDV infection in vitro. [score:2]
miR-17-5p was included in the second experimental set in panel b to confirm the non-effect seen in panel a In a separate experiment, we investigated the potential impact of one of the down-regulated miRNAs that was common to both acutely and persistently infected cattle, miR-1281, on the progression of FMDV infection in vitro. [score:2]
Of the differentially regulated miRNAs, 16 (bta-miR-23b-5p, let-7 g, bta-miR-22-5p, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-455-3p, bta-miR-154a, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, and bta-miR-31) have previously been described to play a role in cellular proliferation or apoptosis (Fig.   6b, orange circle). [score:2]
Mimics of miR-17-5p and miR-1281 were separately tested for their effect on FMDV replication in cell culture (Fig.   5). [score:1]
While miR-17-5p had no apparent impact on the progression of FMDV infection, mimics of miR-1281 decreased the resulting FMDV titers by 2–3 logs. [score:1]
b Cells were transfected with miR-1281 mimics following the same procedure as miR-17-5p (a). [score:1]
In the in vitro experiment, there was no impairment to virus replication in cells transfected with miR-17-5p prior to FMDV infection, and virus titers produced were nearly identical to that of the negative controls (untransfected cells and cells transfected non-sense miRNA mimics [miR-NC]) used in the experiment (Fig.   5a). [score:1]
Fig. 5Effect of miR-17-5p and miR-1281 mimics on FMDV infection in cell culture. [score:1]
Nine of the miRNAs (bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, bta-miR-31, bta-miR-150, and bta-miR-147), have been ascribed immune modulatory functions (Fig.   6b, blue circle). [score:1]
LFBK-αvβ6 cells were grown to approximately 30–40% confluence and transfected with mimics to miR-17-5p, miR-1281 (Thermo Scientific, Waltham, MA), a non-sense negative control miR (miR-NC), a control miR-342-5p that does not impact FMDV infection, or left untransfected following the RNAiMAX (Thermo Scientific, Waltham, MA) transfection method (manufacturer’s protocol). [score:1]
Effect of miR-17-5p and miR-1281 on the progression of FMDV infection in vitro. [score:1]
Eleven of the miRNAs are encoded in intergenic regions, including: bta-miR-1281, bta-miR-150, bta-miR-181b, bta-miR-497, bta-miR-144, bta-miR-34a, bta-miR-154a, bta-miR-146b, bta-miR-17-5p, bta-miR-205, and bta-miR-31. [score:1]
As shown in the top portion of Table  3: bta-miR-22-5p, bta-miR-147, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-154a, bta-miR-17-5p, bta-miR-205, and bta-miR-31, with fold changes of 2.17, 5.28, 5.69, 23.78, 24.62, 24.05, 40.84, 41.22, and 43.37, respectively. [score:1]
To that end, mimics of miR-17-5p were transfected into LFBK-αvβ6 cells, a cell line commonly used for FMDV propagation [37, 38]. [score:1]
a Cells were transfected with miR-17-5p mimics in parallel with negative controls: untransfected and irrelevant miR-342-5p. [score:1]
As described for miR-17-5p above, mimic molecules of miR-1281 were transfected into LFBK-αvβ6 cells and 2 days post-transfection, the cells were infected with FMDV A24 Cruzeiro. [score:1]
The remaining 8 miRNAs (bta-miR-497, bta-miR-144, bta-miR-181b, bta-miR-22-5p, bta-miR-23b-5p, bta-miR-17-5p, bta-miR-154a, and bta-miR-369-3p) detected in this study were found to be clustered. [score:1]
It is interesting to note that six of the 19 miRNAs described in this study are considerably abundant in cattle liver: bta-miR-22-5p, bta-miR-150, bta-miR-17-5p, bta-miR-455-3p, bta-miR-146, and let 7-g [64]; an organ in which FMDV does not establish infection. [score:1]
[1 to 20 of 29 sentences]
2
[+] score: 57
miRNA-target chimeras also significantly predicted functional miR-17 regulation, although the most conservative bioinformatic parameters, such as the presence of 8mer seed sites or the highest TargetScan scores, were better predictors of the most highly regulated genes. [score:7]
This confirmed a number of known functions e. g. of the let-7 family in suppressing embryonic development and cell cycle progress 22, 23, and the miR-17 family in suppressing cell cycle arrest 24, 25. [score:6]
Due to expression of miR-17 and -20 from the miR-17~92 cluster that also contains miR-18, -19 and -92a, and the parallel expression of the other family members miR-93 and -106 from other clusters, careful delineation of the function of individual families and family members remains to be done. [score:5]
The miR-17 family, and to some extent also miR-19, in contrast suppresses cell cycle arrest and there is some evidence for targeting kinases like MAPK14 24, 25. [score:5]
As previously shown for other miRNAs, simply predicting miR-17 targets using TargetScan identified de-repressed mRNAs, although only mRNAs with context++ scores <(−0.25) were significantly de-repressed (Fig.   3d). [score:5]
Experiments with cells infected with bovine viral diarrhea virus (BVDV), which sequesters miR-17 [14], or cells treated with miR-17 inhibitor were included for identification of interactions. [score:3]
Finally, combining predictors markedly increased prediction of de-repression with median log [2] fold changes of 0.17 and 0.22, respectively, for significant peaks combined with the presence of miR-17 chimeras or TargetScan predictions (Fig.   3e). [score:3]
Similarly, the presence of miR-17 chimeras was predictive for regulation with a median log [2] fold change of of 0.03 (Fig.   3b and Supplementary Fig.   S3d). [score:2]
Nonetheless, the most powerful prediction of regulatory miR-17 sites came from combining experimental and bioinformatic approaches (Fig.   3). [score:2]
Figure 3Comparison of experimental and bioinformatic predictors of miR-17 regulation. [score:2]
To evaluate how accurately miRNA chimeras predict valid regulatory miRNA interactions, we performed mRNA-seq on MDBK cells treated with the miR-17 family (miR-17, -20, -93 and -106) inhibitor, tinyLNA-17, and analyzed changes in steady state RNA levels across the transcriptome (Supplementary Table  S5). [score:2]
Here, using miRNA chimeras to predict BVDV miR-17 “sponge” regulated genes we confirmed the finding with even higher statistical significance. [score:2]
txt fasta output/bta-miR-17-5p/ -fasta background/bta-miR-17-5p. [score:1]
txt -mcheck motifs/bta-miR-17-5p. [score:1]
Chimeras representing canonical miR-17 interactions were predictive both on 3′ UTRs and coding sequence (CDS); whereas there was a trend for non-canonical chimeras this was not statistically significant (Fig.   3c). [score:1]
Type Gene ceRNA Ann cow miRNA MDBK 3′UTR miRNA chimeras Non-coding H19 Yes let-7 let-7 Coding PTEN PTENP1 No miR-21 Various miRNAs, mostly miR-27 CNOT6L Yes miR-17, miR-19 miR-17 and miR-25 VAPA Yes miR-17, miR-19 miR-17 ZEB2 Yes miR-26, miR-25 None KRAS KRAS1P Yes let-7 let-7 present, but mostly miR-27 and miR-222 HMGA2 No let-7 let-7 TGFBR3 No let-7 let-7 peak in exon, miR-15, -17, -21, -27 and -31 peaks in 3′UTRDefinitions of previously described ceRNAs in human or mouse were obtained from ref. [score:1]
pl ACTACCTGCACTGTAAGCACTTTA 0 bta-miR-17-5p> motifs/bta-miR-17-5p. [score:1]
These were however excluded in analyses of individual miRNA profiles since these manipulations led to underrepresentation of miR-17 interactions (Supplementary Table  S1). [score:1]
miRNA chimeras predict transcriptome changes induced by miR-17 sequestration. [score:1]
By analyzing AGO-bound miRNAs in MDBK cells, we found the abundance profile dominated by members of the miR-30, let-7, miR-17, miR-374, miR-21, miR-27 and miR-15 families together accounting for more than 50% (Supplementary Fig.   S2a) [14]. [score:1]
The presence of a miR-17 7- or 8mer, but not 6mer, seed site within significant CLIP peaks was robustly predictive for mRNA de-repression, in particular if the seed was present in 3′ UTRs (Fig.   3a and Supplementary Fig.   S3a-c). [score:1]
pl foreground/bta-miR-17-5p. [score:1]
BVDV specifically sequestrates miR-17, and we previously showed that robust infection leads to a functional de-repression of mRNAs with miR-17 8mer related AGO-CLIP peaks [14]. [score:1]
Interestingly, miRNA families encoded by the same cistron, such as miR-23, -24 and -27 or miR-17, -19 and -25, did not preferentially cooperate. [score:1]
Combining presence of CLIP peaks and miR-17 chimeras led to a marginally increased prediction (Fig.   3f). [score:1]
[1 to 20 of 25 sentences]
3
[+] score: 45
Overall miR-140 was found to have the most putative targets among differentially expressed genes under SNEB while miR-17-5p had the second highest number of targets. [score:7]
miR-140 had the highest number of putative down-regulated target genes followed by miR-17-5p. [score:6]
DSG1 (desmoglein1) and FXR1 (fragile X mental retardation, autosomal homolog 1) are both shared targets of miR-17-5p and miR-31 while GNS (glucosamine-N-acetyl-6-sulfatase) is a shared target of mir-140 and miR-31 (Figure  2). [score:5]
Five miRNAs including miR-17-5p, miR-31, miR-140, miR-1281 and miR-2885 were validated using RT-qPCR, to be up-regulated under SNEB. [score:4]
These include the miR-17-5p target GPR37 (G protein-coupled receptor 37) a member of the G-protein coupled receptor-1 family associated with NAFLD [61]. [score:3]
The miR-17-5p target GNS (glucosamine (N-acetyl)-6-sulfatase) that metabolises glucosamine sulphate has been implicated in hepatocellular dysplasia, cirrhosis of the liver and hepatic fibrosis [66]. [score:3]
miR-140 and miR-17-5p are known to show differential expression under oxidative stress. [score:3]
Seven candidate miRNAs differentially expressed on the microarray; including miR-17-5p, miR-31, miR-140, miR-1281, miR-2885, miR-296, and miR-671 were selected for RT-qPCR validation. [score:3]
Moreover, the miR-17-5p target TTR, a carrier protein for transport of lipid soluble vitamins from the liver to the circulation is also reduced under SNEB. [score:3]
The expression of miR17-5p, -1281, -140, 2885 and -31 were consistent between microarray and RT-qPCR whereas miR-296 and miR-671 were not significant. [score:3]
miR-17-5p is associated with GO biological processes include regulation of cell cycle and protein metabolism. [score:2]
A regulatory role for miR-17-5p has been reported in HCC [55, 56] while miR-31 has also been associated with both NAFLD and HCC [58- 60]. [score:2]
Two of these miRNAs have been reported to be altered under oxidative stress in humans [41, 54] and miR-17-5p has been associated with oxidative stress in HCC [41]. [score:1]
[1 to 20 of 13 sentences]
4
[+] score: 34
The mRNA expression of actin -binding protein PFN2, the potential target of miR-17-5p, miR-19a, miR-30b-5p, miR-142-5p, miR-301a, and miR-2478, also tended to be downregulated in the grazing cattle compared to the grain-fed cattle (P = 0.064), as did the potential miR-29b targets DNAJB2 (P = 0.021) and COL3A1 (P = 0.100). [score:9]
The potential targets of downregulated c-miRNAs were associated with protein phosphorylation and phosphate metabolism (miR-17-5p), endocytosis (miR-19a, miR-301a), mTOR signaling (miR-19a), MAPK signaling (miR-19a, miR-98), ECM-receptor interaction and adipocytokine signaling (miR-29b), skeletal muscle tissue development (miR-30b-5p), blood vessel development and morphogenesis, and regulation of actin cytoskeleton (miR-301a). [score:9]
Next, we analyzed the muscle tissue expression of the 11 miRNAs that differed significantly between the groups (miR-10b, miR-17-5p, miR-19a, miR-29b, miR-30b-5p, miR-98, miR-142-5p, miR-301a, miR-374b, miR-425-5p, and miR-652) to determine whether or not c-miRNA expression was associated with that of skeletal muscle tissue miRNAs. [score:5]
The expression of PTEN, the potential target of miR-10b, miR-17-5p, miR-19a, miR-29b, miR-30b-5p, miR-142-5p, miR-301a, miR-652, and miR-2478, was lower in the grazing cattle than in the grain-fed cattle (P = 0.011). [score:5]
In the present study, muscle PTEN and PFN2 were the predicted targets of most of the altered c-miRNAs (miR-17-5p, miR-19a, miR-30b-5p, miR-142-5p, miR-301a) between the feeding conditions, as well as miR-10b. [score:3]
Of those miRNAs, the contents of miR-652, miR-30d, miR-301a, miR-345-5p, miR-374b, miR-425-5p, miR-23b-3p, miR-30b-5p, miR-17-5p, miR-98, miR-28, and miR-874 were lower in the plasma of the grazing cattle than in that of the grain-fed cattle, whereas the contents of miR-10b, miR-2368-3p, miR-885, and miR-2425-3p were higher in the plasma of the grazing cattle. [score:1]
In contrast, the grazing cattle showed significantly lower contents of miR-17-5p (P = 0.031), miR-19a (P = 0.007), miR-29b (P = 0.021), miR-30b-5p (P = 0.035), miR-98 (P = 0.006), miR-142-5p (P = 0.013), miR-301a (P = 0.005), miR-374b (P = 0.016), miR-425-5p (P = 0.010), and miR-652 (P = 0.046). [score:1]
The present results of microarray and qPCR revealed that the grazing JB cattle had a higher plasma content of miR-10b and lower plasma contents of miR-17-5p, miR-23b-3p, miR-28, miR-30b-5p, miR-30d, miR-98, miR-301a, miR-345-5p, miR-374b, miR-425-5p, miR-652, and miR-874 than the grain-fed cattle. [score:1]
[1 to 20 of 8 sentences]
5
[+] score: 33
Finally, miR-17-5p and miR-20a-5p, that we found to be under-expressed in the LM fraction and potentially target PTEN and STAT signaling, if down-regulated were proved to trigger cell apoptosis [68]. [score:8]
14/26s highly expressed in the HM fraction (let-7d-5p, miR-103a-3p, miR-142-3p, miR-17-5p, miR-18a-5p, miR-196a-5p, miR-20a-5p, miR-24-1-5p, miR-26a-5p, miR-301a-3p, miR-30b-5p, miR-34b-5p, miR-34c-5p, miR-378a-3p) and 7/14s highly expressed in the LM fraction (miR-10b-5p, miR-122-5p, miR-1-3p, miR-184, miR-486-5p, miR-7-5p, miR-99b-5p) were predicted to target 327 and 281 experimentally observed genes, respectively. [score:7]
According to previous results, miR-17-5p, miR-26a-5p up-regulation enhances AKT pathway activation by PTEN suppression and promotes cancer [61, 62]. [score:6]
Dysregulation of miR-17-5p, miR-26a-5p, miR-486-5p, miR-122-5p, miR-184 and miR-20a-5p was found to target three pathways (PTEN, PI3K/AKT and STAT). [score:4]
PTEN could be targeted by the simultaneous action of miR-17-5p, miR-26a-5p, miR-486-5p. [score:3]
The relative expression in HM and LM fractions of several of these knowns, including bta-miR-103, bta-miR-30b-5p, bta-miR-17-5p, bta-miR-106b, bta-miR-142-3p, bta-miR-34b, bta-miR-18a, bta-miR-34c, bta-miR-455-5p, bta-miR-10b, bta-miR-99b, bta-miR-1246, bta-miR-99a-5p, and bta-miR-1388-5p, was consistent with the relative abundance of their homologouss, observed in the normal vs abnormal sperm. [score:3]
Among these pathways, “PTEN Signaling” was regulated by miR-17-5p, miR-26a-5p and miR-486-5p, “PI3K/AKT Signaling” by 122-5p and miR-184 and “STAT3 Pathway” by miR-20a-5p (Fig.   4). [score:2]
[1 to 20 of 7 sentences]
6
[+] score: 26
Upstream regulator Molecule type Predicted activation state [1] p -value of overlap Number of target molecules in datasetmiR-30c-5p (and other miRNAs w/seed GUAAACA)mature microRNAInhibited1.75E-0729MYCNtranscription regulatorInhibited4.08E-0752TCRcomplex 1.02E-0657miR-155-5p (miRNAs w/seed UAAUGCU)mature microRNAInhibited1.97E-0634CD40LGcytokineActivated2.06E-0667CD28transmembrane receptorInhibited6.13E-0662mir-210microRNA 1.58E-0516E2F1transcription regulatorActivated8.88E-0552miR-124-3p (and other miRNAs w/seed AAGGCAC)mature microRNAInhibited1.23E-0438HOXA9transcription regulator 1.33E-0434IL2cytokineActivated1.77E-0458CD3complexInhibited4.26E-0498miR-291a-3p (and other miRNAs w/seed AAGUGCU)mature microRNAInhibited4.55E-0418SMARCC1transcription regulator 7.17E-044YWHAQother 7.37E-045SHOXtranscription regulator 7.37E-045TGFB1growth factorActivated7.99E-04187FSHcomplex 1.64E-0360TMBIM6other 1.68E-036 miR-17-5p (and other miRNAs w/seed AAAGUGC) mature microRNA Inhibited 1.94E-03 10 [1] For identification of activation or inhibition of upstream regulators, a threshold for the activation z-score calculated in the IPA analysis of |z-score| > 2 was applied. [score:26]
[1 to 20 of 1 sentences]
7
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
In addition, many miRNA families showed low expression (count number <100) in milk exosomes, such as the miR-1, miR-130, miR-17, miR-10, miR-29, miR-374, mir-9, miR-15 and miR-491 families (Figure 12F), which are routinely expressed in specific tissues [53– 56]. [score:5]
MiR-92a, miR-19b and miR-363 were found to be highly expressed, while miR-17-5p, miR-18a, miR-20b and miR-106a were lowly expressed. [score:5]
Overexpression of the mir-17–mir-18a–mir-19b-1 cluster was shown to accelerate Myc -induced tumor development in a mouse B-cell lymphoma mo del [61]. [score:4]
As mentioned above, miR-17-5p, miR-363, miR-106a, miR-18a, miR-19b, miR-92a, miR-20b and miR-92b formed a complex cluster and family network, and they also showed different expression patterns. [score:3]
In the genome, miR-92a/19b showed three copies; miR-363 and miR-20b had two copies; while miR-17, miR-18a and miR-106a had one copy. [score:1]
MiR-92a belongs to the miR-17 ~92 cluster with seven miRNAs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a) and was first described as an oncogenic miRNA cluster involved in B-cell lymphoma [61]. [score:1]
In porcine milk, miR-363/92a/19b-2/20b (miR-363/92a/19b-2/20b/106a) and miR-17/18a/19b-1/92-1 were also detected. [score:1]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
Among all miRNAs clusters, there were several pre-miRNAs with intervening sequences of less than 1 kb, including 10 known clusters (miR-99b/let-7e/125a, miR-24-2/27b/23b, miR-99a/let-7c, miR-29b/29a, miR-221/222, miR-98/let-7f, miR-181c/d, miR-363/92a/19b-2/106a, miR-363/92a/19b-2, miR-181b-1/181a-1 and miR-17/18a/19b-1/92a-1) and 4 novel miRNAs clusters (cluster 3, 9, 12, 22). [score:1]
Conversely, miR-423-5p had 22,588 counts, while its complementary strand, miR-423-3p, had only 654 reads, and which was shared by miR-22, miR-30a, miR-339, miR-17, miR-24, miR-331, miR-27b and let-7d (detail in Additional file 3: Table S3). [score:1]
We identified a typical polycistronic miRNA cluster, miR-363/92a/19b-2/20b, on chromosome X. Interestingly, the homologous cluster, miR-363/92a/19b-2/20b/106a on chromosome X, was located 33.5 kb downstream of miR-363/92a/19b-2/20b (Figure 11A, C), and a paraologous cluster miR-17/18a/19b-1/92a-1 was found on chromosome 11 (Figure 11B, C). [score:1]
[1 to 20 of 11 sentences]
8
[+] score: 19
Similarly, apoptosis pathway was enriched by only target genes of miRNAs down-regulated in preovulatory dominant follicles (bta-miR-1271, bta-miR-17-5p and bta-miR-365-3p). [score:6]
Both miR-17-5p and miR-17-3p have been implicated in co-ordinately targeting the TIMP metallopeptidase inhibitor 3 (TIMP3) gene and induce growth and invasion of prostate tumour [40]. [score:5]
For instance, the 5p and 3p arms of mir-17 precursor were found to be expressed in both the preovulatory and subordinate follicles with slightly higher expression of the 5p arms. [score:5]
While, the expression level of 30 other matured miRNAs including bta-miR-409a, bta-miR-335, bta-miR-378 and bta-miR-17-5p were significantly reduced in preovulatory dominant follicles (Table 5). [score:3]
[1 to 20 of 4 sentences]
9
[+] score: 17
However, quercetin may be unable to fully attenuate the inflammation mediated by MIRLET7E and MIR17, as the miRNA expression of these two genes was increased after quercetin treatment. [score:3]
Similar trends were noticeably documented in MIR17 and CXCL8 gene expression. [score:3]
The function of miR-17, especially miR-17-5p, when in combination with miR-20a and miR-106a is to inhibit monocyte proliferation, differentiation and maturation, as appeared in a review by Lindsay [39]. [score:3]
The increased expression of MIRLET7E and MIR17 in bovine neutrophils supplemented with quercetin in this study may be because these inflammatory miRNAs are actively involved in LPS-stimulated inflammation at the early phase of infection. [score:3]
To investigate gene expression of microRNA (miRNA) milieus (MIRLET7E, MIR17, MIR24-2, MIR146A, and MIR181C), inflammatory cytokine genes (interleukin 1β [IL1B], IL6, CXCL8, and tumor necrosis factor [TNF]), and the pathogen receptor toll-like receptor (TLR4) in bovine neutrophils under quercetin supplementation. [score:1]
This study was designed to investigate the gene expression of miRNAs (MIRLET7E, MIR17, MIR24-2, MIR146A, and MIR181C) and inflammatory cytokine genes (IL1B, IL6, CXCL8, toll-like receptor [TLR4], and TNF) in bovine neutrophils under supplementation of quercetin during the induction of inflammation by bacterial lipopolysaccharide (LPS). [score:1]
Moreover, the elevation of MIR17 was found to be positively related to the elevated levels of TLR4. [score:1]
miRNAs PBS p value MIRLET7E 1.001±0.013 (n=11) 1.171±0.071 (n=11) 0.028 MIR17 0.994±0.014 (n=10) 1.185±0.247 (n=10) 0.447 MIR24-2 1.000±0.009 (n=12) 0.723±0.118 (n=12) 0.029 MIR146A 1.000±0.006 (n=11) 0.784±0.086 (n=11) 0.021 MIR181C 1.001±0.004 (n=12) 0.855±0.066 (n=12) 0.037 PBS=Phosphate buffered saline, miRNAs=MicroRNA clearly possesses an anti-inflammatory property toward proinflammatory cytokine genes in mammalian neutrophils, macrophages, and macrophage cell lines [19, 20, 24, 26, 27]. [score:1]
miRNAs PBS p value MIRLET7E 1.001±0.013 (n=11) 1.171±0.071 (n=11) 0.028 MIR17 0.994±0.014 (n=10) 1.185±0.247 (n=10) 0.447 MIR24-2 1.000±0.009 (n=12) 0.723±0.118 (n=12) 0.029 MIR146A 1.000±0.006 (n=11) 0.784±0.086 (n=11) 0.021 MIR181C 1.001±0.004 (n=12) 0.855±0.066 (n=12) 0.037 PBS=Phosphate buffered saline, miRNAs=MicroRNA Quercetin clearly possesses an anti-inflammatory property toward proinflammatory cytokine genes in mammalian neutrophils, macrophages, and macrophage cell lines [19, 20, 24, 26, 27]. [score:1]
[1 to 20 of 9 sentences]
10
[+] score: 14
Highly up-regulated miRNAs were bta-miR-15b, bta-miR-17-3p, bta-miR-16b, bta-miR-148a, bta-miR-26b, bta-miR-101, bta-miR-29b, bta-miR-27b and bta-miR-215 (≥10 magnitude of Fold Regulation) whereas bta-miR-148b, bta-miR-199a-3p, bta-miR-122, bta-miR-200b and bta-miR-10a (≤−10 magnitude of Fold Regulation) were highly down-regulated in cows with metritis compared to control cows (Table 2). [score:8]
Serum levels of miR-16, miR-17, miR-20a, miR-20b, miR-26a, and miR-26b were up-regulated in an experimental sepsis condition induced by cecal ligation and puncture in mice 34, whereas over -expression of miR-21, miR-29b and miR-148a occurred in systemic lupus erythematosus 35 36. [score:6]
[1 to 20 of 2 sentences]
11
[+] score: 12
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Recently, Wang et al. (2016), using ovaries and testes of young Nile tilapia, showed that miR-17-5p and miR-20a were highly expressed in the ovaries and negatively regulated DMRT1 expression, suggesting that these miRNAs could induce estrogen production by inhibiting DMRT1 expression and promoting cyp19a1a expression in Nile tilapia. [score:12]
[1 to 20 of 1 sentences]
12
[+] score: 9
Notably, overexpression of miRNA-148a and miRNA-17-5p promoted triacylglycerol synthesis while knockdown of miRNA-148a and miRNA-17-5p impaired triacylglycerol synthesis in goat MECs [108]. [score:4]
Chen Z. Luo J. Sun S. Cao D. Shi H. Loor J. J. miR-148a and miR-17-5p synergistically regulate milk TAG synthesis via PPARGC1A and PPARA in goat mammary epithelial cells RNA Biol. [score:2]
In goat MECs, miRNA-148a and miRNA-17-5p have been shown to synergistically increase milk triacylglycerol synthesis via regulation of PPARGC1A and PPARA. [score:2]
An X. Ma K. Zhang Z. Zhao T. Zhang X. Tang B. Li Z. miR-17, miR-21, and miR-143 enhance adipogenic differentiation from porcine bone marrow-derived mesenchymal stem cells DNA Cell Biol. [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 8
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
The folding secondary structure of porcine mir-17-mir-20 cluster predicted computationally by RNAfold. [score:1]
0031426.g005 Figure 5 Folding secondary structure of porcine mir-17 cluster including four miRNAs (mir-17, mir-18, mir-19a and mir-20) and flanking sequences was predicted by RNAfold. [score:1]
The mir-17-mir-20 cluster consisted of four miRNA genes. [score:1]
Phylogenetic trees of mir-17-mir-20 cluster among different mammalian species were constructed using MEGA4. [score:1]
We implemented the phylogenetic analysis of mir-17 cluster among different mammalian species using MEGA4 [39]. [score:1]
0031426.g004 Figure 4 Folding secondary structure of porcine mir-17 cluster including four miRNAs (mir-17, mir-18, mir-19a and mir-20) and flanking sequences was predicted by RNAfold. [score:1]
mir-17 and mir-20 had closer phylogenetic and evolutionary relationship with each other (Figure 5). [score:1]
The result partially proved that mir-20 resulted from duplication of mir-17 and the history of mir-17 cluster might be closely linked to the early evolution of the mammalian lineage [38]. [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 7
Targeted knockdown of mir-17-5p and let-7p in wild type mice revealed impaired corpus luteum (CL) angiogenesis and decreased serum progesterone levels. [score:4]
In another study, miR17-5p and let-7b were found to be involved in the regulation of development and function of the ovarian corpus luteum specially angiogenesis of corpus luteum [23]. [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 6
Ventura W Placental expression of microRNA-17 and −19b is down-regulated in early pregnancy lossEur. [score:6]
[1 to 20 of 1 sentences]
16
[+] score: 6
The miR-17~92 and miR-106b~25 clusters are paralogues, with a demonstrated role in vascular endothelial growth factor (VEGF) -mediated angiogenesis through targeting of phosphatase and tensin homolog (PTEN), and a possible role in placental immune tolerance during the first trimester of pregnancy; both clusters are highly expressed in the human placenta [36, 39– 41]. [score:5]
Among these were the miR-379~656 cluster (known as C14MC in humans), represented by 5 miRNAs, and the miR-17~92 and miR-106b~25 clusters, represented by 5 and 2 miRNAs, respectively (Table 5). [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 6
Mogilyansky E. Rigoutsos I. The miR-17/92 cluster: A comprehensive update on its genomics, genetics, functions and increasingly important and numerous roles in health and diseaseCell. [score:3]
According to Brock et al. [60], a promoter region of miR-18a and other members of miR-17/92 contain a functional binding site for STAT3, which transcriptionally activates these miRNAs. [score:1]
Moreover, Cai et al. [59] reported that promoter binding of STAT3 is required for transactivation of miR-148a (and other members of miR-17/92 cluster) in human macrophage cells following Toxoplasma infection. [score:1]
miR-18a is a member of miR-17/92 cluster, and plays a role in tumor progression [56, 57]. [score:1]
[1 to 20 of 4 sentences]
18
[+] score: 6
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-198, hsa-mir-208a, hsa-mir-10a, hsa-mir-223, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-155, hsa-mir-29c, hsa-mir-99b, hsa-mir-296, hsa-mir-196b, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-640, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-550a-3, bta-mir-29a, bta-mir-125b-1, bta-mir-126, bta-mir-10a, bta-mir-124a-1, bta-mir-29b-2, bta-mir-29c, bta-mir-150, bta-mir-122, bta-mir-125b-2, bta-mir-19a, bta-mir-99b, hsa-mir-208b, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, bta-mir-124a-2, bta-mir-124b, bta-mir-146a, bta-mir-155, bta-mir-196b, bta-mir-208a, bta-mir-208b, bta-mir-223, bta-mir-296, bta-mir-29d, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, hsa-mir-548q, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, bta-mir-2284w, bta-mir-2284x, hsa-mir-548y, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-548ay, hsa-mir-548az, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Additionally, the deletion of the dicer1 gene, which is critical for proper miRNA processing, results in impaired T cell development (19), while miR-17–92, miR-150, and miR-155 have been demonstrated to be critical for B cell development. [score:3]
Reference miRNA Tissue Source Condition(31) Genome-wide embryo, thymus, lymph node, and small intestine Holstein–Friesian None(44) Genome-wide Bos taurus kidney cells (MDBK) Cell line Bovine herpesvirus 1(46) miR-10a, -15b, 16a, -17, -21, 31, -145, 146a, 146b, 155, -181a, -205, -221, and -223 Mammary tissue Holstein–Friesian Mastitis(48) miR-223 Venous blood Holstein–Friesian Mastitis(45) miR-9, -125b, -155, -146a, and -223CD14 monocytes ex vivo Holstein–Friesian LPS and SEB(49) miR-296, -2430, -671, and -2318 Mammary tissue Holstein–Friesian Mastitis(39) miR-17-5p, -20b, and -93 Mammary tissue Holstein–Friesian Mastitis(40) Genome-wideMammary epithelial cells ex vivo Holstein–Friesian Mastitis(41) Genome-wide Alveolar macrophages Holstein–Friesian None(39) Genome-wide Peripheral blood Holstein–Friesian Mastitis(42) Genome-wide CD14 monocytes Holstein–Friesian Mastitis(47) Genome-wide MAC-T cells Cell lineHeat-inactivated E. coli or S. aureus More recent studies have employed high-throughput sequencing approaches to temporally profile genome-wide changes in miRNA expression in different cell-types in response to challenge with bovine mastitis-causing pathogens such as Escherichia coli, S. aureus, and S. uberis. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 6
More recently, Stenfeldt et al. revealed that bta-miR-17–5p and bta-miR-31 were highest expressed during acute, persistent infection, respectively, whereas, bta-miR-1281 was significantly downregulated while both acute and persistent infection of FMDV (Stenfeldt et al., 2017). [score:6]
[1 to 20 of 1 sentences]
20
[+] score: 6
For example miR-17-5p, 19a, 20a, 19b and 92 (Network 1) are part of the cluster 17 ~ 92 which was shown to be up-regulated during the clonal expansion step of adipocyte differentiation of 3T3-L1 cells [50]. [score:4]
Several miRNAs in the relevant networks were members of bovine miRNA clusters: miR-17-5p, 19a, 20a, 19b and 92 (cluster 17 ~ 92); miR-25 and miR-106b (cluster 106b ~ 25); miR-16b and 15b (cluster 16b ~ 15b) and miR-15a (cluster 16a ~ 15a) in Network 1. While in Network 2 let-7a and let-7b were members of the let-7a ~ let-7b cluster; let-7a, let-7d, and let-7f formed the let-7a ~ let-7d cluster and let-7f and miR-98 were members of the 98 ~ let-7f cluster. [score:1]
8) or different miRNA families (e. g. cluster including miR-17-3p, -18a, -19a, -20a, -19b, -92 in chr. [score:1]
[1 to 20 of 3 sentences]
21
[+] score: 6
The c-Myc-regulated microRNA-17~92 (miR-17~92) and miR-106a~363 clusters target hCYP19A1 and hGCM1 to inhibit human trophoblast differentiation. [score:6]
[1 to 20 of 1 sentences]
22
[+] score: 5
Nevertheless, HIF1A is an experimentally validated target for has-miR-17-5p and -20a (http://mirtarbase. [score:3]
tw/) and is also successfully in silico predicted for bta-miR-17-5p and -20a (http://www. [score:1]
Notable, bta-miR-17-5p and bta-miR-20a are DE miRNAs identified in our study and show a FC < 2.0 (Table 1). [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 5
A total of 68 miRNAs were profiled using Firefly [®] technology, of which miRNAs miR-122 (P-value = 0.048), miR-16 (P-value = 0.042), miR-30b (P-value = 0.029), miR-320a (P-value = 0.042), miR-15b (P-value = 0.089), miR-16-2 (P-value = 0.061), miR-17 (P-value = 0.072), and miR-22 (P-value = 0.069) were found to be upregulated in female-conditioned embryo media (Figure 1). [score:4]
miRNAs miR-122 (P-value = 0.048), miR-16 (P-value = 0.042), miR-30b (P-value = 0.029), miR-320a (P-value = 0.042), miR-15b (P-value = 0.089), miR-16-2 (P-value = 0.061), miR-17 (P-value = 0.072), and miR-22 (P-value = 0.069) were found to be significant. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 4
MiR-20a-5p, which was differentially expressed in our study, belongs to the miR-17/92 cluster that has mainly been described for its function as an oncomiR, but is also important to cell cycle proliferation, apoptosis and other biological processes in several organs [58]. [score:3]
Eight miRNAs (miR-15a-5p, miR-17-5p, miR-20a-5p, miR-33a-3p, miR-126-3p, miR-181a-5p, miR-142-5p and miR-223-3p; Supplementary S1 Table) were chosen for further study on the basis of their ranking and their function highlighted in the literature. [score:1]
[1 to 20 of 2 sentences]
25
[+] score: 4
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-151, bta-mir-21, bta-mir-27a, bta-mir-125b-1, bta-mir-205, bta-mir-27b, bta-mir-193a, bta-mir-98, bta-let-7d, bta-mir-200a, bta-mir-200c, bta-mir-210, bta-mir-29b-2, bta-mir-29c, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-15a, bta-mir-100, bta-mir-130a, bta-mir-146a, bta-mir-155, bta-mir-184, bta-mir-219-1, bta-mir-223, bta-mir-28, bta-mir-494, bta-mir-708, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-3596, bta-mir-652, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-664b, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Additionally, bta-miR-15a, bta-miR-17, bta-miR-26a-2, bta-miR-29a, bta-miR-29b-1, and bta-miR-193a were identified as down-regulated in the normalised data (both methods), but not in the un-normalised data. [score:4]
[1 to 20 of 1 sentences]
26
[+] score: 3
Feuermann and colleagues found that one of the targets of STAT5 is the miR-17/92 cluster [34]. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-125b-1, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-155, hsa-mir-106b, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-151a, hsa-mir-450a-1, hsa-mir-452, hsa-mir-450a-2, hsa-mir-92b, hsa-mir-151b, hsa-mir-378d-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-151, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-92a-2, bta-let-7d, bta-mir-450a-2, bta-mir-7-3, bta-let-7f-1, bta-let-7c, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-450b, bta-mir-106b, bta-mir-143, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-26a-1, bta-mir-378-1, bta-mir-452, bta-mir-92a-1, bta-mir-92b, bta-mir-7-2, bta-mir-7-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-450a-1, bta-mir-378-2, hsa-mir-378b, bta-mir-2284w, bta-mir-2284x, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-450b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-378j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Other highly expressed microRNAs previously associated with endothelial cells included miR-21, miR-378, miR-20a, miR-17, and miR-26a [Kuehbacher et al., 2007; Wang and Olson, 2009; Bonauer et al., 2010]. [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 1
Ovhv2-mir-17- 29, -20, -17, -10, -6, -3 and -1 were previously designated ovhv2-miR-2 to -8. One miRNA is encoded in the non-coding region situated toward the right end of the genome and is designated ovhv2-miR-73-1. The remaining miRNAs are encoded within ORFs 24 and 61 and are designated ovhv2-miR-24-1 and ovhv2-miR-61-1. ovhv2-miR-73-1 was the only OvHV-2-encoded miRNA to show seed sequence homology to any other reported miRNA, miR-216a (Figure 1). [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
ESCC miRNAs include some members of miR-17 family, miR-290~295 cluster, and miR-302~367 cluster (23). [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
The mir-17 and mir-363 clusters are well conserved and supported by reads (Additional file 1: Figure S15 and S16). [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
However, in livestock, few studies have been described so far, with the exception of studies using porcine tissues where miR-93, miR-25, miR-106a, miR-17-5p, and miR-26a have been reported as stable reference miRNAs [12– 13]. [score:1]
[1 to 20 of 1 sentences]