sort by

10 publications mentioning hsa-mir-889

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-889. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 28
The results confirmed that the methylation levels were inversely associated with the expression levels, i. e., hypomethylation of SNORD113-5, SNORD113-7, SNORD114-9, and miR-889 correlated with high gene expression in tumor samples relative to non-tumoral tissue. [score:5]
Expression levels of some DLK1-DIO3 cluster componentsExpression of some randomly selected DLK1-DIO3 cluster components (DIO3, SNORD113-5, SNORD113-7, SNORD114-9, and miR-889) was analyzed by qPCR. [score:5]
The expression of miR-889 was normalized to the expression of RNU48 and B2M for the normalization of different genes. [score:5]
In order to investigate methylation -dependent RNA expression changes, some components of the DLK1-DIO3 cluster, such as DIO3, SNORD113-5, SNORD113-7, SNORD114-9, and miR-889, were randomly selected to analyze their expression levels in matched normal-tumor samples. [score:3]
For the miR-889 expression levels, 2 ng/μL of total RNA was converted into cDNA by the reverse transcriptase reaction, which was performed by sequential incubation at 16°C for 30 min, 42°C for 30 min and 85°C for 5 min. [score:3]
Expression of some randomly selected DLK1-DIO3 cluster components (DIO3, SNORD113-5, SNORD113-7, SNORD114-9, and miR-889) was analyzed by qPCR. [score:3]
For this reason, 454 bisulfite sequencing (Roche, Mannheim, Germany) was used to validate the DNA methylation status of DLK1, miR-889 and SNORD114-9 [58]. [score:1]
The methylation status of DIO3, miR-889 and SNORD114-9 was further validated by 454 bisulfite sequencing using pooled non-tumor and tumor samples from non-smokers (Figure 4B). [score:1]
Zoomed-in views of the SNORD114-9, miR-889 and DIO3 regions are highlighted in orange squares. [score:1]
B. Validation of the DNA methylation status of DIO3, miR-889 and SNORD114-9 by 454 bisulfite sequencing using pools of 10 non-tumoral and tumoral tissue samples in non-smoking-related lung cancer patients. [score:1]
[1 to 20 of 10 sentences]
2
[+] score: 12
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
[1 to 20 of 2 sentences]
3
[+] score: 4
MiRNA-144 was found to be highly expressed in the PBMC compared to miRNA-361-5P, miRNA-889, and miRNA-576-3p that were significantly down regulated in active tuberculosis patients. [score:3]
However, increased level of miRNA-361-5p, miRNA-889, and miRNA-576-3p have been reported in tuberculosis infected serum as non-invasive molecular biomarker for rapid diagnosis and prevention of tuberculosis infection (Qi et al., 2012). [score:1]
[1 to 20 of 2 sentences]
4
[+] score: 3
A set of three miRNAs, i. e. miR-361-5p, miR-889, and miR-576-3p, was identified that specifically indicated TB disease. [score:3]
[1 to 20 of 1 sentences]
5
[+] score: 1
The detection rates of miR-889-3p were less than 75%; no significant difference was observed in the levels of miR-144-5p, and -181c-5p between epilepsy patients and controls (P > 0.05). [score:1]
[1 to 20 of 1 sentences]
6
[+] score: 1
Finally we validated two miRNAs (miR-506 and miR-889) that were not detected in any sample by sequencing. [score:1]
[1 to 20 of 1 sentences]
7
[+] score: 1
miRNAlog [2]FoldChange P-value Corrected P-value hsa-mir-577 −3,28 1,46E-10 3,87E-08 hsa-mir-182-5p −2,70 6,50E-15 3,44E-12 hsa-mir-485-5p −2,12 8,79E-05 8,45E-03 hsa-mir-124-3p −1,83 1,05E-05 1,85E-03 hsa-mir-218-5p −1,68 1,54E-04 1,16E-02 hsa-mir-183-5p −1,62 3,14E-04 2,08E-02 hsa-mir-873-5p −1,58 9,80E-04 3,25E-02 hsa-mir-133a −1,53 6,05E-04 2,29E-02 hsa-mir-487b −1,45 1,56E-03 4,59E-02 hsa-mir-219-5p −1,44 9,55E-04 3,25E-02 hsa-mir-409-3p −1,34 1,12E-03 3,48E-02 hsa-mir-889 −1,23 5,71E-04 2,29E-02 hsa-mir-136-3p −1,15 1,75E-03 4,87E-02 hsa-mir-410 −1,12 4,02E-04 2,29E-02 hsa-mir-127-3p −0,95 5,61E-04 2,29E-02 hsa-mir-148a-3p 1,23 4,99E-04 2,29E-02 hsa-mir-155-5p 1,82 9,56E-05 8,45E-03 hsa-mir-221-3p 2,10 4,82E-04 2,29E-02For each differently expressed miRNA we report the standard name according to MirBase database, the log [2] fold-change, the P-value and the corresponding corrected P-value as calculated by DESeq. [score:1]
[1 to 20 of 1 sentences]
8
[+] score: 1
A combination of the serum levels of miR-361-5p, miR-889 and miR-576-3p were shown to distinguish pulmonary tuberculosis patients from healthy individuals [26]. [score:1]
[1 to 20 of 1 sentences]
9
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
However, 29 miRNAs such as miR-890*, miR-296-5p, miR-617, miR-181c*, miR-889, miR-520a-5p and miR-641 were absent in SE but these miRNAs were detected in HE and CE animals (Fig.   6). [score:1]
[1 to 20 of 1 sentences]
10
[+] score: 1
57/30.85/5.71 Yes 20 64/58 0 (0) hsa-mir-130a-3p 5/5/0 0.76/0.97/0 Yes 56 724/172 27 (3.73) hsa-mir-151a-3p 6/6/3 2.87/1.26/0.48 Yes 49 76/77 3 (3.95) hsa-let-7d-3p 6/4/0 0.70/0.31/0 Yes 66 9/1 0 (0) hsa-mir-27b-3p* 5/0/0 0.25/0/0 Yes 64 921/8 2 (0.22) hsa-mir-301b-3p* 5/2/1 1.24/−/− No 63 NA NA hsa-mir-340-3p* 4/0/0 1.19/0/0 No 70 NA NA hsa-mir-377-3p* 4/3/0 8.10/4.6/0 No 54 NA NA hsa-mir-539-5p* 6/6/0 2.23/1.62/0 No 18 NA NA hsa-mir-889-3p* 5/5/0 0.62/0.41/0 No 62 NA NA hsa-mir-99a-5p 6/6/4 3.40/1.44/0.30 No 13 NA NA 22 miRNAs were found to be significantly hypoedited in GBM (wilcoxon-two-tailed, p < 0.05). [score:1]
[1 to 20 of 1 sentences]