sort by

48 publications mentioning mmu-mir-449b

Open access articles that are associated with the species Mus musculus and mention the gene name mir-449b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 363
To establish a causal relationship between miR-449 deregulation and cancer-relevant parameters, such as cell cycle regulation, apoptosis and senescence, we over-expressed miR-449 in gastric cancer cell lines and observed a significant down-regulation of proliferation coupled with up-regulation of the acidic beta-gal senescence marker and induction of apoptosis. [score:11]
However, in agreement with previous findings for miR-34a, we find that miR-449 regulates the expression of p53 [31, 32] as over -expression of miR-449 resulted in a potent up-regulation of p53 subsequently resulting in activation of p21 and induction of apoptosis markers, such as cleaved CASP3 and PARP as previously reported [60]. [score:9]
Having demonstrated down-regulation of miR-449 expression in gastric cancers we wanted to examine the effect of re -expressing miR-449 in gastric cancer cell lines. [score:8]
qPCR analysis of miR-449 expression in Gastrin knock out gastric tissues compared to relative expression in wild type gastric tissues, miR-449 is significantly down-regulated (p = 0.04) in Gastrin knock out tissues compared to wild types. [score:8]
As shown in table 1, 20 microRNAs were significantly deregulated in the knockout mice compared to wild type littermate controls, with three miRNAs differing more than two fold, miR-7 being up-regulated and miR-709 and miR-449b being down-regulated in the antrum of Gastrin knockout mice compared to wild types. [score:8]
TB performed cell cycle and senescence studies, targets validation and direct targets detection studies, p53 activation studies and miR-449 expression studies, conducted data analyses, contributed in designing the study and in writing the manuscript. [score:8]
"ns" not significant p value > 0.05, "*" or "#" significant 0.01 < p value < 0.05, "**" or "##" very significant 0.01 < p value < 0.001, "***" or "###" extremely significant p value < 0.001 Hence, miR-449 directly targets cell cycle regulator genes consistent with a tumour suppressor function and with the cell cycle arrest observed upon miR-449 re-introduction into cancer cell lines. [score:7]
"ns" not significant p value > 0.05, "*" or "#" significant 0.01 < p value < 0.05, "**" or "##" very significant 0.01 < p value < 0.001, "***" or "###" extremely significant p value < 0.001 Hence, miR-449 directly targets cell cycle regulator genes consistent with a tumour suppressor function and with the cell cycle arrest observed upon miR-449 re-introduction into cancer cell lines. [score:7]
We found that mRNAs with predicted miRNA target sites (7 mer seed site) in the 3'UTR were significantly down-regulated compared to mRNAs without predicted target sites after transfection of miR-449b (p < 1.2e-70, two-tailed Wilcoxon rank-sum test), (Additional file 1, figure S4a). [score:7]
Hence, aside from the pro-oncogenic effects of up-regulation of MYC, MET, CCNE2 and other direct targets, loss of miR-449 may result in increased E2F1 activity. [score:7]
While miR-449 was clearly down-regulated or lost in the analyzed mouse tumour samples no clear tendency for loss or down-regulation of miR-34a was observed (data not shown). [score:7]
Vinculin (VCL) and tubulin beta (TUBB) were used as loading controls D - verification of direct and functional target binding using luciferase constructs holding wild type 3'UTRs and mutated 3'UTRs (two mutations in miR-449 binding site), * indicates statistical significance in luciferase expression between wild type 3'UTRs transfected with miR449a/b compared to RNA scrambled control, # indicates statistical difference in luciferase expression between wild type 3'UTRs compared to mutant 3'UTRs transfected with miR-449a and miR-449b. [score:7]
qPCR analysis (upper panel) showing down-regulation of miR-449 expression in 8 gastric cancer tissues compared to miR-449 expression in sample-matched controls (dotted line). [score:7]
Beside gastric cancer, the expression of miR-449 has also been found to be reduced in several cell lines [55] and in prostate cancer, where it was found to target HDAC1 and induce growth arrest following over -expression in prostate cancer cells [56]. [score:7]
A series of the putative miR-449 targets were subsequently validated at endogenous level using western blotting and quantitative PCR and their direct regulation by miR-449 was established using heterologous reporter constructs and binding site-specific mutation studies. [score:6]
Many of the direct mRNA targets for miR-449 identified in this study are also targets of miR-34a and miR-449 and miR-34a belong to the same family of miRNAs as they share the same seed sequence. [score:6]
Focusing on a set of putative target genes with well-established roles in tumourigenesis, we confirmed down-regulation by miR-449 of met proto oncogene (MET), cyclin dependent kinase 6 (CDK6), geminin (GMNN), myelocytomatosis viral oncogenes homolog (MYC), sirtuin 1 (SIRT1) and histone deacetylase 1 (HDAC1) at the transcript level (figure 3b). [score:6]
Analyses of the genomic DNA from the tumours found no evidence for loss or hyper-methylation of the miR-449 loci using methylation-specific melting curve analysis (MS-MCA) indicating transcriptional down-regulation of expression (data not shown). [score:6]
Genes were sorted by expression change induced by transfection of miR-34a or miR-449b, and the correlation with down-regulation was tested for all words of length 5-7 (N = 21 504). [score:6]
B - Chart showing high correlation of expression changes upon re-introduction of miR-449b or miR-34a into SNU638 cells with a Pearson's correlation coefficient of r = 0.94, p = 0. C - Word analysis showing shared miR-449b/34a seed site correlating with gene down-regulation. [score:6]
For a subset of target genes including MET, GMNN, CCNE2, SIRT1 and HDAC1, we confirmed direct interaction of miR-449 with the target gene 3' UTR using luciferase assay (figure 3d). [score:5]
To further confirm miR-449 deregulation during gastric cancer development, we examined its expression in wild type mouse antrum tissues infected with H. Pylori. [score:5]
During the search for miR-449 targets we also identified several growth factors (AREG, and KITLG) and growth factor receptors, such as MET, as targets. [score:5]
Interestingly no noticeable expression of the miR-449 family was detected across a panel of gastric cell lines including SNU638, SNU5, SNU216, SNU601 and MKN74 sustaining the notion of miR-449 having tumour-suppressive functions (data not shown). [score:5]
We also show that miR-449 over -expression activated p53 and its downstream target p21 as well as the apoptosis markers cleaved CASP3 and PARP. [score:5]
The expression profiles were used to identify differentially expressed transcripts in cells transfected with miR-449b or controls (Additional file 1, table S2). [score:5]
Hence, the cancer-specific loss or down-regulation of miR-449 in gastric cancer can likely be explained by the connection to key cell cycle regulators. [score:5]
miR-449 induces p53 expression but is not regulated by p53. [score:4]
We identify miR-449 as significantly down-regulated or lost in mouse mo dels of gastric cancer as well as in primary human gastric tumours. [score:4]
The present study represents the first report demonstrating cancer-related down-regulation of miR-449 in both mouse mo dels for gastric cancer and in primary human gastric tumours. [score:4]
To characterize the transcripts controlled by miR-449 and to see if miR-449 regulates different transcripts than miR-34a, SNU638 cells expression profiles were examined 24 hours post transfection of miR-449b or miR-34a and differentially expressed transcripts identified. [score:4]
Importantly, analyses of primary gastric tumours from patients clearly documented a tumour-specific down-regulation of miR-449 also in humans. [score:4]
Click here for file Figure S1 - miR-449 is down-regulated in Gastrin knock out mice compared to wild type. [score:4]
Interestingly, miRNA arrays demonstrated a specific down-regulation of miR-449b in H. Pylori infected mice (table 2 and Additional file 1, figure S1). [score:4]
Affymetrix top down-regulated genes upon miR-449 re-introduction into SNU638 cells. [score:4]
Growth rate of gastric cell lines over -expressing miR-449 was inhibited by 60% compared to controls. [score:4]
Western blot analyses confirmed the ability of miR-449 to down-regulate MET, GMNN, MYC, SIRT1, cyclin E2 (CCNE2) and HDAC1 at the protein level to an extent similar to that achieved by re-introduction of miR-34a (figure 3c). [score:4]
miR-449 is down-regulated in human gastric cancers. [score:4]
Figure S1 - miR-449 is down-regulated in Gastrin knock out mice compared to wild type. [score:4]
To unveil molecular links between the loss of miR-449 and cancer progression or initiation we experimentally identified a number of direct mRNA targets using transcriptional profiling and extensive bioinformatics analysis. [score:4]
FACS cell cycle analysis of miR-449 over -expressing cells showed a significant increase in the sub-G [1 ]fraction indicative of apoptosis. [score:3]
In the present study, transcriptional profiling demonstrated that over -expression of miR-449 or miR-34a results in identical transcriptome changes. [score:3]
In conclusion, we found no evidence that miR-449 is a transcriptional target of p53. [score:3]
Figure S5 - miR-449 expression is p53 independent. [score:3]
B - qPCR validation of Affymetrix arrays showing down-regulation of MET, CDK6, GMNN, MYC and HDAC1 upon miR-449 re-introduction compared to scrambled RNA controls. [score:3]
Affymetrix 133v2 arrays identified GMNN, MET, CCNE2, SIRT1 and CDK6 as miR-449 targets. [score:3]
Figure S2 - miR-449 inhibits cell proliferation in human gastric cancer cell line MKN74. [score:3]
The joint seed sequence of miR-449b and miR-34a induce highly correlated expression changes. [score:3]
The expression changes induced by transfection of mature miR-449b and miR-34a were highly correlated despite divergence of the mature sequences outside the seed region (Pearson's correlation coefficient R = 0.94, p = 0), (Additional file 1, figure S4b). [score:3]
miR-449 inhibits cell cycle progression and induces senescence. [score:3]
Figure S4 - miR-449b and miR-34a induce highly correlated expression changes. [score:3]
This suggests that deregulation of miR-449 not only leads to deregulated control of cell cycle proteins but also of growth factors and their receptors. [score:3]
Thus, re-introduction of miR-449 negatively affects proliferation of gastric cancer cell lines concomitant with the induction of senescence and apoptosis in concordance with miR-449 having tumour suppressive functions. [score:3]
Finally, we examined the relationship between the p53 tumour suppressor and miR-449. [score:3]
However, no significant change in miR-449 expression was detected after p53 pathway activation (Additional file 1, figure S5b). [score:3]
C - Western blot validation of down-regulated genes upon miR-449 re-introduction into SNU638 cells compared to scrambled RNA controls. [score:3]
miR-449b is down regulated in the antrum of both Gastrin KO mice and H. pylori infected mice Gastrin knockout mice are achlorhydric with a tendency for developing antral hyperplasia and gastric adenomas over time (figure 1) [6, 12]. [score:3]
This is highly interesting as it places miR-449 at a key node in a feed-back loop in which E2F1 activates the transcription of miR-449 that in turn targets CDC25A and CDK6. [score:3]
In contrast, the expression of miR-449 has been reported to be increased in endometrioid adenocarcinoma [57] and melanoma in young adult patients [58]. [score:3]
The expression of miR-449 was also increased in skeletal muscle damage and regeneration [59]. [score:3]
Figure 3 miR-449 targets cell cycle controller genes. [score:3]
In this study, we document a diminished expression of miR-449 in Gastrin KO mice and further confirmed its loss in human gastric tumours. [score:3]
miR-449 expression studies, conducted data analyses and contributed in writing the manuscript. [score:3]
Figure 2 miR-449 is part of the miR-34 family and inhibits cell proliferation. [score:3]
Hence, we speculate that miR-449 induces apoptosis by inhibiting the histone deacetylase HDAC1 and SIRT1 leading to the p53 pathway activation thus the induction of apoptosis markers cleaved CASP3 and PARP. [score:3]
In summary, we have found that miR-449 may act as a tumour suppressor and is lost in gastric cancer. [score:3]
A - Chart showing significant down-regulation (p < 1.2e-70) of mRNAs with predicted miR-449 seed match in their 3'UTR (red line) compared to mRNAs lacking the seed match (black line). [score:3]
A pathway activation analysis based on the differentially regulated transcripts demonstrates that miR-449 mainly controls transcripts coding for proteins involved in cell damage responses, cell cycle control, inflammation and cancer pathways (figure 3a). [score:2]
miR-449 regulates numerous cell cycle controllers. [score:2]
We investigated the function of miR-449 by identifying its direct targets. [score:2]
In agreement with other studies [55, 60], we did not observe a p53 -dependent regulation of miR-449 in gastric cancer cells as well as in primary human and mouse fibroblasts. [score:2]
Western blot analysis showing an increase of the p53 protein upon miR-449 and positive control miR-34a re-introduction into SNU638 cells compared to RNA scrambled control as well as an activation of the p53 downstream target p21 and apoptosis markers cleaved CASP3 and PARP. [score:2]
Interestingly, miR-449b was the only miRNA significantly deregulated in both mouse mo dels. [score:2]
Importantly, qPCR analyses showed a loss of miR-449 expression in human clinical gastric tumours compared to normal tissues. [score:2]
We exhaustively evaluated all oligonucleotides (words) of length 5-7 for correlation with down-regulation after miR-449b and miR-34a transfection (see methods). [score:2]
A - Ingenuity Pathway Analysis (IPA) of deregulated genes upon miR-449 re-introduction into SNU638 cells showing enrichment for the gene categories cancer, cell death and cell cycle pathways among others. [score:2]
B - miR-449 re-introduction into human gastric cell lines (SNU638) inhibits cell proliferation (red line) compared to a scrambled control (blue line) and miR-146 control (black line). [score:2]
Thus, another important property of miR-449 could be as a regulator of signals important for growth and migration/invasion. [score:2]
ß-Gal assays indicated a senescent phenotype of gastric cell lines over -expressing miR-449. [score:2]
Error bars represent S. D. C - Visual inspection of cell proliferation inhibition and senescence-like phenotype upon miR-449 re-introduction into SNU638 cells (lower panel) compared to scrambled transfection control (upper panel). [score:2]
Figure 5 miR-449 is down regulated in human gastric cancers. [score:2]
Table S2 - list of genes deregulated upon miR-449 re-introduction. [score:2]
miR-449b is down regulated in the antrum of both Gastrin KO mice and H. pylori infected mice. [score:2]
B - qPCR analyses of miR-449a and miR-449b post p53 induction. [score:1]
To assess the function of miR-449 in gastric cell lines we re-introduced miR-449b in SNU638 and MKN74 cells. [score:1]
We did not find any correlation between the reduction in miR-449 expression and clinical characteristics of the cancer (figure 5b). [score:1]
The miR-449 family consists of miR-449a and b in humans and miR-449a, b and c in mice. [score:1]
This was furthermore spurred by the presence of a putative p53 binding site 10 kb upstream from human miR-449 (data not shown). [score:1]
The 3'UTRs of HDAC1, SIRT1, MET, GMNN and CCNE2 holding miR-449 binding sites were cloned downstream of the luciferase reporter in pMIR-REPORT vector system (Ambion). [score:1]
A - miR-449 is part of the miR-34 family and is evolutionarily conserved. [score:1]
Towards understanding the mechanism by which miR-449 does this we examined the effect of miR-449 on SIRT1 and HDAC1. [score:1]
Interestingly, miR-449 was recently shown to operate under the control of E2F1 [55, 60]. [score:1]
SNU638 were transfected with 50 nM of miR-34a or miR-449b duplexes with siGLO siRNA used as negative control. [score:1]
As miR-34a has been firmly placed downstream from p53 [30- 33] it was relevant to test if the same was the case for miR-449. [score:1]
Flow cytometric analysis of propidium iodide-stained cells transfected with miR-449b showed a G [1 ]accumulation 48 hours after transfection, followed at 72 hours post transfection by an accumulation of cells in the sub G [1 ]fraction suggestive of cell death (figure 2d). [score:1]
miRNA precursors were purchased from Ambion, hsa-miR-449a (PM11521), hsa-miR-449b (PM11127) and hsa-miR-34a (PM11030). [score:1]
Figure 4 miR-449 activates the p53 pathway. [score:1]
Hence, this study further underlines the importance of miRNAs in cancer and points to an important function for miR-449 in gastric cancer. [score:1]
Furthermore we show that miR-449 induces senescence and apoptosis by activating the p53 pathway. [score:1]
To evaluate the importance of miR-449 in human malignancies we next examined the expression of miR-449 in 10 gastric cancer biopsies. [score:1]
To rule out cell line-specific effects, the functional consequences of miR-449 re-introduction in terms of cell cycle arrest were verified in MKN74 cells (Additional file 1, figure S3). [score:1]
We also found that re-introduction of miR-449 induces senescence and apoptosis. [score:1]
[1 to 20 of 102 sentences]
2
[+] score: 85
q-PCR analysis of mRNA expression for aire, spt1, Insulin and CRP in 2-DG FTOC (Control, 2-DG FTOC; miR-449a, 2-DG FTOC infected with lentivirus expressing miR-449a for 4 days; miR-449a/miR-449/34 sponge, 2-DG FTOC infected with lentivirus expressing miR-449a and miR-449/34 sponge for 4 days). [score:7]
Thymic in situ injection Virus expressing Control-GFP or miR-449/34 sponge-GFP were packaged according to Lenti-X™ shRNA Expression Systems User Manual (Clontech). [score:5]
Although the expression levels of miR-449b, miR-449c, miR-34b and miR-34c were much lower than that of miR-449a, the expression abundance of miR-34a was comparable to that of miR-449a in developing thymus (data not shown). [score:5]
Statistic analysis of the K14 [+] and K8 [+] zone in GFP -expressing area revealed that K14 [+] GFP [+] mTEC was significantly reduced, while K8 [+] GFP [+] cTEC was increased after expression of miR-449/34 sponge (Fig.   7B). [score:5]
Clues from the expression profiling of miR-449/34 cluster during thymus development, miR-34 may function at early stage before E15.5 while miR-449 may regulate late differentiation of mTECs. [score:5]
Expression of miR-449/34 sponge resulted in reduced GFP [+] medulla (K14 [+]GFP [+]) and augmented GFP [+] cortex (K8 [+]GFP [+]) in GFP -expression area (Fig.   7A 1 [st] and 2 [nd] panel). [score:5]
Virus expressing Control-GFP or miR-449/34 sponge-GFP were packaged according to Lenti-X™ shRNA Expression Systems User Manual (Clontech). [score:5]
The generation of miR-449/34 sponge transgenic mice or miR-449/34 knock out mice may help to reveal the molecular mechanisms of miR-449/34 in regulation of thymus development. [score:4]
Expression of miR-34a was increased in miR-449a [Ins/Ins] thymusThe functional redundancy of miR-449/34 family has been previously reported 38– 40. [score:3]
However, the expression of miR-449b was slightly increased(Fig.   S4B). [score:3]
However, the other two members of miR-449 family, miR-449b and miR-449c, showed very low background expression and only miR-449c showed a slight increase in new-born thymi (Fig.   2A). [score:3]
Thymic in situ expression of miR-449/34 sponge reduced mature mTECs. [score:3]
Unlike miR-449 cluster, expression of miR-34 cluster was consistently decreased from the detecting point E14.5 (Fig.   2B). [score:3]
The GFP protein acted as a reporter gene of miR-449/34 sponge expression. [score:3]
Injection of miR-449/34 sponge virus resulted in reduced GFP [+] medulla and augmented GFP [+] cortex, reflected on the extensive miR-449/34 sponge-GFP expression in cortex. [score:3]
Figure 7Thymic in situ expression of miR-449/34 sponge reduced mature mTECs. [score:3]
Upon RANKL stimulation, expression of miR-449a was significantly increased while other members of miR-449 cluster were undetectable (Fig.   1B). [score:3]
Fetal thymic lobes (2-DG FTOC) were cultured in RPMI1640-10%FBS medium and infected with lentivirus carrying miR-449a or miR-449/34 sponge expressing vectors. [score:3]
Thus, these results indicated that expression of miR-449/34 sponge to interfere with miR-449a and other cluster members blocked normal maturation of mTECs. [score:3]
Taken together, these results indicated that interference of miR-449a and miR-449/34 cluster blocked normal differentiation of mTEC and may also have impact on cTEC development. [score:2]
To further confirm the impact of miR-449a on mTEC development, we introduced miR-449/34 sponge through thymic in situ injection of lentivirus in 3-week old mice. [score:2]
Neutralization of miR-449a and other miR-449/34 family members reduced the number of mature MHCII [hi] mTECs in thymus. [score:1]
MiR-449 cluster members (miR-449c/449b/449a) share similar seed sequence with miR-34 cluster members (miR-34a, miR-34b/34c) and constitute a conserved miRNA family 38– 40. [score:1]
Control-GFP virus and miR-449/34 sponge-GFP virus were concentrated by ultracentrifugation and stored at −80 °C. [score:1]
The functional redundancy of miR-449/34 family has been previously reported 38– 40. [score:1]
of miR-449/34 sponge that was used to silence miR-449a was sufficient to neutralize the function of miR-449a in 2-DG FTOC (Fig.   4). [score:1]
To clone miR-449/34 sponge, forward sequence: 5'-gatccACCAGCTAACTATCACTGCC ACGATACCAGCTAACTATCACTGCCAACGCGACCAGCTAACTATCACTGCCACGATACCAGCTAACTATCACTGCCAACG CGACCAGCTAACTATCACTGCCACGATACCAGCTAACTATCACTGCCAttttttg-3' and reverse sequence: 5'-aattcAAAAAATGGCAGTGATAGTTAGCTGGTATCGTGGCAGTGATAGTTAGCTGGTCGCGTTGGCA GTGATAGTTAGCTGGTATCGTGGCAGTGATAGTTAGCTGGTCGCGTTGGCAGTGATAGTTAGCTGGTATCGTGGCAGTGA TAGTTAGCTGGT g-3' were synthesized, annealed and cloned into plvx-shRNA2 (Clontech). [score:1]
In silico analysis identified that members of the miR-449 cluster and miR-34 cluster possess similar mature sequences and seed regions (Fig.   6B). [score:1]
[1 to 20 of 28 sentences]
3
[+] score: 63
A hypothetical mo del of age -dependent miRNAs regulating LCs development and function is shown in Figure 6. Table 1 miRNAs in aging putative targets function in LC reference miR709↑ RANK LC development and homeostasis↓ 49 IRF8 LC development and homeostasis↓ 29 AhR impair LC maturation 33 miR449↑ TGFβRII LC development and homeostasis↓ 32, 46 RunX3 LC development and homeostasis↓ 30 CSF1R LC development and survival↓ 35 miR9↑ TGFβRII LC development and turnover↓ 32, 46 RunX3 LC development and homeostasis↓ 30 RANK LC development and homeostasis↓ 49 miR10a↓ Gfi1 LC development and homeostasis↓ 28 miR200c↓ C/EBP LC differentiation↓ 31 Langerin LC antigen uptake ↑ 22, 23 Gfi1 LC development and homeostasis↓ 28 miR744↓ TGFβI inhibit LC maturation 32, 46 miR20b↓ RANKL inhibit LC maturation 34 miR205↓ C/EBP LC differentiation↓ 31 The density of LCs in the epidermis is known to decrease with age in mice [21]. [score:19]
A hypothetical mo del of age -dependent miRNAs regulating LCs development and function is shown in Figure 6. Table 1 miRNAs in aging putative targets function in LC reference miR709↑ RANK LC development and homeostasis↓ 49 IRF8 LC development and homeostasis↓ 29 AhR impair LC maturation 33 miR449↑ TGFβRII LC development and homeostasis↓ 32, 46 RunX3 LC development and homeostasis↓ 30 CSF1R LC development and survival↓ 35 miR9↑ TGFβRII LC development and turnover↓ 32, 46 RunX3 LC development and homeostasis↓ 30 RANK LC development and homeostasis↓ 49 miR10a↓ Gfi1 LC development and homeostasis↓ 28 miR200c↓ C/EBP LC differentiation↓ 31 Langerin LC antigen uptake ↑ 22, 23 Gfi1 LC development and homeostasis↓ 28 miR744↓ TGFβI inhibit LC maturation 32, 46 miR20b↓ RANKL inhibit LC maturation 34 miR205↓ C/EBP LC differentiation↓ 31 (A) LCs were isolated using AutoMACS with anti-MHCII-PE and anti-PE microbeadsfollowed by a cell sorter. [score:19]
Thus, upregulated miR-449 and miR-9 in aged LCs could downregulate the TGF-β signaling pathway and block LC development. [score:8]
Thus, upregualated miR-709 and miR-449 in aging LCs may downregulate the expression of IFR and CSFR, causing a deficiency in LCs development in aging mice. [score:7]
Based on the miRNAs potentially linked to LCs development and function, we have further confirmed that miR-709, miR-449 and miR-9 were upregualated in aging, while miR-200c and miR-10a were downregulated in aging by using single TaqMan RT-PCR assays (Figure 5 D). [score:4]
miRNAs miR-449 and miR-9 potentially target TGFβ1, TGFβRI, TGFβRII, RunX3 and C/EBP, which are involved in TGF-β signaling (Figure 6). [score:3]
Interestingly, miR-709 and miR-449 also target IFR8 and CSF1R. [score:3]
[1 to 20 of 7 sentences]
4
[+] score: 62
Identical expression profiles between miR-34b/c and miR-449a/b/c, and the upregulation of miR-34b/c in miR-449 KO testes (Bao et al., 2012), strongly suggest that these two miRNA clusters might be functionally redundant. [score:6]
Both miR-34b/c- and miR449 -null sperm can fertilize wild type oocytes and support embryonic developmentTo test if miR-34b/c- and miR-449 -null sperm can fertilize WT oocytes and support preimplantation development, we performed ICSI using epididymal sperm isolated from these two KO males. [score:3]
MicroRNA-449 and microRNA-34b/c function redundantly in murine testes by targeting E2F transcription factor-retinoblastoma protein (E2F-pRb) pathway. [score:3]
As described above, these miRNA KO sperm lacked expression of either miR-34b/c or miR-449 (Fig.  1B). [score:3]
Fig. 3. Computer-assisted sperm analyses (CASA) of epididymal sperm collected from wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice. [score:2]
Testicular and epididymal histology and sperm morphology of wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice at the age of 10 weeks. [score:2]
Both miR-34b/c- and miR449 -null sperm can fertilize wild type oocytes and support embryonic development. [score:2]
Fertilization and development of WT oocytes injected with WT or miR-d KO (miR-34b/c [−/−];miR-449 [−] [/−]) spermatozoa. [score:2]
To test if miR-34b/c- and miR-449 -null sperm can fertilize WT oocytes and support preimplantation development, we performed ICSI using epididymal sperm isolated from these two KO males. [score:2]
Here, we show that both miR-34b/c- and miR-449 -null male mice displayed normal fertility, and that intracytoplasmic injection of either miR-34b/c- or miR-449 -null sperm led to normal fertilization, normal preimplantation development and normal birth rate. [score:2]
miR-449 and miR-34b/c knockout mice were generated as described (Choi et al., 2011; Bao et al., 2012). [score:2]
Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesis. [score:2]
The fact that both miR-34b/c -null and miR-449 -null spermatozoa perform as efficiently as the WT spermatozoa in ICSI demonstrates that a lack of either of the two miRNA clusters does not affect fertilization and early development either in vitro or in vivo. [score:2]
Computer-assisted sperm analyses (CASA) of epididymal sperm collected from wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice. [score:2]
Normal fertility of miR-34c or miR-449 KO males suggests that sperm-borne miR-34c or miR-449 alone is dispensable for fertilization and early development. [score:2]
Fig. 2. Testicular and epididymal histology and sperm morphology of wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice at the age of 10 weeks. [score:2]
Term development of mouse embryos developed from the oocytes fertilized by injection of WT and miR-d KO (miR-34b/c [−/−]; miR-449 [−/−]) round spermatids. [score:2]
Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway. [score:2]
However, miR-34b/c and miR-449 double knockout (miR-d KO) males were infertile due to severe spermatogenic disruptions and oligo-astheno-teratozoospermia. [score:2]
Similar ICSI experiments were performed using miR-449 -null sperm, and no effect on fertilization and preimplantation development was observed (supplementary material Table S3; Fig. S1). [score:2]
Moreover, miR-34c belongs to a family of five miRNAs including miR-34b, miR-34c, miR-449a, miR-449b, and miR-449c, which are encoded by two miRNA gene clusters: miR-34b/c and miR-449. [score:1]
Inactivation of either the miRNA-34b/c or the miR-449 miRNA cluster does not affect fertility. [score:1]
Histological and TUNEL analyses on developing testes of wild-type (WT) and miR-34b/c;miR-449 double KO (miR-d KO) male mice and the acridine orange (AO) staining of WT and miR-d KO spermatozoa. [score:1]
Inactivation of either the miRNA-34b/c or the miR-449 miRNA cluster does not affect fertilityAs reported previously, global miR-34b/c KO and miR-449 KO mice are viable (Choi et al., 2011; Bao et al., 2012). [score:1]
Oligoasthenoteratozoospermia and infertility in mice deficient for miR-34b/c and miR-449 loci. [score:1]
We observed no differences between WT controls and mating pairs with different combinations between KO and WT mice, suggesting that both miR-34b/c and miR-449 global KO males and females both have normal fertility. [score:1]
miR-449 KO mice are viable and fertile (Bao et al., 2012), and here we show that miR-34b/c global KO mice also display normal fertility. [score:1]
In summary, although either of the two miRNA clusters (miR-34b/c and miR-449) is dispensable for male fertility, ablation of both results in disrupted spermatogenesis and male infertility. [score:1]
Fig. 4. Histological and TUNEL analyses on developing testes of wild-type (WT) and miR-34b/c;miR-449 double KO (miR-d KO) male mice and the acridine orange (AO) staining of WT and miR-d KO spermatozoa. [score:1]
Bars represent proportions of red, yellow/orange, or red sperm in WT, miR-34b/c KO, miR-449 KO, and miR-d KO mice. [score:1]
Since the five miRNAs (miR-34b, miR-34c, miR-449a, miR-449b and miR-449c) share the same seed sequence of “GGCAGUG”, we analyzed two possible 6nt seed sequence combinations, including one with the 1 [st]–6 [th] nt and the other with the 2 [nd]–7 [th] nt (“selected words”). [score:1]
Adult (6–8 weeks) WT, miR-449 KO and miR-34b/c KO female mice were superovulated using pregnant mare's serum gonadotropin (PMSG, 5 IU/mouse, i. p. ), followed by human chorionic gonadotropin (hCG, 5 IU/mouse i. p. ) 48 h later. [score:1]
Similarly, adult miR-449 KO males were bred with adult WT or miR-449 KO females. [score:1]
To evaluate whether miR-34c and the other 4 members of the miRNA family have an essential role in the first cleavage division both in vivo and in vitro, we analyzed miR-34b/c (Choi et al., 2011) and miR-449 (Bao et al., 2012) knockout mice, and also generated miR-34b/c; miR-449 double knockout (herein called miR-d KO) mice. [score:1]
As reported previously, global miR-34b/c KO and miR-449 KO mice are viable (Choi et al., 2011; Bao et al., 2012). [score:1]
[1 to 20 of 35 sentences]
5
[+] score: 37
Mice heterozygous for the miR-34bc [Fl], targeted Dcr and miR-449 targeted alleles were crossed to Deleter Cre [43] to generate the miR-34b [−], Dcr [FH] and miR-449 [−] alleles, respectively. [score:5]
The targeting vector used for introduction of loxP flanked Neomycin (Neo) cassette into the miR-449 locus and the schematic map of the targeted miR-449 before and after Cre -mediated-recombination are shown. [score:5]
Our analysis identifies miR-34b/c and miR-449 loci as specifically and abundantly expressed in post-mitotic germ cells. [score:3]
miR-34b/c and miR-449 are selectively expressed in post-mitotic spermatogenesis. [score:3]
With the similarity of expression of miR-34b/c and miR-449 loci and their potential to be functionally redundant with respect to spermatogenesis, we generated miR-34bc [−/−];449 [−/−] mice (Fig. 3A) that were born in Men delian ratios. [score:3]
A 8 kb DNA fragment corresponds to the wild-type miR-449 locus, integration of loxP flanked neo cassette of introduces an additional BamHI site, thus decreasing the size of the BamHI DNA fragment recognized to 6.6 kb in the miR-449 targeted allele. [score:3]
The Dcr [FH], miR-34bc and miR-449 targeting constructs were electroporated into A9 ES cells (ESCs) and manipulated to generate mice fully derived from ESCs [41]. [score:3]
Both the miR-34b/c and miR-449 showed highly restricted expression profiles across an assortment of mouse tissues (Fig. 2C) [32]. [score:3]
Our study identifies the miR-34b/c and miR-449 as the first miRNA loci required for mammalian spermatogenesis. [score:1]
This strategy is designed to remove the miR-449 without affecting the Cdc20B gene. [score:1]
The miR-449a, miR-449b and miR-449c miRNAs are encoded in 1.6 kb of sequence within an intron of 20 Kb of the coding Cdc20B gene. [score:1]
For the miR-34bc [−/−];449 [−/−] experiments, miR-34bc [+/−];449 [+/−] or miR-34bc [+/−] or miR-449 [+/−] were used as control mice. [score:1]
The miR-34b/c miRNAs are part of a miR-34 family encompassing six miRNAs (miR-34a, b, c and 449a, b, c) encoded by three distinct loci (miR-34a, miR-34b/c and miR-449) (Fig. 2B). [score:1]
Having established that loss of both miR-34b/c and miR-449 loci results in oligoasthenoteratozoospermia, we next wanted to define the etiology of this disorder. [score:1]
Deletion of miR-34bc and miR-449 leads to sterility due to the production of abnormal spermatozoa with reduced motility. [score:1]
To generate mice lacking all miR-449 miRNAs, we replaced the hairpins that encode all miR-449s with loxP flanked neo cassette. [score:1]
Position of the DNA encoding the pre-miR-449a, pre-miR-449b and pre-miR-449c are indicated within the intron of Cdc20B. [score:1]
[1 to 20 of 17 sentences]
6
[+] score: 27
For instance, miR-449-5p exerts anti-IAV activities by inhibiting histone deacetylase and, therefore, inducing IFNβ expression (18), and inhibition of miR-223-3p (which was more highly expressed in the DBA/2J strain in our study) reduced mortality and delayed death of H5N2-infected mice (64). [score:9]
Expression of 75 miRNAs, including miRNAs of the miR-21, miR-223, miR-34, and miR-449 correlated with both HA mRNA expression and any of the hematological parameters. [score:5]
Many miRNAs whose expression differed between DBA/2J and C57BL/6J mice during infection belong to the miR-467, miR-449, and miR-34 families. [score:3]
Indeed, changes in expression of several of these 20 miRNAs (miR-147-3p, miR-155-3p, miR-223-3p, as well as the miR-34 and miR-449 families) correlate with IAV virulence (14, 15, 17, 64). [score:3]
The miR-34 and miR-449 families control epithelial barrier repair (65) and regulate multiciliogenesis via the Delta/Notch pathway (66, 67), which might help transport virions out of the respiratory tract (68) and reduce end-organ damage. [score:2]
Small RNA profiling of influenza A virus-infected cells identifies miR-449b as a regulator of histone deacetylase 1 and interferon beta. [score:2]
Using the ViTa Database, the human homologs of miR-135b-5p, miR-147-3p, miR-31-5p, miR-379-5p, miR-7a-5p, as well as the miR-449 (-5p) and miR-34 (-5p) families, were predicted to bind to viral RNA segments of influenza A/Puerto Rico/8/34/Mount Sinai (H1N1). [score:1]
Of note, miR-31-5p, miR-379-5p, miR-7a-5p, as well as some members of the miR-449 (-5p) and miR-34 (-5p) families were moderately to highly abundant (>10 CPM), making it more likely that they would bind to a biologically relevant number of viral RNAs. [score:1]
Of these two, the miR-449 family is of considerable interest with respect to the higher resistance of C57BL/6J mice, because—in addition to their different abundance in the two strains—these miRNAs were more strongly induced in C57BL/6J mice, suggesting that their higher abundance is less due to mere leukocyte infiltration. [score:1]
[1 to 20 of 9 sentences]
7
[+] score: 26
miR-449 and miR-34 have the same inhibitory seed sequence and function together in mouse development, such that knockout of either miR-449 or miR-34 paralogs alone does not yield a detectable developmental phenotypes, whereas knockout of both sets of miRNAs mice show defects in brain development and spermatogenesis caused, at least in part, by defective microtubule and associated cilia function [22]. [score:8]
The fact that we detect reduction in expression of paralogs of both miR-34 and miR-449 genes in sperm of men with high ACE scores, as well as in sperm of mice exposed to sociability stress and in embryos derived from them, adds to the potential functional significance of these findings. [score:3]
b– c Correlation plot comparing relative expression of miR-449a to miR-449b (b) and miR-34b to miR-34c (c) for individual samples fitted with single-variable linear regression. [score:3]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, b To determine whether early life stress also regulates sperm miR-449 and miR-34 in mice, we exposed adolescent males to chronic social instability (CSI) stress [33], which induces sociability defects in male mice for at least 1 year after stress ceases. [score:2]
Wu J Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesisProc. [score:2]
To determine whether early life stress also regulates sperm miR-449 and miR-34 in mice, we exposed adolescent males to chronic social instability (CSI) stress [33], which induces sociability defects in male mice for at least 1 year after stress ceases. [score:2]
Interestingly, both sharply reduced levels of sperm miR-449 and miR-34 family members and severe stress have been found to be associated with reduced sperm quality and fertility in men 32, 36. [score:1]
Fig. 1 a qPCR analysis of miR-449a, miR-449b-5p, miR-34b-3p, miR-34c-5p, miR-152-3p, and miR-375-3p in sperm RNA from low ACE group (score 0–1, n = 5) vs. [score:1]
One set includes two of the three paralogs of miR-449, miR-449a, and miR-449b, and the other set, two of the three paralogs of miR-34, miR-34b, and miR-34c. [score:1]
a qPCR analysis of miR-449a, miR-449b-5p, miR-34b-3p, miR-34c-5p, miR-152-3p, and miR-375-3p in sperm RNA from low ACE group (score 0–1, n = 5) vs. [score:1]
Wang M Sperm-borne miR-449b influences cleavage, epigenetic reprogramming and apoptosis of SCNT embryos in bovineSci. [score:1]
Because the relative levels of miR-449a and miR-449b, as well as miR-34b and miR-34c, were similar to each other in almost every sample (Fig. 1b, c) miR-449a and miR-34c were used as representatives of each family. [score:1]
[1 to 20 of 12 sentences]
8
[+] score: 20
In particular, miR-31 and miR-34c were not modulated (Figures 1B,C); miR-206 was up-regulated (Figure 1D) and miR-449 and miR-335 were down-regulated (Figures 1E,F) in the diaphragm of 4-week-old mdx mice. [score:7]
In particular, we observed a down-regulation of miR-449 (Figure 2C), and an up-regulation of miR-206 (Figure 2D) in the diaphragm of 4-week-old mdx/mIGF-1 mice, compared to mdx littermates. [score:6]
In contrast, mIGF-1 overexpression modulated regenerative miR-449 and miR-206 (Figures 2C,D) but not miR-335 expression (Figure 2B). [score:5]
miR-335 and miR-449 are potent mediators of cell differentiation (Lizé et al., 2011; Tomé et al., 2011), whereas miR-494 has been proven critical for the myocytes’ adaptation and survival during hypoxia/ischemia (Han et al., 2011). [score:1]
Dystrophic-signature miRNAs has been divided into three main classes: degenerative miRNAs (miR-1, miR-29c, and miR-135a), regeneration miRNAs (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), and inflammatory miRNAs (miR-222 and miR-223) (Greco et al., 2009). [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 18
In addition, miR-449 expression is not substantially increased in miR-34 -null mice, and activation of the p53 pathway does not lead to significant upregulation of miR-449 (Figure S8). [score:6]
Although our observation that single KO and miR-34 [T KO/T KO] mice produce viable offspring argues against an essential role for miR-34 in these processes, members of the related miR-449 family, that are particularly highly expressed in the testis (Figure S8), could partially compensate for miR-34 loss in this context. [score:3]
Figure S8Expression of miR-449a, miR-449b and miR-449c. [score:3]
First, in the tissues and cells used in our experiments, the expression of miR-449 members is much lower compared to miR-34a and miR-34c, as judged by multiple independent methods including qPCR, Northern blotting and high throughput sequencing (Figure S8 and data not shown). [score:2]
Notice the loss of signal for miR-449b in the miR-34 [T KO/T KO] lung and testis samples, which likely reflects cross-hybridization of the miR-449b probe to miR-34. [score:1]
In particular, members of the miR-449 family (miR-449a, b and c) have the same “seed” sequence as miR-34, and miR-34 antagonists could in principle impair their function as well. [score:1]
For each tissue, the same membrane was serially probed first for the three members of the miR-449 family and lastly for miR-34a. [score:1]
A conclusive test for this hypothesis will require the generation of compound miR-34 and miR-449 mutant animals, but several lines of evidence suggest that this explanation is not particularly likely. [score:1]
[1 to 20 of 8 sentences]
10
[+] score: 17
miR-34-5p (B), miR-410-3p (C), miR-449-5p (D) and miR-203 (E) expression, determined by Real-time PCR, was down-regulated in HPCx tumor tissues from gemcitabine -treated mice (p < 0.05). [score:6]
Real-time PCR confirmed that miR-34-5p (Figure 1B), miR-410-3p (Figure 1C), miR-449-5p (Figure 1D) and miR-203 (Figure 1E) were down-regulated in HPCx tumor tissues from gemcitabine -treated mice (P < 0.05). [score:4]
Thus, we identified potential miRNAs related to gemcitabine resistance in a human pancreatic cancer xenograft (HPCx) with miRNA microarray analysis and showed that miR-34-5p, miR-410-3p, miR-449-5p and miR-203 were significantly down-regulated in HPCx tumor tissues from gemcitabine -treated mice. [score:4]
Real-time PCR was used to detect the expression levels of miR-34-5p, miR-410-3p, miR-449-5p, miR-203, HMGB1, ARFIP1, GRIA2, CPEB4, NDFIP2, KLF6, PARG, OTX2, TMEFF2, TRPC1 and KLHL5. [score:3]
[1 to 20 of 4 sentences]
11
[+] score: 15
However miR-449 expression was shown to be significantly downregulated in the antrum of gastrin knockout mice relative to wild-type counterparts [25]. [score:7]
Dysregulation of the miR-449/pRB-E2F1 regulatory loop therefore increases E2F1 activity and promotes cell cycle progression and inhibits apoptosis in gastric cancer. [score:5]
The transcription factor E2F1 promotes miR-449 transcription which inhibits the oncogenic genes CDC25A and CDK6. [score:3]
[1 to 20 of 3 sentences]
12
[+] score: 12
Therefore, the miR-449 cluster, including miR-449a, may undergo similar regulatory processes, contributing to the suppression of colon tumorigenesis by miR-449a. [score:4]
Previous papers have reported that overexpression of miR-449a reduced Notch signaling [40] and that blocking of miR-449 -binding sites of endogenous human Notch1 or frog Dll1 strongly repressed multiciliogenesis [41]. [score:3]
In addition, the miR-449 cluster contains sequences and secondary structures similar to those of the miR-34 family, which was found to be a p53-responsive gene cluster 35, 36. miR-34 targets the histone deacetylase SIRT1 [37], leading to the accumulation of acetylated and therefore highly active p53. [score:3]
The miR-449 cluster contains sequences and secondary structures similar to those of the miR-34 family and has therefore been classified as a single family of miRNAs. [score:1]
MicroRNA-449a (miR-449a) is a member of the miR-449 family (miR-449a, miR-449b, and miR-449c). [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 12
Following chronic CS exposure, 12 miRNAs (miR-146a, miR-148a, miR-152, miR-21, miR-26a, miR-30a-5p, miR-30c, miR-31, miR-31*, miR-342-3p, miR-376b* and miR-449) were differentially expressed in both lung tissue and BAL supernatant of which 10 showed concordant up- or down-regulation. [score:6]
By focusing on the overlap between subacute and chronic CS exposure within the same compartment, or the overlap between miRNAs with altered expression levels in BAL and lung, we narrowed the pool of interesting miRNAs down to 18: let-7b, let-7c, miR-135b, miR-138, miR-146a, miR-148a, miR-152, miR-155, miR-21, miR-26a, miR-30a-5p, miR-30c, miR-31, miR-31*, miR-322*, miR-342-3p, miR-376b* and miR-449. [score:3]
Only miR-449 and miR-148a displayed different expression patterns in the two compartments (Fig.   3b). [score:3]
[1 to 20 of 3 sentences]
14
[+] score: 11
Both miR-449a and miR-449b were first described as tumor suppressors in osteosarcoma cells, targeting CDK6 and CDC25A [31]. [score:5]
In an independent cohort of 163 radical prostatectomy patients, miR-449b overexpression was shown to be an independent predictor of recurrence after prostatectomy [37]. [score:3]
In contrast, several studies supported the oncogenic phenotype of miR-449a and miR-449b. [score:1]
The role of miR-449a and miR-449b (another member of the miR-449 family cluster and also located in the second intron of CDC20b) in other human malignancies appears to be controversial, and varies largely depending on the biological context. [score:1]
In prostate cancer, microRNA profiling identified 31 microRNAs, including miR-449b, that were associated with recurrence [37]. [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 9
Treatment days miRNAExpression change [#] Predicted mRNA target(s)Expression change [#]GD 8/11 [†] miR-1192 ↑ Atf1, Gng4, Map3k1, Rpe, Setd2, Stxbp6, Zc3h6 ↓ miR-532-5p ↑ Atf1, Itpripl2, Stxbp6 ↓GD 14/16 [*] miR-10b ↓ Aak1 ↑ miR-184 ↓ Myl9 ↑ miR-302c ↑ Ccdc6, Mfap3, Ptpro, Rnd3, Rpl36a/r, Sema3c, Stoml3, Supt3h ↓ miR-342-5p ↓ Aak1, Cables2, Rhog ↑ miR-343 ↑ Asic4, Dcn, Gpr116, Ptpro, Stoml3 ↓ miR-449b ↓ Ina ↑PD 4/7 [†] miR-26b ↑ Adam9, Chsy1, Cnr1, Exoc8, Hs6st1, Lingo1, Map3k7, Mras, Pfkfb3, Ppm1b, Rhou, Sema6d, Shank2, Tab3, Tdrd7, Ube2j1 ↓ miR-34b-5p ↓ Kitl ↑ miR-184 ↑ Ncor2, Prkcb ↓ miR-721 ↑ Akap11, B4galt, Cnr1, Efnb2, Fam20b, Ino80, Irf1, Lrrk2, Ncoa3, Pfkfb3, Ppargc1a, Rbm9, Shank2, Spen, Sphk2, Tsc1, Wdfy3 ↓ miR-1970 ↓ Arhgap6 ↑ # Significance for expression change was 1.2-fold, p < 0.05. [score:9]
[1 to 20 of 1 sentences]
16
[+] score: 8
Hnf4a is essential to liver development and maintenance, and when suppressed, it can cause epigenetic changes that lead to increased incidence of hepatocellular cancer [59 Reduced expression of miR-449 in aging liver would increase Hnf4a expression, possibly preventing hepatocyte transformation. [score:8]
[1 to 20 of 1 sentences]
17
[+] score: 7
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-191, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, mmu-mir-429, mmu-mir-449a, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-449c, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-124b
Similarly, expression of miRNAs from the respiratory epithelium, such as miR-449, is abolished in E16.5 Foxg1-Cre [+/−]; Dicer [loxP/loxP] mutants, confirming that Dicer function can be effectively knocked out in all structures originating from the olfactory placodes (Figure 3C). [score:4]
Five of 24 probes, including miR-449 and miR-205, displayed expression limited to the nonneural respiratory epithelium (Figure 2A, left column, and Table S3). [score:3]
[1 to 20 of 2 sentences]
18
[+] score: 7
In addition, the lack of a strong effect of genetic deletion of miR-34a could also be secondary to functional redundancy provided by the other miR-34 members or other p53-regulated tumor suppressor miRNAs [45– 49] or by the p53-independent miR-449 family, which shares a seed sequence with miR-34 [50]. [score:4]
In mice, miR34b/c and the related miR-449 cluster are expressed specifically in multiciliated epithelia and their KO causes infertility and respiratory dysfunction [6, 7], supporting their distinct roles. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
1Proliferation, Invasion, Tumor suppression [63– 66] miR-344 ↓2.0 ↓3.2 NA miR-346 ↓2.4Proliferation [67, 68] miR-362 ↓2.3Proliferation, Invasion, Apoptosis [69– 76] miR-369 ↓2.8 ↓2.6 ↓2.1Aerobic glycolysis [77] miR-374 ↑3.0 ↓2.2 NA miR-449 ↑2.7 ↑2.4Proliferation [78– 81] miR-463 ↓2.7 NAmiR-466 [°] ↑2.4 ↑2.1 ↓3.5 NA miR-483 ↓3.2Apoptosis [82] miR-493 ↑2.1 ↓2.2Proliferation [83– 85] miR-499a ↓5.0 ↑2.3Proliferation [86] miR-504 ↓2.6 ↑2.0Proliferation, Apoptosis [87, 88] miR-579 ↑2.8 NAmiR-582 [^] ↑2.4Proliferation [89] miR-615 ↓2.1Proliferation, Invasion [90, 91] miR-652 ↑2.4Proliferation, EMT [92, 93] miR-669b ↓2.1 NA miR-669h ↓3.6 ↑2.3 NA miR-669i ↓2.3 NA miR-669k ↓7.2 ↓5. [score:3]
[1 to 20 of 2 sentences]
20
[+] score: 7
MiR-29 activates p53 by targeting p85-alpha and CDC42 (18), miR-449 targets SIRT1 and HDAC1 (19), and miR-32 targets TSC1 and activates mTOR in human glioblastoma multiforme (20), all of which lead to the stabilization of p53. [score:7]
[1 to 20 of 1 sentences]
21
[+] score: 6
To confirm the role of miR-34b-3 and miR-449 in the inhibition of cancer cell proliferation in vivo, we performed subcutaneous tumor mouse mo dels. [score:3]
The double knock out mice of miR-34b/c and miR-449 show basal forebrain structures, absence of motile cilia in trachea and oviducts, and severe disruption of spermatogenesis, but no spontaneous tumor formation [49]. [score:2]
MiR-449 cluster have very similar sequences and secondary structures belonging to the miR-34 family. [score:1]
[1 to 20 of 3 sentences]
22
[+] score: 6
Next, we studied the effect of miR-449 overexpression on lung epithelial proliferation. [score:3]
MiR-449a, and its paralogs miR-449b and miR-449c, are co-regulated with their host gene CDC20B [30]. [score:2]
E-F. Expression of the 3C2 viral marker was measured in RCAS-mir449 infected chick samples (*, lung airways or parabronchi). [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 6
We also found that miR-29c regulates the miR-34c and miR-449 expression by targeting DNMT3a and DNMT3b in NPC cells [10]. [score:6]
[1 to 20 of 1 sentences]
24
[+] score: 5
Sandbothe M The microRNA-449 family inhibits TGF-beta -mediated liver cancer cell migration by targeting SOX4J. [score:5]
[1 to 20 of 1 sentences]
25
[+] score: 5
The eQTL for miR130b (Chr 9: 36–44 Mb, −log P = 4.42), miR-542-3p (Chr 12: 79–103 Mb, −log P = 4.73) and miR-449b (Chr 14: 50–72 Mb, −log P = 4.49) were mapped on QTL for disease onset on chromosome 9, 12 and 14. [score:3]
Genes that are involved in transcriptional processes, such as Polr3f, Polr2a, Polr3g and Polr2a were also mapped to the eQTL for miR-409, miR-681, miR-34 and miR-449. [score:1]
We found that 4/38 (10.53 %) miRNAs (miR-291a-3p, miR-341, miR-449b and miR-681) exhibits in dels in CAST/EiJ strain on chromosome 7 (3.2 Mb), 12 (69 and 109 Mb) and 13 (113 Mb), which may suggest false positive associations for those loci (Table  1). [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 5
The top 5 miRNAs (miR-449b-5p, miR-767-5p, miR-98-5p, let-7b-5p and let-7f-5p) not reported in literature were validated by demonstrating rescue of reporter gene downregulation upon mutation of potential binding sites (Van Peer et al., in preparation). [score:5]
[1 to 20 of 1 sentences]
27
[+] score: 5
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34b, mmu-mir-34a, mmu-mir-449a, mmu-mir-449c
miR449 mimic, under JAM‐A overexpression). [score:3]
miR449 mimic), * P‐value = 0.01928 (Neg. [score:1]
miR449 mimic). [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 4
Few of the highly upregulated microRNAs were: miR-79, miR-183, miR-206, miR-207, miR-296-3p, miR-298, miR-380-5p, miR-433, miR-449b, miR-705, miR-761 (S1 Table). [score:4]
[1 to 20 of 1 sentences]
29
[+] score: 4
NEAT1 functions as an oncogenic factor in multiple types of cancer, including breast cancer, and its expression is under the regulation of ERα signaling, the miR-449b-5p/c-Met axis, and hypoxia responses [31– 34]. [score:4]
[1 to 20 of 1 sentences]
30
[+] score: 4
A recent paper reported that inactivation of two miRNA clusters, miR-34b/c and miR-449 clusters, with identical seed sequences, affected brain development, and microtubule dynamics (Wu et al., 2014). [score:2]
Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesis. [score:2]
[1 to 20 of 2 sentences]
31
[+] score: 3
ICC experiments confirmed that Cx43 and cTnT were convincingly turned on upon over -expression of miRNA449 alone and even more so in combination with miRNA133 (Fig. 3B). [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 3
Wu J Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesisProc. [score:2]
Comazzetto S Oligoasthenoteratozoospermia and infertility in mice deficient for miR-34b/c and miR-449 lociPLoS Genet. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 3
It was previously demonstrated that the miR-449 family contributes to cell fate determination by targeting the Notch signaling pathway [50]. [score:3]
[1 to 20 of 1 sentences]
34
[+] score: 3
LncARSR promoted sunitinib resistance by competitively binding miR-34/miR-449 to facilitate AXL and c-MET expression [34]. [score:3]
[1 to 20 of 1 sentences]
35
[+] score: 3
LncARSR promoted sunitinib resistance by competitively binding miR-34/miR-449 to facilitate AXL and c-MET expression [22]. [score:3]
[1 to 20 of 1 sentences]
36
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
For human miRNAs with same id numbers, only 2 are separated in the consensus families, namely mir-92/mir-92b and mir-449/mir-449b, showing that most of the miRNA families are robust to the variation in the input of the PBC pipeline. [score:1]
We further examined the alignments for mir-92/92b and mir-449/449b. [score:1]
[1 to 20 of 2 sentences]
37
[+] score: 2
Other miRNAs from this paper: mmu-mir-449a, mmu-mir-449c
Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway. [score:2]
[1 to 20 of 1 sentences]
38
[+] score: 2
The miR-449 (a and b) cluster is embedded into an intronic sequence of the mRNA-encoding gene CDC20B on Chr 5q11.2 [17]. [score:1]
Accordingly, in a very recent report miR449 by repressing the Delta/Notch pathway was elegantly shown to control the human airway epithelium and vertebrate multilciliogenesis [32]. [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 2
Small RNA profiling of influenza A virus-infected cells identifies miR-449b as a regulator of histone deacetylase 1 and interferon beta. [score:2]
[1 to 20 of 1 sentences]
40
[+] score: 1
Both miR-208b and miR-449 have been shown to be highly elevated by cardiovascular damage [41], while several plasma miRNAs have been shown to be specifically affected by drug -induced liver damage [42]. [score:1]
[1 to 20 of 1 sentences]
41
[+] score: 1
In these mice, 5 miRNAs were altered in blood but not in lung (miR-34b, miR-106a, miR-449, miR-466, miR-493). [score:1]
[1 to 20 of 1 sentences]
42
[+] score: 1
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-223, mmu-mir-449a, mmu-mir-146b
Six candidate miRNAs were found (miR-146a, miR-146b-5b, miR-223*, miR-561, miR-449a and miR-449b). [score:1]
[1 to 20 of 1 sentences]
43
[+] score: 1
In addition to miR-492, other miRs such as miR-494 and miR-449 were also reported to be associated with various cancers [21- 23]. [score:1]
[1 to 20 of 1 sentences]
44
[+] score: 1
Other miRNAs from this paper: mmu-mir-449a, mmu-mir-449c, xla-mir-449
In mammals as well as in Xenopus, the Ccno gene is adjacent to the genes Mcidas and Cdc20b, which incorporates the miR-449 family in intron 2 (Supplementary Fig. 4a,b). [score:1]
[1 to 20 of 1 sentences]
45
[+] score: 1
Plasma miR208b and miR449 have been shown to be highly elevated by cardivascular damage [42]. [score:1]
[1 to 20 of 1 sentences]
46
[+] score: 1
This is exemplified by the miR-34/miR-449 family (Fig. 1b). [score:1]
[1 to 20 of 1 sentences]
47
[+] score: 1
MicroRNAs are thought to be important in fertility since the double inactivation of miR-34b/c and miR-449 miRNA clusters results in male infertility due to reduced sperm production and decreased sperm motility [6, 31]. [score:1]
[1 to 20 of 1 sentences]
48
[+] score: 1
The results revealed potentially conserved sites for approximately nine miRNA family candidates (miR-30c, miR-34a/c, miR-449b, miR-181, miR-301a, miR-421, miR-299-5p, miR-609 and miR-99a) in the PAI-1 mRNA 3′ UTR. [score:1]
[1 to 20 of 1 sentences]