sort by

4 publications mentioning dme-mir-996

Open access articles that are associated with the species Drosophila melanogaster and mention the gene name mir-996. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 201
Other miRNAs from this paper: dme-mir-279, dme-mir-286, dme-let-7
In either case, we conclude that this dramatic, fully-penetrant, neural cell specification phenotype requires the joint activity of the miR-279 and miR-996 miRNAs, and that either miRNA suffices to direct normal development of these neurons via joint repression of shared critical target genes. [score:5]
mir-279[ex117] expressed <10% the normal level of miR-996, and mir-279[ex36] did not detectably express miR-996 (Fig 2B). [score:5]
Homozygous [ex117] mutants expressed ~10% of the wild type level of miR-996 and [ex117/ex36] transheterozygous mutants expressed ~5% of miR-996. [score:5]
For average power of rhythmicity, all living flies were included with arrhythmic flies having a value of 0. Nevertheless, given the substantial overlapping capacities of these miRNAs for target regulation (Fig 6A), we asked whether increased levels of mir-996 could influence circadian rhythm. [score:4]
Strikingly, endogenous expression of only a single copy of either 1x-mir-279 or 1x-mir-996 transgenes in the double mutant, thus recapitulating full knockout of either miRNA on top of heterozygosity for the other, was sufficient to rescue adult viability (Fig 3C). [score:4]
For average power of rhythmicity, all living flies were included with arrhythmic flies having a value of 0. Nevertheless, given the substantial overlapping capacities of these miRNAs for target regulation (Fig 6A), we asked whether increased levels of mir-996 could influence circadian rhythm. [score:4]
In more stringent assays, we then showed that single insertions of either "1x" transgenes, recapitulating mir-279 -knockout and mir-996 -knockout conditions, similarly provided essentially full suppression of the double deletion phenotype (Fig 4E and 4F). [score:4]
Altogether, these data indicate that intact mir-996 expression fully complements loss of mir-279 in both nervous system development and adult neurophysiology. [score:4]
These observations strongly hinted that endogenous miR-996 contributes to suppression of CO [2]-sensing neurons in the maxillary palp. [score:3]
We verified comparable ectopic expression of both miR-279 and miR-996 in these transfection experiments (Fig 6B). [score:3]
Interestingly, in this sensitized overexpression background, miR-996 induced substantial behavioral arrhythmia (81% and 44% of the independent UAS-mir-996 insertions exhibited arrhythmia, Fig 6D and Table 2). [score:3]
S2 FigSevere loss of mature miR-996 expression in mir-279 deletion alleles. [score:3]
1005245.g002 Fig 2Severe loss of mature miR-996 expression in mir-279 deletion alleles. [score:3]
The mir-996[ex310] homozygous mutant lacked mature miR-996, validating its nature as a null allele and demonstrating specificity of the miR-996 probe; this mutant expressed miR-279 normally (Fig 2A). [score:3]
Coexpression of miR-279 and miR-996. [score:3]
On the other hand, mir-279[ex117] deletes to within 14 nt of the transcription start site (Fig 1A), which does not abolish, but apparently debilitates expression and/or processing of the intact mir-996 hairpin. [score:3]
Severe loss of mature miR-996 expression in mir-279 deletion alleles. [score:3]
These tests demonstrated specific expression of mature miR-279 and miR-996 in the designated genotypes (Fig 1A). [score:3]
In particular, mir-279[ex117] (which retains some expression of miR-996) exhibits a weaker GR21 phenotype than mir-279[ex36] or mir-279/996[ex15C] (which are nearly null or definitively null for both miRNAs, respectively) under clonal conditions (Fig 1F– 1H). [score:3]
We then deleted the rpsL-neo cassette from the targeted construct by BbvCI digestion and the remaining vector was re-ligated to generate the mir-279-1x or mir-996-1x construct. [score:3]
Unanticipated effects of mir-279 deletions on mir-996 expressionWhile the initial genetic data were reasonably explained by phenotypic dominance of miR-279, certain other observations remained difficult to account for. [score:3]
Unanticipated effects of mir-279 deletions on mir-996 expression. [score:3]
mir-996-2x expressed only comparable amount of miR-996 as mir-279/996-wt and mir-996-1x transgenes. [score:3]
Intensities of miR-279 and miR-996 expression were quantified by normalization to homozygous wild type and marked below each lane. [score:3]
Our small RNA analyses showed that miR-279 and miR-996 belong to the same expression cluster across diverse Drosophila tissue and cell line small RNA libraries [31], indicating their coordinate deployment. [score:3]
These tests also confirm that tim-Gal4> UAS-mir-996 flies effectively misexpressed miR-996, even though they lacked circadian defects. [score:3]
The mir-279 or mir-996 hairpins were targeted with an rpsL-neo cassette (Gene Bridges), which was flanked by the ~50bp left and right homology arms for the miRNA and carried two BbvCI restriction sites between the rpsL-neo cassette and the homology arms. [score:3]
These defects are comparably rescued by mir-279-2x or mir-996-2x transgenes as they are by wildtype mir-279/996 genomic transgene, to target levels that are slightly higher than in Canton S heads but similar to [ex15C]/+ heads. [score:3]
Both mir-279 "single" alleles and the mir-279/996 double deletion failed to express mature miR-279, as expected, but all of these mutants also proved deficient for miR-996. [score:3]
In fact, under these non-clonal conditions, this genuine double deletion mutant exhibited slightly stronger phenotypes than either of the shorter deletions that physically remove only mir-279 but compromise mir-996 expression (Fig 4G). [score:3]
While manipulation of these various targets can substantially rescue setting-specific phenotypes caused by loss of miR-279 and miR-996, none of them rescue the extremely abbreviated lifespan of the double mutant. [score:3]
Surprisingly, we find that the phenotypes attributed to mir-279 deletions depend on the unanticipated loss of expression of the downstream locus mir-996, whose genomic locus is retained in extant mir-279 mutants. [score:3]
However, our studies unexpectedly reveal that all mir-279 single deletion mutants affect the expression of miR-996. [score:3]
In the mir-279/996[ex15C] homozygous background (which is normally mostly lethal by ~4 days), expression of only a single 1x-mir-279 (I) or single 1x-mir-996 (J) transgene can restore normal rhythmic behavior in constant darkness. [score:3]
Circadian activities were also recovered by each member of a mutant transgene panel (as detailed in the inset box) bearing reciprocal substitutions of mir-279 or mir-996 into the other hairpin locus (mir-279-2x, D and mir-996-2x, E), as well as by knockout transgenes for either miRNA (mir-279-1x, F and mir-996-1x, G). [score:2]
Although the stringent evolutionary conservation of these miRNAs is de facto evidence that they are not truly "redundant", we demonstrate using precise genetic engineering that single genomic copies of either mir-279 or mir-996 can fully compensate for the deletion of all four miRNA alleles in diverse developmental and physiological settings. [score:2]
In this study, we generated single and double mutants of mir-279 and mir-996, and cursory examination suggested that miR-996 was dispensable for overt development and behavior, while miR-279 was essential. [score:2]
1005245.g006 Fig 6(A) Luciferase sensor assays in S2 cells indicated that 3' UTRs of multiple miR-279 targets are all additionally responsive to miR-996. [score:2]
Our studies of miR-279 and miR-996 provide a new testbed for this, since this locus is responsible for several of the most overt developmental and behavioral phenotypes ascribed to animal miRNAs. [score:2]
The evidence gathered indicates that miR-279 and miR-996 play surprisingly similar roles in diverse developmental and behavioral settings. [score:2]
In contrast, mir-279 single hairpin deletions, which we now recognize as deficient for mature miR-996, exhibit ectopic CO [2]-sensing neurons in the palp, and these project to medial glomeruli. [score:1]
mir-996[ex310] is a deletion of the mir-996 region that does not affect mir-279 and mir-279/996[ex15C] deletes both miRNAs. [score:1]
Strikingly, all transgene isoforms, including single mir-279 and mir-996 versions, fully restored the normal circadian clock in the mutant flies (Fig 5I and 5J and Table 1). [score:1]
This indicates that there is no essential requirement for the unique miR-279 sequence, and that one allele of either mir-279 or mir-996 supports normal viability of Drosophila. [score:1]
Both miR-279 and miR-996 contribute to circadian rhythm. [score:1]
Generation of genetically defined miR-279 and miR-996 single and double mutants. [score:1]
On the basis of such transcriptome data, the provenance of CR31044 was expanded in the most recent FlyBase release (5.47), such that it now includes both mir-279 and mir-996 (Fig 1A). [score:1]
In mutant heads bearing either wildtype mir-279/996 genomic transgene, or mir-279-only or mir-996-only transgenes, we observed comparable restoration of nerfin-1 and escargot transcript levels by the various miRNAs (Fig 4H and 4I). [score:1]
Comparison of gain-of-function activities of miR-279 and miR-996. [score:1]
6 mir-279[ex117/ex117] 30.2% (16/53) 23.59±0.07 8.5±2.0 mir-279/996-wt/+; mir-279/996[ex117/ex117] 100% (32/32) 23.64±0.05 115.7±6.4 mir-279-2x/+; mir-279/996[ex117/ex117] 100% (32/32) 23.63±0.05 75.5±5.9 mir-996-2x/+; mir-279/996[ex117/ex117] 100% (32/32) 23.55±0.04 71.8±5.0 mir-996-1x/+; mir-279/996[ex117/ex117] 96.8% (30/31) 23.80±0.07 75.3±5.3 mir-279-1x; mir-279/996[ex117/ex117] 100% (32/32) 23.52±0.05 96.6±5.2 mir-279/996-wt/+; mir-279/996[ex36/ex15C] 96.9% (31/32) 23.39±0.05 89.0±6.8 mir-279-2x/+; mir-279/996[ex36/ex15C] 96. [score:1]
Such mir-279-2x and mir-996-2x constructs carried a NotI site at the 5' side and an AscI site at the 3' side of the ectopic hairpin. [score:1]
The wildtype genomic fragment was modified to replace the mir-279 and mir-996 hairpins with either a deletion or the non-cognate miRNA. [score:1]
Quantitative data for these genotypes is shown in Table 2. This was not due to inability to produce miR-996, since the degree of accumulation of ectopic miR-996 induced by tim-Gal4 was greater than for miR-279 (Fig 6F). [score:1]
In mir-279 alleles [ex117] and [ex36] that retain the mir-996 genomic DNA, the levels of mature miR-996 are strongly diminished ([ex117]) or nearly undetectable ([ex36]). [score:1]
The wildtype 16.6 kb transgene restored accumulation of mature miR-279 and miR-996 (Fig 3B) and fully rescued viability of mir-279/996[ex15C] double deletion homozygotes (Fig 3C). [score:1]
Both mir-996 single deletions were homozygous viable and lacked obvious morphological or behavioral defects. [score:1]
The mir-279 hairpin was PCR cloned and inserted to the 5' end of the mir-996 downstream fragment, then the resultant 3.1kb piece was digested out and ligated with the 13.5kb mir-996 upstream sequence to generate the mir-279-2x construct. [score:1]
To generate the mir-279-2x construct, genomic fragments 13.5kb upstream and 3.0kb downstream of the mir-996 hairpin were retrieved from the CH322-35G11 BAC and cloned between the AscI and NotI sites of the attB-P[acman]-AmpR vector. [score:1]
However, ectopic miR-996 only weakly affected circadian rhythm, with 13% arrhythmic flies observed with only one of the two insertions (Fig 6D). [score:1]
For reasons that are not apparent, the amount of mature miR-996 from the transgenic copies, especially the reprogrammed allele, was not as robust as the endogenous chromosomal locus (Fig 3B). [score:1]
Under MARCM clonal conditions, mir-996 single hairpin deletions exhibit normal specification of CO [2]-sensing neurons within the antenna, and these project to ventral glomeruli in the central brain (Fig 1D and 1E). [score:1]
The mir-996 single deletion and mir-279/996 double deletion alleles were generated by imprecise excision of P{EPgy2}CR31044[EY03350], which is inserted 370bp downstream of the mir-996 hairpin. [score:1]
We use precise genetic engineering to show that a single endogenous copy of either mir-279 or mir-996 can fully rescue viability, olfactory neuron, and circadian rhythm defects of double deletion animals. [score:1]
When we initially annotated mir-996, its hairpin was embedded in the annotated gene CG31044 (FlyBase Release 5.12), which was predicted to encode a short, non-conserved, protein. [score:1]
The [ex117] allele, which is null for miR-279 and strongly hypomorphic of miR-996, exhibits normal circadian behavior as a heterozygote (A) but not as a homozygote (B). [score:1]
Generation of single and double deletion alleles of the mir-279 and mir-996 loci. [score:1]
n = ~32 for each genotype; the number of flies assayed for each genotype are indicated in Table 1. The evidence gathered indicates that miR-279 and miR-996 play surprisingly similar roles in diverse developmental and behavioral settings. [score:1]
Since the available allelic series did not permit assessment of phenotypes caused by specific loss of miR-279, we sought an alternative strategy to analyze "clean" mir-279 and mir-996 mutant backgrounds. [score:1]
Similar procedures were followed to generate the mir-996-2x construct. [score:1]
Other previously-described stocks utilized in this study include UAS-luc-mir-279 and UAS-DsRed-mir-996 [61], tim-Gal4 and tim-UAS-Gal4 [62], and the MARCM tester stock eyflp; Gr21-Gal4, UAS-sytGFP; FRT82, tubGal80 [18, 63]. [score:1]
Our current studies affirm and extend the broad impact of the mir-279/ mir-996 locus, which generates phenotypically critical miRNAs of profound impact. [score:1]
The activity and circadian defects in mir-279[ex117/ex117] animals were rescued by single copies of the wild-type 16.6kb mir-279/996 transgene (D) or the 2x-mir-279-only (E) or 2x-mir-996-only (F) transgenes. [score:1]
We next tested the potential involvement of miR-996 in maintenance of circadian behavior. [score:1]
miR-279 and miR-996 co-accumulate at various embryonic and post-embryonic settings. [score:1]
We also recovered a longer deletion ([ex15C]) that removes both mir-279 and mir-996 loci, thus establishing an apparent allelic series of single and double mutants of these miRNAs (Fig 1A). [score:1]
Generation of new mir-279/996 deletion allelesThe mir-996 single deletion and mir-279/996 double deletion alleles were generated by imprecise excision of P{EPgy2}CR31044[EY03350], which is inserted 370bp downstream of the mir-996 hairpin. [score:1]
Shown are Northern blots of miR-279 and miR-996 in various mir-279 and mir-996 homozygous or trans-heterozygous allele combinations. [score:1]
As we showed in the head, endogenous miR-279 and miR-996 exhibit comparable activity to restrict the accumulation of nerfin-1 and escargot transcripts (Fig 4H). [score:1]
Using this genomic fragment, we then generated a series of mutant transgenes in which we specifically deleted 100bp covering either the mir-279 or mir-996 hairpins (1x-mir-279 and 1x-mir-996, which essentially serve as mir-996- KO and mir-279- KO transgenes, respectively) or replaced either miRNA with the non-cognate hairpin (2x-mir-279 and 2x-mir-996) (Fig 3A). [score:1]
In summary, these gain-of-function experiments reveal intrinsic differences between miR-279 and miR-996, which otherwise exhibit surprising genetic redundancy under carefully controlled endogenous conditions. [score:1]
Therefore, the capacities of miR-279 and miR-996 in S2 cells are similar. [score:1]
Generation of single and double deletion alleles of the mir-279 and mir-996 lociThe mir-996 hairpin is located ~1.5 kb downstream of the mir-279 hairpin (Fig 1A). [score:1]
We used Northern blotting to verify that more mature miR-996 was generated in the latter condition (Fig 6F). [score:1]
The mir-996[ex310] deletion contains a 568 deletion with 9bp of P-element sequence left, while the mir-996[ex187] deletion contains a 584 bp deletion with 154bp of P-element sequence left. [score:1]
Northern analysis of small RNAs in different mir-279 and mir-996 alleles confirmed this hypothesis. [score:1]
Moreover, single insertions of either "2x" transgene, in which mir-279 was substituted for mir-996, and vice versa, also provided complete rescue of the ectopic CO [2]-sensing neurons (Fig 4C and 4D). [score:1]
9% (31/32) 23.55±0.04 68.7±5.7 mir-996-2x/+; mir-279/996[ex36/ex15C] 100% (32/32) 23.44±0.04 96.0±4.8 mir-996-1x/+; mir-279/996[ex36/ex15C] 100% (32/32) 23.58±0.05 104.5±6.2 mir-279-1x/+; mir-279/996[ex36/ex15C] 100% (32/32) 23.41±0.04 78.4±6.7 mir-279/996-wt/+; mir-279/996[ex15C/ex15C] 100% (32/32) 23.36±0.04 80.1±6.3 mir-279-2x/+; mir-279/996[ex15C/ex15C] 93.8% (30/32) 23.55±0.04 66.8±4.9 mir-996-2x/+; mir-279/996[ex15C/ex15C] 100% (32/32) 23.44±0.04 78.6±5.1 mir-996-1x/+; mir-279/996[ex15C/ex15C] 93.8% (30/32) 23.60±0. [score:1]
Such phenotypic differences suggested that miR-279 has stronger capacity to influence circadian cell activity, even though endogenous mir-996 is completely able to compensate for the absence of mir-279. [score:1]
Our previous efforts yielded two alleles in this region, [ex117] and [ex36], that delete mir-279 but spare the mir-996 locus (Fig 1A). [score:1]
Nevertheless, mature miR-279 is more similar to miR-286 than it is to miR-996 (Fig 1A). [score:1]
At the time, we hypothesized that CG31044 might represent the primary transcript for mir-996, distinct from mir-279 [26]. [score:1]
Nevertheless, we were interested to assess whether miR-996 contributes to any biological settings known to depend on miR-279. [score:1]
We proceeded to subject these engineered miRNA backgrounds to detailed phenotypic study, to ascertain the extent to which defects previously attributed to miR-279 might actually depend on the joint function of miR-279 and miR-996. [score:1]
The quantification of percentage of rhythmic animals, their circadian period, and their power of rhythmicity are shown in Table 1. Restoration of either miR-279 or miR-996 on the [ex117] background, in either two doses or in a single dose, fully recovered behavioral rhythmicity (Fig 5D– 5F and Table 1). [score:1]
The mir-996 locus was later identified in the vicinity of mir-279 and shown to encode a similar seed, but they otherwise have distinct mature sequences and were originally suggested to derive from separate genes [26, 27]. [score:1]
Both miR-279 and miR-996 contribute to maintenance of circadian rhythm. [score:1]
Both miR-279 and miR-996 mediate specification of CO [2]-sensing neuronsUnder MARCM clonal conditions, mir-996 single hairpin deletions exhibit normal specification of CO [2]-sensing neurons within the antenna, and these project to ventral glomeruli in the central brain (Fig 1D and 1E). [score:1]
Both miR-279 and miR-996 mediate specification of CO [2]-sensing neurons. [score:1]
Following the segregation of TMS, Δ2–3, we screened ~500 candidate excision chromosomes for deletions in the mir-279/ mir-996 region using the the following PCR amplicons: mir279F excision CAAGAAACCACCCCGAGAAGAAGAAG mir279R excision AGCAGGTGTTACAGTTACACTCAAACG. [score:1]
Phylogenomic tracing indicates that mir-279 is ancestral and that mir-996 has adopted a derived sequence [28]. [score:1]
The mir-996 hairpin is located ~1.5 kb downstream of the mir-279 hairpin (Fig 1A). [score:1]
Notably, miR-996 has not been implicated in any biological processes, since available mir-279 deletion alleles do not affect the mir-996 locus, and mir-279 mutant phenotypes can be rescued by a genomic transgene that contains only mir-279 and lacks mir-996 sequence [18]. [score:1]
Therefore, we conclude that the available mir-279 "single" mutants are unexpectedly also strong or nearly null alleles of mir-996. [score:1]
Green and blue triangles represent mir-279 and mir-996 hairpins, respectively. [score:1]
miR-996 restores proper CO [2]-sensing neurons to mir-279/996 double mutants. [score:1]
The mature sequences of three members of the miR-279 seed family are shown; note that miR-286 is encoded elsewhere in the genome but is more related to miR-279 than is miR-996. [score:1]
These experiments utilized male body and male head RNA samples, and show similar results as to female samples shown in main Fig 2. Levels of mature miR-996 are strongly diminished in the mir-279 alleles [ex117] and [ex36] that retain the mir-996 genomic DNA. [score:1]
Indeed, the deep conservation of divergent non-seed regions of miR-279 and miR-996, and the observation that mir-279 is ancestral and that mir-996 emerged more recently during arthropod evolution [28], suggest that miR-996 may have neofunctionalized from miR-279 to acquire some distinct activity. [score:1]
We screened excisions of a P element inserted downstream of mir-996, and recovered two small deletions ([ex187] and [ex310]) that selectively remove this locus. [score:1]
Signal quantifications were performed in the Image Gauge software and levels of miR-279 and miR-996 in different genotypes were normalized to 2S rRNA. [score:1]
mir-996[ex310] is a deletion of the mir-996 region that does not affect mir-279, and mir-279/996[ex15C] is a deletion of both miRNAs. [score:1]
The GR21+ projections of mir-996 deletion MARCM clones were identical to wildtype (Fig 1E). [score:1]
As the phenotypes of these mutants were rescued by a ~3kb genomic transgene bearing only mir-279, and lacked mir-996 sequence [18], mir-279 appeared to be causal. [score:1]
RNA samples were separated on 12% polyacrylamide denaturing gels (National Diagnostics), transferred to the GeneScreen Plus (Perkin Elmer) membrane, crosslinked with UV light and hybridized with γ- [32]P-labeled LNA (Exiqon) antisense probes for miR-279 and miR-996 at 45°C overnight. [score:1]
Both miR-279 and miR-996 mediate normal adult rhythmic behavior. [score:1]
This suggests that miR-279 and miR-996 are selected for distinct sequences, presumably related to some separable functions. [score:1]
[1 to 20 of 116 sentences]
2
[+] score: 5
For example, miR-996-3p and miR-986-5p are expressed at similar levels, yet the former represses its target by over 60% while the latter induces less than 25% repression. [score:5]
[1 to 20 of 1 sentences]
3
[+] score: 1
gambiae miR-996 and miR-989, respectively [42] and homologs of these two miRNAs are found in the expanded list of Drosophila miRNAs [40, 41]. [score:1]
[1 to 20 of 1 sentences]
4
[+] score: 1
Other miRNAs from this paper: dme-mir-1, hsa-mir-1-2, hsa-mir-1-1
Within the multiple copy miRNAs, two miRNAs, miR-1-5p and miR-996-5p, had the same hairpin precursors, but were located in two distinct locations of the genome, suggesting a duplication event. [score:1]
[1 to 20 of 1 sentences]