sort by

19 publications mentioning hsa-mir-1908

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1908. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 281
And all these three inhibitors suppressed the proliferation of miR-1908 overexpressing U87 cells (Fig.   8d). [score:7]
In survival analysis of glioblastoma patients, we found that patients with higher miR-1908 expression levels had poorer disease free survival (DFS) than those with lower miR-1908 expression levels (Fig.   1e) which suggested that miR-1908 significantly affected prognosis of glioblastoma patients. [score:7]
As shown in Fig.   6b, overexpressing miR-1908 significantly suppressed PTEN levels in glioblastoma cells (Fig.   6b) meanwhile silencing miR-1908 increased PTEN expression (Fig.   6c). [score:7]
a Correlation of miR-1908 overexpression with PTEN downregulation in indicated glioblastoma tissues. [score:6]
Of note, the close correlation between high miR-1908 expression and low expression of PTEN, as well as with the malignant properties of glioblastoma tumors, were also confirmed in planted tumors and in clinical glioblastoma samples, suggesting a possible role of miR-1908 in the development and progression of glioblastoma. [score:6]
Altogether, these data demonstrate that miR-1908 is upregulated in glioblastoma and that high miR-1908 expression predicts poor patient survival. [score:6]
In the current study, we identify that miR-1908 is highly expressed in multiple subtypes of glioblastoma tissues and causes simultaneous downregulation of PTEN, leading to activation of both AKT/FOXO3a and AKT/mTOR pathways, consequently leading to accelerated proliferation and enhanced angiogenesis in glioblastoma. [score:6]
MiR-1908 expression is frequently up-regulated in glioblastoma. [score:5]
Moreover PTEN overexpression significantly inhibited wound healing (Additional file 4: Figure S4C) and invasion ability (Fig.   9g) of U87-miR-1908 cells, meanwhile silencing PTEN promoted wound healing (Additional file 4: Figure S4D) and invasion ability (Fig.   9h) of SW1088-anti-miR1908 cells. [score:5]
As shown in Fig.   9c and d, PTEN overexpression significantly inhibited phosphorylation of Akt, P13K, S6K, and 4E-BP1 in U87-miR-1908 cells (Fig.   9c), meanwhile silencing PTEN increased phosphorylation of P13K, S6K, and 4E-BP1 in SW1088-anti-miR1908 cell (Fig.   9d). [score:5]
At the molecular level, both the AKT/FOXO3a and AKT/mTOR pathways contribute to miR-1908–mediated malignant phenotype of glioblastoma cells, likely mediated by suppressing PTEN expression. [score:5]
As shown in results, decreased P21 and increased Cyclin D1 proteins (Fig.   7c) and mRNA (Fig.   7d) could be caused by miR-1908 overexpression, whereas opposite effects on the regulation of P21 and Cyclin D1 were found at both the mRNA and protein levels when miR-1908 was knocked down (Fig.   7e and f). [score:5]
d MTT shows the effect of LY294002, AKT inhibitor III or rapamycin on miR-1908 overexpressing cells. [score:5]
In this study, overexpression of miR-1908 significantly decreased PTEN in glioblastoma cells to inhibit phosphorylated P13K and AKT, resulting in increase in proliferation, migration and invasion [37– 39]. [score:5]
The 3’-UTR (untranslated region) sequence of PTEN was predicted to interact with miR-1908 or a mutated sequence within the predicted target sites was synthesized and inserted into the XbaI and FseI sites of the pGL3 control luciferase reporter vector (Promega, Madison, WI). [score:5]
Error bars, SD Fig. 8AKT/FOXO3a or AKT/mTOR signaling pathway inhibitors restrained the proliferation of miR-1908 overexpressing cells. [score:5]
e Wild-type miR-1908 target sequences of PTEN 3’-UTR and mutant-type miR-1908 target sequences of PTEN 3’-UTR. [score:5]
In linear correlation analysis, PTEN expression was inversely proportional to miR-1908 expression (Fig.   6a). [score:5]
Moreover, PTEN was significantly suppressed in xenograft tumor sections with overexpression of miR-1908 (Fig.   6d). [score:5]
Overexpression of miR-1908 promotes the malignant phenotype of glioblastoma cells by promoting cell proliferation, migration and invasion through silencing PTEN expression. [score:5]
Of note, ectopic miR- 1908 expression in U87 cell remarkably increased the level of phosphorylated AKT, resulting in enhanced phosphorylation of P13K, S6K, and 4E-BP1 (Fig.   7a), whereas silencing miR-1908 in SW1088 cells robustly suppressed phosphorylation of AKT, P13K, S6K, and 4E-BP1 (Fig.   7b), indicating that miR-1908 indeed activated the AKT/FOXO3a and AKT/mTOR pathways. [score:5]
b PTEN expression in miR-1908 overexpressing cells in western blot. [score:5]
Error bars, SD We next examined the role of miR-1908–mediated inhibition of PTEN in the development and maintenance of the malignant phenotype of glioblastoma cells. [score:4]
Furthermore, the expression levels of miRNA-1908 were significantly increased in the patients with a high risk of recurrence compared to that observed in the low-risk patients, and this higher expression correlated with a poor survival. [score:4]
Fig. 6PTEN is a direct target of miR-1908. [score:4]
We found that miR-1908 is a risk factor in glioblastoma where it acts as an oncogene by regulating PTEN expression. [score:4]
d ICH for PTEN in miR-1908 overexpressing tumors and control. [score:3]
The expression levels of miR-1908 in the subsequent cell lines were examined by qRT-PCR (Additional file 1: Figure S1 A-E). [score:3]
In contrast, inhibition of endogenous miR-1908 remarkably abrogates the proliferation and invasion of glioblastoma cells. [score:3]
Error bars, SD We have confirmed that miR-1908 was expressed higher in GSCs (Fig.   1b). [score:3]
As shown in Fig.   5a, overexpression of miR-1908 promoted the formation of spheres of glioblastoma cells (Fig.   5a) meanwhile silencing miR-1908 decreased the number of spheres (Fig.   5b). [score:3]
a Quantification of miR-1908 in glioblastoma cell lines (A127, SW1783, U87, U373, LN-229, SW1088, HS683, HFU251, SNB19 and T98G)) and stem cell lines (GSCs; 802 and 1228) showing higher expression than in normal human astrocytes. [score:3]
d Quantification of miR-1908 in normal brain, stageI-IIglioblastoma and stage III-IV glioblastoma, (e) Correlation analysis of expression data and patient survival data from Affiliated Hospital of Guilin Medical University showing that miR-1908 levels are a risk indicator for survival. [score:3]
g ICH for phosphor-P13K, phospho-AKT, phospho-S6K1 and phospho-4E-BP1 in miR-1908 overexpressing tumors. [score:3]
22 days later, U87 cells stably overexpressing miR-1908 had bigger tumors than controls. [score:3]
To better stand the role of miR-1908 in glioblastoma, we used retroviral vectors to establish glioblastoma cell lines stably overexpressing or silencing miR-1908. [score:3]
Fig. 5Ectopic miR-1908 expression in glioblastoma cells accelerates sphere formation. [score:3]
b Average expression of miR-1908 in glioblastoma cells, GSGs and normal human astrocytes. [score:3]
Error bars, SDWe have confirmed that miR-1908 was expressed higher in GSCs (Fig.   1b). [score:3]
Aberrant expression of miR-1908 in human glioblastoma cells was correlated with poor prognosis. [score:3]
The overexpression of miRNA-1908 significantly promoted anchorage-independent growth in vitro and significantly increased the tumor forming potential in vivo. [score:3]
miR-1908 inhibits PTEN activation in glioblastoma cells. [score:3]
Moreover, increased phosphorylation of P13K, S6K, and 4E-BP1 were found in tumors overexpressing miR-1908. [score:3]
Error bars, SD On the basis of the indispensable role of PTEN in the biologic functions of miR-1908, we overexpressed PTEN in U87-miR-1908 cell (Fig.   9a) and silenced PTEN in SW1088-anti-miR1908 cell (Fig.   9b). [score:3]
Confirmation of miR-1908 expression in indicated cells. [score:3]
Fig. 4Overexpressing miR-1908 promotes migration and invasion of glioblastoma cells. [score:3]
PTEN overexpression could restrain the increase in proliferation, migration and invasion in miR-1908-overexpresison glioblastoma cells. [score:3]
c PTEN expression in miR-1908 silencing cells in western blot. [score:3]
In glioblastoma cells, overexpression of miR-1908 robustly promotes cell proliferation and invasion in vitro. [score:3]
Moreover,miR-1908 was expressed higher in both glioblastoma (GBMs) and glioblastoma stem cells (GSCs) (Fig.   1b) than that in astrocytes. [score:3]
In contrast, silencing miR-1908 in glioblastomas dramatically suppressed the proliferation (Fig.   2b) and viability (Fig.   2d) of indicated cells. [score:3]
a U87 cells stably overexpressing miR-1908 or scrambled miRNA was subcutaneously injected into nude mice. [score:3]
Error bars, SD To verify whether PTEN is a potential target of miR-1908, we analyzed the relation between miR-1908 and PTEN. [score:3]
PTEN is a potential target of miR-1908, and PTEN levels are inversely correlated with miR-1908 levels in glioblastoma tissues. [score:3]
As show in Fig.   3a and b, overexpression of miR-1908 significantly accelerated tumor growth and induced an increase in tumor weight (Fig.   3c) and volume (Fig.   3d). [score:3]
As shown in Fig.   3e, higher Ki-67 levels were found in sections with overexpressing miR-1908 by ICH. [score:3]
Fig. 2Ectopic miR-1908 expression in glioblastoma cells accelerates proliferation of glioblastoma cells. [score:3]
MTT assay revealed that overexpression of miR-1908 promoted proliferation of glioblastoma cells (Fig.   2a). [score:2]
These results revealed that miR-1908 directly mediates the degradation of PTEN mRNA. [score:2]
In scratch assay, overexpression of miR-1908 significantly accelerated wound healing of glioblastoma cells (Fig.   4a and Additional file 2: Figure S2A) while silencing miR-1908 decreased the rate of migration (Fig.   4b). [score:2]
These findings indicate that miR-1908 plays an important role as a tumor promotor in glioblastoma development. [score:2]
In order to identify the target molecule of miRNA-1908, a luciferase reporter assay was performed, and the corresponding downstream signaling pathway was examined using immunohistochemistry of human glioblastoma tissues. [score:2]
To further confirm the regulation of PTEN by miR-1908, the luciferase reporter containing the complimentary seed sequence of miR-1908 at the 3’-UTR region of PTEN mRNA was constructed (Fig.   6e), luciferase activity was detected at 48 h after the co-transfection of FLuci vector (3-UTR-PTEN wt FLuci vector or 3 -UTR-PTEN mut FLuci vector), miR-1908 mimic or NC mimic, and RLuci vector in glioblastoma cells. [score:2]
MiRNA-1908 significantly suppressed the luciferase activity of mRNA combined with the PTEN 3’-UTR. [score:2]
MiR-1908 is a novel microRNA that is highly expressed in human adipocytes [15]. [score:2]
In colony formation assay, overexpression of miR-1908 significantly increased the viability of indicated cells which formed more and bigger clones (Fig.   2c). [score:2]
But the potential role of miR-1908 in the carcinogenesis and tumor development of glioblastoma is unknown. [score:2]
The effects of miR-1908 or PTEN expression on cell migration and invasion were assessed using the wound-healing and Transwell assays as previously described [45]. [score:2]
To further confirm that miR-1908 is related with the development of glioblastoma, we measured the miR-1908 expressions in 47 glioblastoma samples (Table  1). [score:2]
miRNA-1908 functions as an oncogene in glioblastoma by repressing the PTEN pathway. [score:1]
These results suggested that miR-1908 promoted the proliferative and angiogenic phenotype of glioblastoma cells by simultaneously activating both AKT/FOXO3a and AKT/mTOR pathways. [score:1]
Fig. 9Restoration of PTEN inverses miR-1908–induced proliferation and invasion. [score:1]
The effects of miR-1908 on proliferation of glioblastoma. [score:1]
Following deparaffinization, sections were immunohistochemically analyzed using antibodies for miR-1908, Ki67, p-Akt, p-P13K, p-S6K1, and p-4E-BP1, respectively, and subsequently were pathologically confirmed for the tumor phenotype and specific immunostaining. [score:1]
Repression of PTEN in glioblastoma cells was essential for miR-1908 -induced proliferation. [score:1]
Error bars, SD In order to confirm whether the growth-promoting effect of miR-1908 observed in cultured cells is relevant to glioblastoma growth in vivo, U87-miR-1908 cell and control cell were subcutaneously inoculated into BALB/C athymic mice, respectively. [score:1]
In this study, we investigated the expression, function, and mechanism of miR-1908 in glioblastoma. [score:1]
As shown in Fig.   1a, miR-1908 was significantly higher in glioblastoma cells (Fig.   1a) than in astrocytes. [score:1]
We also investigated the miRNA-1908 expression in 34 patients according to the postoperative risk of recurrence. [score:1]
These results indicated that miR-1908 may be related to the growth and recurrence of glioblastomas. [score:1]
miR-1908 promotes migration and invasion in SNB19 cells. [score:1]
We investigated the growth potentials of miRNA-1908 -overexpressing SW-1783 cells in vitro and in vivo. [score:1]
f and g Relative luciferase activity of PTEN in cells after co-transfection with wild type (Wt) or mutant (Mt) PTEN 3’-UTR reporter genes and miR-1908 mimics, anti-miR-1908 mimics or control. [score:1]
Both AKT/FOXO3a and AKT/mTOR signaling contribute to miR-1908 -mediated malignant phenotype of glioblastoma cells. [score:1]
Of note, miR-1908 was highest in stageIII-IV tumors and higher in stageI-II tumors than in normal brain (Fig.   1d) showing us that miR-1908 may be a prognostic factor of glioblastoma. [score:1]
These data suggested that PTEN wan essential for miR-1908 -induced proliferation, migration and invasion. [score:1]
c Quantification of miR-1908 in human glioblastoma tumors (T) and normal human brain (N). [score:1]
b Representative results of sphere formation of SW1088, U373 cells transfected with anti-miR-1908 mimics or miR control. [score:1]
Restoration of PTEN inverses miR-1908–induced proliferation and invasion in U87 or SW1088 cells. [score:1]
As shown in Fig.   1c, miR-1908 was significantly higher in glioblastoma than in normal brain (Fig.   1c). [score:1]
Error bars, SDIn order to confirm whether the growth-promoting effect of miR-1908 observed in cultured cells is relevant to glioblastoma growth in vivo, U87-miR-1908 cell and control cell were subcutaneously inoculated into BALB/C athymic mice, respectively. [score:1]
In functional tests, PTEN overexpression in U87-miR-1908 cell significantly decreased the proliferation in MTT assay (Fig.   9e) and colony formation assay (Additional file 4: Figure S4A) meanwhile silencing PTEN promoted the proliferation of SW1088-anti-miR1908 cells (Fig.   9f, Additional file 4: Figure S4B). [score:1]
Error bars, SD To further understand the function of miR-1908 in glioblastoma, we next assessed the effect of miR-1908 on glioblastoma cell migration and invasion. [score:1]
c Representative results of invasive ability of U87 and SW1783 cells transfected with miR-1908 mimics or miR control. [score:1]
To further confirm the role of miR-1908 in GSCs, sphere formation was used to reveal the function of miR-1908 in GSCs. [score:1]
d Representative results of invasive ability of U373 and SW1088 cells transfected with anti-miR-1908 mimics or miR control. [score:1]
a Representative results of sphere formation of SNB19, U87 and SW1783 cells transfected with miR-1908 mimics or miR control. [score:1]
[1 to 20 of 97 sentences]
2
[+] score: 72
B. Histograms of percent expression (mean and standard deviation) of target positivity (A/B*100, where A is the number of Alexa Fluor positive cells and B is the number of total (DAPI) cells per given field) obtained from Columbus analysis showing alterations in the expression of kRAS, FOXP2, FOSL2 and MEGF10 after hsa-miR-1206 inhibition; KI-67 after hsa-miR-600 inhibition; MYCN and DCLK1 (after hsa-miR-548a-5P inhibition; IFNγ, CD8, NF2, GRB10, kRAS after hsa-miR-513a-5P inhibition and, CCND1, NKX3.2, PhPT1, CD8, NF2 after hsa-miR-1908 inhibition. [score:17]
We examined the cellular localization and expression levels of kRAS, FOXP2, FOSL2, MEGF10 (after hsa-miR-1206 inhibition), CCND1, NKX3.2, PhPT1, CD8, NF2 (after hsa-miR-1908 inhibition), IFNγ, CD8, NF2, GRB10, kRAS (after hsa-miR-513a-5P inhibition), KI-67 (after hsa-miR-600 inhibition), MYCN and DCLK1, (after hsa-miR-548a-5P inhibition) in SH-SY5Y cells using Operetta high content quantitative confocal imaging. [score:13]
To verify the function of identified circulating miRNAs on the putative target proteins, we inhibited five human specific miRNAs, 2 upregulated (hsa-miR-1908; hsa-miR-513a-5P) and 3 downregulated (hsa-miR-1206; hsa-miR-548a-5P; hsa-miR-600) and examined for the miRNA -dependent modulations in protein targets. [score:13]
For this, we selectively silenced five human (non-homologous) specific miRNAs, 2 upregulated (hsa-miR-1908; hsa-miR-513a-5P) and 3 downregulated (hsa-miR-1206; hsa-miR-548a-5P; hsa-miR-600) and examined for the alterations in 14 different critical protein targets including kRAS, CCND1, MYCN, IFNγ, CD8, NF2, KI-67, FOXP2, MYCN, FOSL2, GRB10, NKX3.2, DCLK1, PhPT1 and MEGF10 (Figure 7A). [score:9]
Like-wise selective inhibition of miR-1908 demonstrated a significant increase in the expression of its targets CCND1, CD8, NF2 and PhPT1 in this setting. [score:7]
Transient transfection of parental SH-SY5Y cells with hsa-miR-1908-, hsa-miR-513a-5P-, hsa-miR-1206-hsa-miR-548a-5P-, hsa-miR-600 -inhibitors (MISSION [®] Synthetic miRNA Inhibitors, Sigma-Aldrich) were carried out by using Neon electroporation transfection system (Life Technologies). [score:5]
Of the 34 upregulated miRNAs examined, we identified 11 human-specific non-homologous miRNAs, including miR-1261, miR-1268, miR-1280, miR-1304, miR-1308, miR-1908, miR-198, miR-513a-5p, miR-513b, miR-548h, and miR-580 (Supplementary Table 1A). [score:4]
Evidently, except for two candidates in each up (miR-1308, miR-1908) and down (miR-639, miR-628-3p) regulated clusters, none have been reported as serum-circulating diagnostic/prognostic markers in any tumor systems thus far. [score:2]
Further, studies have recognized the regulation of serum miR-639 and miR-628-3p in bladder cancer, melanoma, and pancreatic cancer [36- 38] and, miR-1908 in nasopharyngeal carcinoma [39]. [score:2]
[1 to 20 of 9 sentences]
3
[+] score: 17
lncRNA Alternative splicing [37] Neuro development [39] lincHPAT Embryo development [40] FMR4 Antiapoptotic [43] Psoriasis disease [44] 

 miRNA C19MC Preeclampsia; cancers [68] X-linked miRNA cluster Possible roles in epididymal physiology; sperm maturity; male fertility; tube development [73], [74] miR-1202 Major depressive disorder [79] miR-1908-5p Bipolar disorder [80] miR-603 Pre-miR-603 with rs11014002 SNP having protective effect toward Alzheimer’s disease [83], [84] 

 Despite the great advances, there are some limitations that need to be overcome for future studies. [score:8]
In silico brain expression profiles also show inverse correlation between the expression of miR-1908-5p and its target genes [80]. [score:7]
For instance, a recent study has shown the association between a primate-specific miRNA, miR-1908-5p, and the pathogenesis of BD. [score:1]
Previously uncharacterized, miR-1908-5p is shown to target genes that function in neuronal glutamatergic synapses, which includes DLGAP4, GRIN1, STX1A, CLSTN1, and GRM4. [score:1]
[1 to 20 of 4 sentences]
4
[+] score: 15
We should underline that some of these miRNAs (Table 3) are expressed in the 90% of the ES patients, such as the up-regulated miR-210 (11p15.5), Let-7a (9q22.32), Let-7e (19q13.41), miR-181b (1q32.1) and the down-regulated miR-1908 (11), miR-659 (22q13.1) and miR-937 (8q24.3). [score:9]
Xia X. Li Y. Wang W. Tang F. Tan J. Sun L. Li Q. Sun L. Tang B. He S. MicroRNA-1908 functions as a glioblastoma oncogene by suppressing PTEN tumor suppressor pathway Mol. [score:4]
Moreover, some authors identified miR-1908, miR-199a-5p and miR-199a-3p as endogenous promoters of metastatic invasion, angiogenesis and colonization in melanoma [41]. [score:1]
Some miRNAs such as miR-937, miR-1303, miR-1908, miR-1915, miR-762 and miR-379 had only been experimentally validated in previous studies [12] by next-generation sequencing experiments (NGS), while other miRNAs were validated by alternative methods (Table S4). [score:1]
[1 to 20 of 4 sentences]
5
[+] score: 12
Of the 31 PD-miRNAs, 7 miRNAs (hsa-mir-202, hsa-mir-196a-2, hsa-mir-423, hsa-mir-943, hsa-mir-520h, hsa-mir-1908 and hsa-mir-647) were identified in prior studies as being differentially expressed in human diseases representing a significant increase above expectation (1.1 out of 31) for disease -associated miRNAs (95% C. I. = 1.08 – 1.11; p = 2.2 × 10 [−16]) (Figure  5B). [score:7]
Finally, multiple studies have linked miRNAs hsa-mir-1908, hsa-mir-647 and hsa-mir-943 expression to various cancers known to have ethnic specific disparities [63- 65]. [score:3]
Overall, we identify 7 PD-miRNAs that are currently implicated as cancer biomarkers or diagnostics: hsa-mir-202, hsa-mir-423, hsa-mir-196a-2, hsa-mir-520h, hsa-mir-647, hsa-mir-943, and hsa-mir-1908. [score:1]
Similarly, the other 6 PD-miRNAs identified (hsa-mir-423, hsa-mir-196a-2, hsa-mir-520h, hsa-mir-1908, hsa-mir-647 and hsa-mir-943) have also been implicated in cancer susceptibility in human populations [56]. [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 12
The mitogen-activated protein kinase (MAPK) signaling pathway was associated with the smallest P-value (1.8×10 [−11]) among the pathways targeted by the five miRNAs over-expressed in NPC exosomes, which included hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908. [score:5]
Five miRNAs, including hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908, were commonly over-expressed in the exosomes from P-serum and TW03 (EBV [+]) or TW03 (EBV [−]) cells (Fig. 5E). [score:3]
E. The identification of five over-expressed miRNAs in P-serum-EXOs/N-serum-EXOs, TW03 (EBV [+])-EXOs/NP69-EXOs, and TW03 (EBV [−])-EXOs/NP69-EXOs: hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908. [score:3]
Our results showed that five exosomal miRNA clusters, including hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908, were abundant in NPC tumor-derived exosomes from patient sera or TW03 cell lines versus the exosomes from healthy donor sera or NP69 cells. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 10
Target name Sequence Tm(°C) Let-7 AAACCGTTACCATTACTGAG 47,4 miR-21 TAGCTTATCAGACTGATGTT 47,9 miR-1260b ATCCCACCACTGCCACC 57,9 miR-1908 CGGCGGGGACGGCGATTGG 66,9 miR-143 TGAGATGAAGCACTGTAGC 51,9 miR-145 GTCCAGTTTTCCCAGGAATCC 55,7 miR-338 TCCAGCATCAGTGATTTTGT 52,1 miR-451 AAACCGTTACCATTACTGAG 49,8 EXOs were purified from xeno-free cell culture supernatants of adipose derived stem cells by ultracentrifugation. [score:3]
It was worth noticing that some of the miRNAs previously shown to be expressed at altered levels in EXOs from cancer patients, as it was the case of miRNA let-7-a-1, miR-21, miR145, miR-451a and miR-1908 appeared at equivalent levels in EXOs from either patient or non-oncogenic participant ADSCs arguing in favor of their safe use in therapeutics. [score:3]
When relative amounts of miRNAs in EXOs from patient and non-oncogenic participant ADSCs were compared we observed similar levels (no significant differences in t-test analysis, p>0.05) regardless of their origin (Figure 6 E) indicating no association between miRNA load and disease state of the participants, even for those miRNAs previously found in EXOs of cancer patients, as is the case of let-7-a-1, miR-21, miR145, miR-451a and miR-1908 [54]. [score:2]
T-test analysis of miRNA levels in ADSCs and their EXOs showed no significant differences (p>0.05) between some miRNAs (including miR-1908, and miR-338-3p) indicating that they are present at similar levels in both compartments: cells and vesicles, while other miRNAs (including let-7-a-1, miR-21 and miR-1260b) showed significant differences (p<0.05), suggesting that they preferentially pack into EXOs (Figure S2). [score:1]
This is the case of miR-338-3p, miR-1260b and miR-1908. [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 9
Recent findings [7] have suggested that miR-26b inhibits adipogenic differentiation and overexpression of miR-1908 inhibited adipogenic differentiation [8]. [score:7]
We identified that miR-148a, miR-26b, miR-132, miR-365 and miR-1908 were highly expressed in mature adipocytes with over 5-fold compared to SVCs/hMSCs-Ad. [score:2]
[1 to 20 of 2 sentences]
9
[+] score: 6
In nasopharyngeal carcinoma, overexpressed miR-20a-5p combined with miR-24–3p, miR-891a, miR-106a-5p and miR-1908 formed the exosomes to downregulated the MARK1 signaling pathway to alter cell proliferation and differentiation [23]. [score:6]
[1 to 20 of 1 sentences]
10
[+] score: 5
Three additional miRNAs (hsa-miR-21, hsa-let-7c and hsa-miR-1908) chosen from the original miRNA screen as upregulated miRNAs in CB ECFC-derived cells were also used for q-RT-PCR validation. [score:4]
Our results confirmed statistically significant differences between the CB and PB cells for all except one of these miRNAs, hsa-miR-1908. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 4
The Ct values for the miRNAs were approximately 28 (miR-21), 29 (miR-20a), 30 (miR-146a, miR-221), 31 (miR-222), 33 (miR-149*, miR-210, miR-328, miR-1908), and 34 (miR-133a). [score:1]
We failed to confirm the changes in miR-1908 following resistance exercise. [score:1]
The other miRNAs (miR-1908, miR-20a, miR-21, miR-133a, miR-210, miR-222, and miR-328) did not change significantly following resistance exercise (Fig. 2). [score:1]
Based on the criteria described in the Method (fold-change >1.5, coefficient of variation <50%, and high Hy3 signal >1.5× the median signal), only four miRNAs (miR-149*, miR-299-5p, miR-1469 and miR-1908) were selected. [score:1]
[1 to 20 of 4 sentences]
12
[+] score: 4
Locus ID Gene RefSeq Expression Phastcons Status 21019 Intron - AC124066.2 1,12,2,1 0.57 miR-1180 38843 Intron ARL10 - 0,0,3,2 0.99 miR-1271 6150 Intron C10orf33 - 4,0,1,4 1 miR-1287 6746 Intron JMJD1C - 1,4,2,1 1 miR-1296 27738 Intron DNMT3A - 3,12,7,4 0.99 miR-1301 8884 intron FADS1 NM_013402 2,0,9,2 0.34 miR-1908 37600 repeat - - 136,933,146,220 0.03 alt. [score:3]
While writing this paper a new version of miRBase was released, now including six of these miRNAs (mir-1180, mir-1271, mir-1287, mir-1296, mir-1301, and mir-1908). [score:1]
[1 to 20 of 2 sentences]
13
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-100, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-139, hsa-mir-10b, hsa-mir-34a, hsa-mir-182, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-221, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-134, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-154, hsa-mir-320a, hsa-mir-155, hsa-mir-128-2, hsa-mir-200a, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-302c, hsa-mir-367, hsa-mir-370, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-379, hsa-mir-328, hsa-mir-151a, hsa-mir-135b, hsa-mir-335, hsa-mir-133b, hsa-mir-449a, hsa-mir-451a, hsa-mir-410, hsa-mir-486-1, hsa-mir-146b, hsa-mir-520f, hsa-mir-518d, hsa-mir-517c, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-584, hsa-mir-602, hsa-mir-629, hsa-mir-638, hsa-mir-449b, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-298, hsa-mir-1246, hsa-mir-718, hsa-mir-2861, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-4728, hsa-mir-4734, hsa-mir-378j, hsa-mir-6165, hsa-mir-486-2
Paggetti et al. (2015) MiR-1908, and MiR-298 The human myeloid leukemia (CML) cell line K562 qRT-PCR analysis, and Western blotting The expression level of miRNAs were different among K562 cells and K562 cell-derived exosomes. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 3
List of the most highly expressed human microRNAs in salivary microvesicles are: hsa-let-7b, hsa-let-7c*, hsa-miR-128, hsa-miR-150*, hsa-miR-17, hsa-miR-1908, hsa-miR-212, hsa-miR-27b*, hsa-miR-29b, hsa-miR-29c, hsa-miR-335, hsa-miR-379*, hsa-miR-433, hsa-miR-454, hsa-miR-483-3p, hsa-miR-584, hsa-miR-621, hsa-miR-652, hsa-miR-760 and hsa-miR-888* [9]. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
As control, the expression of miR-152, which belongs to the same family of miR-148a, as well as miR-1908 and let-7a, was unchanged (Fig. S2B), suggesting that miR-148a did not disrupt other endogenous miRNA pathways. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 2
hsa-miR-1908 Chr11: 61582681–61582701 (−) 11q12.2 IntragenicHosted in FADS1 intron (mitochondrial localization [76]). [score:1]
While 44 miRNAs showed a greater enrichment in the cytosolic Hy3-labeled RNA fraction, 13 miRNAs were significantly and reproducibly enriched in the mitochondrial Hy5-labeled RNA sample (ranging from 1.5- to 56-fold), namely hsa-miR-1973, hsa-miR-1275, hsa-miR-494, hsa-miR-513a-5p, hsa-miR-1246, hsa-miR-328, hsa-miR-1908, hsa-miR-1972, hsa-miR-1974, hsa-miR-1977, hsa-miR-638, hsa-miR-1978 and hsa-miR-1201 (Figure 5A). [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 1
As control we selected other miRNAs showing practically same average values: hsa-miR-1908-5p and hsa-miR-1260b (Table 2). [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
Yang L. Shi C. M. Chen L. Pang L. X. Xu G. F. Gu N. Zhu L. J. Guo X. R. Ni Y. H. Ji C. B. The biological effects of hsa-miR-1908 in human adipocytes Mol. [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
[24] In the same vein, miR-499, miR-708 and miR-1908 were shown to have significant association with bipolar disorder. [score:1]
[1 to 20 of 1 sentences]