sort by

2 publications mentioning dre-mir-2184

Open access articles that are associated with the species Danio rerio and mention the gene name mir-2184. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 34
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
Conversely, miR-204 was downregulated in zebrafish and bichir, miR-133a was downregulated in bichir, and miR-2184, miR-338 and miR-24 were downregulated in axolotl. [score:10]
S24 Table Zebrafish Ensembl gene identifiers for 107 genes upregulated in three mo dels with predicted miRNA binding sites for miR-2184, miR-204, miR-338, miR-133a and miR-24 and members of the network of commonly up- and downregulated genes with functional interactions to 11 blastema -associated genes. [score:7]
We performed similar analyses to capture potential target genes for the 5 commonly downregulated miRNAs (miR-2184, miR-204, miR-338, miR-133a and miR-24). [score:6]
S23 Table Zebrafish Ensembl gene identifiers for 205 genes upregulated in three mo dels with predicted miRNA binding sites for miR-2184, miR-204, miR-338, miR-133a and miR-24 in all three mo dels. [score:4]
Within this subset of differentially regulated zebrafish miRNAs, we identified 10 miRNAs: miR-21, miR-181c, miR-181b, miR-31, miR-7b, miR-2184, miR-24, miR-133a, miR-338 and miR-204, that showed conserved expression changes with both bichir and axolotl regenerating samples (Table 1). [score:4]
Although zebrafish miRNAs have been examined in numerous studies [25, 27, 41– 43], our analysis revealed novel paralogs of 18 miRNAs that do not currently have zebrafish records in miRBase (version 21), including miR-181a, miR-20a, miR-23b, miR-24, miR-29a, miR-103, miR-128, miR-148, miR-181b, miR-199, miR-204, miR-212, miR-221, miR-338, miR-724, miR-2184, let-7b and let-7e. [score:1]
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
[1 to 20 of 8 sentences]
2
[+] score: 14
e Heat maps profiles for change in expression of selected miRNAs Table 2 Cold shock -induced differential expression of known miRNAs miRNA Mature miRNA sequence Fold change Up-regulated miRNAs  Dre-mir-29b-1 UAGCACCAUUUGAAAUCAGUGU 3.90  Dre-mir-99-2 AACCCGUAGAUCCGAUCUUGUG 2.04  Dre-mir-99-1 AACCCGUAGAUCCGAUCUUGUG 1.79  Dre-mir-92a-2 UAUUGCACUUGUCCCGGCCUGU 1.75  Dre-mir-2184 AACAGUAAGAGUUUAUGUGCU 1.73 Down-regulated miRNAs  Dre-mir-737 AAUCAAAACCUAAAGAAAAUA −1.71  Dre-mir-9-2 UCUUUGGUUAUCUAGCUGUAUGA −1.75  Dre-mir-363 AAUUGCACGGUAUCCAUCUGUA −1.79  Dre-mir-125b-2 UCCCUGAGACCCUAACUUGUGA −1.91  Dre-mir-199-1 CCCAGUGUUCAGACUACCUGUUC −2.79 After eliminating miRNAs whose expression might be changed due to development process during incubation (control vs normal). [score:14]
[1 to 20 of 1 sentences]