sort by

11 publications mentioning zma-MIR397a

Open access articles that are associated with the species Zea mays and mention the gene name MIR397a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 53
In the expression analysis of miRNA targets, the following primers were used: miR397 target (F/5′ GTTCGATGTGCAAATGACCAA 3′; R/5′ CCGTCACGATGCTCTTGCT 3′), miR398 target (F/5′ TCTCATTATTCTCATGTGTTCTCAGTTC 3′; R/5′ CGGCGACGGCAACAAG 3′), miR408 target (F/5′ CCAAGAGACGCCAGTGAAGAG 3′; R/5′ TACTGCCCGTTCACCGTGAT 3′) and miR528 target (F/5′ CCCAGCACTCATTCCATAGCA 3′; R/5′ CCCAGCACTCATTCCATAGCA 3′). [score:12]
In maize, four Cu-miRNAs - miR397, miR398, miR408 and miR528 - were up-regulated and their targets were down-regulated in response to H. seropedicae inoculation. [score:9]
A hypothetical mo del involving copper-miRNA is proposed, emphasizing the fact that the up-regulation of miR397, miR398, miR408 and miR528, which is followed by inhibition of their targets, can facilitate association with diazotrophic bacteria. [score:8]
In plants inoculated with endophytic diazotrophic bacteria, an inverse miRNA/target regulation was observed: miR397, miR408 and miR528 were induced, and their targets were repressed. [score:6]
Relative expression of miR397, miR398, miR408 and miR528 in response to inoculation with A. brasilense and H. seropedicae. [score:3]
The results confirmed an increase in expression of miR397, miR398, miR408 and miR528 in plants inoculated with H. seropedicae (Figure 5). [score:3]
MiR397 was classified as Cu-miRNA, because its target is an mRNA that encodes laccase protein involved in copper homeostasis. [score:3]
The described targets of miR397, miR408 and miR528 in maize are laccases and cupredoxins [64], important copper protein families with redox activities [65] whose domains are conserved in other enzymes [66]. [score:3]
The expression profiles of four Cu-miRNAs (miR397, miR398, miR408 and miR528) were assayed by stem–loop qRT-PCR [105, 106]. [score:2]
Moreover, miR397 and miR528 are also classified as Cu-miRNA because they regulate proteins involved in copper homeostasis. [score:2]
More recently, miR397 has been shown to be involved in nitrogen fixation-related copper homeostasis in Lotus japonicus [21]. [score:1]
While 80% of these miRNA families were identified in both libraries, miR172, miR397, miR529 and miR827 were found only in the inoculated library, and miR3630 was present only in the control library. [score:1]
[1 to 20 of 12 sentences]
2
[+] score: 48
miR397 target: GRMZM2G146152_T01 (LAC2); miR398 target: GRMZM2G058522_T01 (SOD9); miR408 target: GRMZM2G384327_T03 (GR1); miR528 targets: GRMZM2G106928_T01 (SOD1A) and GRMZM2G107562_T01 (PLC). [score:9]
Here we tested the mRNA levels for maize GRMZM2G146152_T01 (laccase-like, LAC2) as target for miR397, GRMZM2G058522_T01 (SOD9) as validated target for miR398 (Shen et al., 2013), GRMZM2G106928_T01 (SOD-1A) and GRMZM2G107562_T01 (plastocyanin-like protein, PLC) as targets for miR528, and GRMZM2G384327_T03 (Gamma Response 1 protein, GR1), as previously predicted miR408 target (Li et al., 2013a). [score:9]
Our selection included both, validated and predicted targets according to the properties indicated in Table 1. The level of miR397 target, LAC2, showed contrasting changes between VS-535 and H-565 genotypes throughout hormone depletion. [score:5]
Our selection included both, validated and predicted targets according to the properties indicated in Table 1. The level of miR397 target, LAC2, showed contrasting changes between VS-535 and H-565 genotypes throughout hormone depletion. [score:5]
In a previous study performed on VS-535-derived EC, we found that development-related miRNAs such as miR156, miR159, miR164 and miR168 decreased as the length of subculture increased, while stress-related miRNAs such as miR397, miR398, miR408, and miR528 remained highly expressed (Dinkova and Alejandri-Ramirez, 2014). [score:4]
However, other miRNAs, significantly up-regulated in the dedifferentiation process, were miR156k, miR168, miR397, miR398, and miR408. [score:4]
Others represent enzymes involved in plant stress response (targets of miR397, miR398, miR408, miR528) or the miRNA biogenesis pathway itself (miR168). [score:3]
However, in H-565-derived plantlets miR397 and miR398 remained expressed at higher levels. [score:3]
There was poor correlation between miR397 and LAC2 levels for either of the embryogenic cultivars, suggesting this transcript is regulated by additional mechanisms during plant regeneration. [score:2]
Strikingly lower levels were detected for all tested miRNAs in VS-535 at 0% hormones and regenerated plantlets under light, whereas H-565 maintained the presence of some of the stress-related miRNAs (miR397 and miR398) higher. [score:1]
Particularly, the stress-related miR397, miR398, miR408, and miR528 showed about two-fold reduction in VS-535 fully developed plantlets with respect to dedifferentiated tissues (100% hormones). [score:1]
On the other hand, the stress-related miR397, miR398, miR408 and miR528, become enriched upon callus induction and remain at high levels once the proliferation is established. [score:1]
They identified miR528, miR156, miR166, miR168, miR390, miR164, miR167, miR398, miR397, miR408, and miR319 as the most abundant during dedifferentiation. [score:1]
[1 to 20 of 13 sentences]
3
[+] score: 33
Five miRNAs (miR169, miR172, miR397, miR398, and miR827) were identified as being differentially expressed in leaves in response to the transient low N condition, with miR172 up-regulated but miR397, miR398, and miR827 down-regulated (Table S1). [score:9]
For example, miR398(b,c), miR172(a,b,c,d) and miR397(a,b) had the same response under chronic and transient treatments in leaves, while miR408 and miR169(f,g,h) were down-regulated in both treatments and both tissues. [score:4]
Three of these five miRNAs (miR172, miR397, miR398) shared the same expression patterns in their response to both chronic and transient N-limiting conditions, while one of them (miRNA827) showed an inverse response to the two conditions (Table S1, Fig. 1). [score:3]
Nine miRNA faimlies (miR164, miR169, miR172, miR397, miR398, miR399, miR408, miR528, and miR827) were identified to be differentially expressed in leaves in response to chronic low N condition. [score:3]
The second category includes miR395, miR397, miR398, miR399, miR408, miR528, and miR827, whose potential target genes are predominantly involved in energy metabolism and scavenging of the oxidative species produced during stress. [score:3]
With regards to tissue specificity(or tissue dependent), some miRNAs were only regulated in roots or leaves, such as miR160, miR167, miR168, miR319 and miR395 in roots, and miR164, miR172, miR397, miR398 and miR827 in leaves, while some others were regulated in both tissues, such as miR169, miR399, miR408 and miR528 (Fig. 4). [score:3]
Both predicted targets of miR397, GRMZM2G072808 and GRMZM2G419994, are putative multi-copper oxidase. [score:3]
Most of the miRNAs tested matched the regulation patterns as discovered in the chronic and transient 2 hr array results including miR172a (Fig. 3), miR397a (Fig. 3), miR408 (Fig. 3) in leaves, and miR168a (Fig. 2) in roots. [score:2]
Nine miRNA families (miR164, miR169, miR172, miR397, miR398, miR399, miR408, miR528, and miR827) were identified in leaves, and nine miRNA families (miR160, miR167, miR168, miR169, miR319, miR395, miR399, miR408, and miR528) identified in roots. [score:1]
Other multi-copper oxidases that showed a similar pattern to miR397 include miR408/GRMZM2G066260 (Cupredoxin) (Fig. 3) and miR528/GRMZM2G367668 (multi-copper oxidase)(Fig. 3), suggesting that multi-copper oxidase activity involved in electron transport and in oxidase activity might be an important aspect of the physiological response to N limitation. [score:1]
The five miRNAs (miR169, miR172, miR397, miR398, and miR827) identified in leaves in response to transient low N condition were among the nine miRNAs identified under chronic N-limiting condition (Table S1, Fig. 1). [score:1]
[1 to 20 of 11 sentences]
4
[+] score: 17
Therefore, a high abundance of miR397 and miR528 would directly repress the expression of AO and indirectly repress that of DHA, maintain a high rate of cell division, and thereby promote plant growth. [score:5]
For example, the expression levels of Zma-miR528 and Zma-miR397 were clearly higher in the Mo17 × B73 cross than in B73 × Mo17 in 5-DAP kernels and 7-DAP endosperms (Figure 4B). [score:3]
It has been predicted that one target of miR528 and miR397 is the L-ascorbate oxidases (AO) gene, which would increase the accumulation of dehydroascorbate (DHA) and in turn restrict cell-division ability (Potters et al., 2000; Pignocchi et al., 2006). [score:3]
Similarly, Zma-miR408 also exhibited similar expression trends to Zma-miR528 and Zma-miR397, which might contribute to the phenotypic difference between these two reciprocal crosses (Figure 4B). [score:3]
Moreover, seven out of 36 miRNAs, including osa-miR167, osa-miR397, osa-miR398, osa-miR408, osa-miR528, osa-miR1866-3p, and osa-miRc11 were also preferentially expressed in rice seeds according to miRNA chip data in subspecies of japonica (Xue et al., 2009). [score:3]
[1 to 20 of 5 sentences]
5
[+] score: 16
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, zma-MIR444a, zma-MIR444b
In addition to these families, target genes of miR169, miR319, miR408 and miR529 were involved in transcription regulation, whereas miR159, miR397, and miR399 target genes were involved in response to stimulus. [score:6]
Similar to miR397 and miR408, miR528 also targets copper proteins cupredoxin, multicopper oxidase and laccase genes and thus might play a critical role in regulating physiological processes (photosynthetic and respiratory electron transport) and stress responses. [score:4]
In six of these cases the host genes were also the predicted target of the embedded miRNA gene, oriented either on the same strand (miR159c, miR319b, miR396a and miR397a) or opposite strand (miR169j and miR399d). [score:3]
Target genes of miRNA families, miR164, miR397, miR408, and miR528 showed enrichment in laccase and oxidoreductase activities and were found to be involved in secondary metabolic processes such as phenylpropanoid, amino acids, aromatic compounds and lignin catabolic processes (Table S7). [score:3]
[1 to 20 of 4 sentences]
6
[+] score: 11
But during the seeds development process of many crops, such as wheat [34], rice [33], and maize in the present study, the expression amount of miR397 are all maintaining a very low level. [score:4]
There are some other evidence showed that overexpression of miR397 can improve rice yield, mainly by increasing the grain size (result from cell division but not cell expansion) and promoting panicle branch [45]. [score:3]
In conclusion, miR397 may play important role in the early time of reproductive stage, but in the later seeds development process it’s the LAC genes who supply energy and improve the maize’s ability to resist environmental stresses during the grain filling stage. [score:2]
LAC 17 is the main oxidoreductase gene found in this study, and the qRT-PCR results showed that the relative abundance of LAC 17 increased slowly with the light decrease of miR397 across the four consecutive grain filling stages (Fig 4). [score:1]
Lu et al. (2013) characterized the laccase gene family and identified 49 laccase genes, of which 29 were predicted to be targets of Populustrichocarpa (ptr)-miR397a [42]. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 4
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, zma-MIR444a, zma-MIR444b
The 12 down-regulated miRNA families were miR156, miR159, miR164, miR166, miR167, miR168, miR169, miR172, miR319, miR393, miR394 and miR397. [score:4]
[1 to 20 of 1 sentences]
8
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR160f, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR1127a, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2275a, osa-MIR2275b, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397b, zma-MIR398a, zma-MIR398b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, tae-MIR167b, hvu-MIR168, hvu-MIR169, tae-MIR169, hvu-MIR397a, tae-MIR398, tae-MIR171b, hvu-MIR166b, hvu-MIR166c, osa-MIR2275c, osa-MIR2275d, tae-MIR1122b, tae-MIR9653a, tae-MIR9654a, tae-MIR9656, tae-MIR9657a, tae-MIR9659, tae-MIR9660, tae-MIR1127b, tae-MIR9661, tae-MIR396, tae-MIR9665, tae-MIR2275, tae-MIR9667, tae-MIR167c, tae-MIR1120b, tae-MIR397, tae-MIR1130b, tae-MIR5384, tae-MIR9675, tae-MIR1120c, tae-MIR9679, tae-MIR9657b, hvu-MIR397b, hvu-MIR156b, tae-MIR9653b
A recent study has found that miR397 overexpression improves rice yield by increasing grain size and promoting panicle branching [21]. [score:3]
[1 to 20 of 1 sentences]
9
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169f, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319b, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169f, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, osa-MIR529a, tae-MIR159a, tae-MIR159b, tae-MIR171a, tae-MIR1120a, osa-MIR1430, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR166n, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR397b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, hvu-MIR168, hvu-MIR171, hvu-MIR397a, tae-MIR171b, hvu-MIR1120, hvu-MIR166b, osa-MIR3981, hvu-MIR166c, tae-MIR1120b, tae-MIR397, tae-MIR1120c, hvu-MIR397b, hvu-MIR156b
However, there was no correlation between the level of precursor and mature miR397b-3p, most likely due to detection of putative miR397 molecules belonging to the same microRNA397 family encoded by other loci. [score:1]
Based on the nucleotide sequence and hairpin structural similarities, we classified barley MIR397 as an orthologue of rice MIR397b (Figure 1)B. The annotated osa-miR397b is located in the 5 [′] arm of the hairpin structure. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 1
Other miRNAs from this paper: zma-MIR164b, zma-MIR156k, zma-MIR2118b, zma-MIR397b
In one set 5 miRNAs (zma-miR164b-3p, zma-miR156k-5p, zma-miR2118b, zma-miR397a-5p, zma-miR397b-5p) were called differential, whereby the latter two have identical sequences. [score:1]
[1 to 20 of 1 sentences]
11
[+] score: 1
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR390b, zma-MIR444a, zma-MIR444b
The laccase-like protein (LAC) was tuned by miR397, which affects grain size, grain number and yield in rice [19]. [score:1]
[1 to 20 of 1 sentences]