sort by

4 publications mentioning aae-mir-184

Open access articles that are associated with the species Aedes aegypti and mention the gene name mir-184. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 9
In order to confirm the small RNA sequencing results, and to determine the expression patterns of these miRNAs in different developmental stages, we chose three conserved miRNAs: miR-184, −989 and miR-1000 represented in our sequencing data for further northern blot analysis. [score:4]
The expression patterns of four conserved miRNAs are shown in Figure  3. The patterns of miR-184, −2943 and miR-1000 are similar to the patterns found in Ae. [score:3]
Probe sequences were as follow, aan-miR-184: CCCTTATCAGTTCTCCGTCCA; aan-miR-989: GTACCACTACGTCACATCACA; aan-miR-998: GAGCTGAATCTCATG GTGCTA; aan-miR-2943: TTTGCCTGCAAGTGCCTACTTAA; aan-miR-1000: ACTG CTGTGTCAGGCAATAT. [score:1]
miR-184 and miR-1000 are present in An. [score:1]
[1 to 20 of 4 sentences]
2
[+] score: 5
Other miRNAs from this paper: aae-mir-275, aae-mir-317-1, aae-mir-2940, aae-mir-317-2
For example, when B. mori was selected as a reference, miR-184, which is a very highly expressed miRNA in most cases, was not allocated in the top 10 by DSAP (Table 3). [score:3]
miR-184, miR-275-3p, miR-317 were the most abundant miRNAs in all the different analyses. [score:1]
miRNA A. aegypti A. gambiae D. melanogaster B. mori Loose Strict DSAP Loose Strict DSAP Loose Strict DSAP Loose Strict DSAP miR-184 −0.5547 −0.5328 −0.42 −0.5355 −0.5343 −0.25 −0.3218 −0.5075 0.42 −0.3062 −0.5349 −1.77 miR-275-3p −0.9623 −0.9398 −0.15 −0.9430 −0.9411 −0.75 −0.7293 −0.9143 0.75 −0.7131 −0.9411 −0.75 miR-317 −1.0387 −1.0176 −0.71 −1.0261 −1.0275 +∞ −0.7996 −0.9923 – −0. [score:1]
[1 to 20 of 3 sentences]
3
[+] score: 2
We then performed northern blots using miR-184 and miR-998 probes. [score:1]
Although less obvious, miR-184 level also appears to be higher in blood-fed samples than in sugar-fed samples (Figure 4). [score:1]
[1 to 20 of 2 sentences]
4
[+] score: 1
miR-184 has been identified in over 39 organisms [29] and is conserved from humans to insects. [score:1]
[1 to 20 of 1 sentences]