sort by

2 publications mentioning aae-mir-2943-1

Open access articles that are associated with the species Aedes aegypti and mention the gene name mir-2943-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 15
Several miRNAs show the stage-specific expression, of which miR-2943 only expressed in the egg stage, suggesting that miR-2943 may be associated with the development of mosquito eggs. [score:6]
miR-2943, which has been proved to be only expressed in the embryonic stage, was taken as the positive control. [score:3]
As described before, miR-1000 and miR-2943 belong to the low GC miRNAs family. [score:1]
In contrast, miR-2943 is only present in the embryonic stage. [score:1]
As shown in Additional file 3: Table S2, the GC contents of aan-miR-1000 and miR-2943 are very contiguous to miR-141 and miR-200c, which is about 43.5%. [score:1]
miR-2943 is only detected in the embryonic stage. [score:1]
Probe sequences were as follow, aan-miR-184: CCCTTATCAGTTCTCCGTCCA; aan-miR-989: GTACCACTACGTCACATCACA; aan-miR-998: GAGCTGAATCTCATG GTGCTA; aan-miR-2943: TTTGCCTGCAAGTGCCTACTTAA; aan-miR-1000: ACTG CTGTGTCAGGCAATAT. [score:1]
So, aan-miR-1000 and miR-2943 also belong to low GC miRNAs. [score:1]
[1 to 20 of 8 sentences]
2
[+] score: 3
albopictus and DENV2 infection specifically in the midgut tissue, three miRNAs (miR-2941, miR-989, miR-2943) were differentially expressed [29], the first two also with change in abundance upon ZIKV infection in this study. [score:3]
[1 to 20 of 1 sentences]