sort by

6 publications mentioning gga-mir-2954

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-2954. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 48
)(ATP -dependent helicase CHD2) ENSTGUG00000010181 XP_002196848.1 CK304764 crk-like protein (v-crk avian sarcoma virus CT10 oncogene homolog-like) (CRKL) ENSTGUG00000010364 NEGR1 DV954047 Neuronal growth regulator 1 Precursor ENSTGUG00000011700 HMGB1 CK314519 High mobility group protein B1 (High mobility group protein 1)(HMG-1) We used TargetScan to find binding sites of tgu-miR-2954-3p on eight chicken genes and here are listed the information of their homologous genes in the zebra finch genome including Ensembl IDs, Gene Symbols, EST (Accession numbers of song-regulated EST identified in the previous microarray study) and Gene Names (or aliases in parenthesis). [score:5]
We used the TargetScan algorithm [52] to predict binding sites of tgu-miR-2954-3p in chicken genes, and then we confirmed the presence of the same conserved target sequence in the zebra finch genome assembly. [score:5]
One of these, tgu-miR-2954-3p, is predicted (by TargetScan) to regulate eight song-responsive mRNAs that all have functions in cellular proliferation and neuronal differentiation. [score:4]
To gain insight into the potential functional role of tgu-miR-2954-3p in the response to song, we used a conservative strategy to predict gene targets that are both conserved in birds and responsive to song exposure in the zebra finch. [score:3]
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
TaqMan and Illumina RNA-seq data generated from independent sets of birds (n = 6 in each data set) for expression from the tgu-mir-2954 locus. [score:3]
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
Indeed, our Northern analysis of the tgu-miR-2954-3p confirms a sex difference in expression of this Z-linked miRNA gene. [score:3]
By TaqMan as well as by Illumina, we observed an apparent sex difference in the direction of the response of tgu-miR-2954-3p to song - up in males and down in females (Figure 3 and Additional File 1, Table S4). [score:2]
Eight genes met all these criteria (Table 3) and are thus both song-responsive and also subject to regulation by tgu-miR-2954-3p. [score:2]
In nine out of ten cases, we observed the same direction of song response by TaqMan as in the small RNA-seq experiment, although the P-value by TaqMan was below 0.05 in only five cases (tgu-miR-124, tgu-miR-29a, tgu-miR-92, tgu-129-5p, and tgu-miR-2954-3p, Additional File 1, Table S4). [score:2]
The network includes well-characterized conserved miRNA known to have roles in neuronal differentiation (miR-124), and novel miRNAs that can target genes that control neuronal differentiation (tgu-miR-2954-3p). [score:1]
RNA probes were synthesized for tgu-miR-2954-3p probe 5' - UGCUAGGAGUGGAAUGGGGAU G - 3' by Integrated DNA Technologies. [score:1]
In these same animals, normal song, but not SEN, triggered a significant decrease in the levels of tgu-miR-124, tgu-mir-129-5p, tgu-miR-92 and tgu-miR-2954-3p (Additional File 2, Figure S3 panels A-C, H). [score:1]
The stem loop precursor processed by Drosha from the sense RNA (tgu-mir-2954) generates two active miRNAs from its both arms (tgu-miR-2954-3p and tgu-miR-2954-5p). [score:1]
Note Added in Proof: The novel miRNA referred to here as "miR-2954-3p" is now identified in miRBase as "miR-2954". [score:1]
C. Northern blot analysis using an RNA probe complementary to novel miRNA tgu-miR-2954-3p. [score:1]
Figure 2 The genome locus for tgu-mir-2954 produces three different miRNAs. [score:1]
B) Read counts from the Illumina RNA-seq for miR-2954-3p and miR-2954-5p (also shown in the Additional File 1, Table S4). [score:1]
To test for song-specificity of the miRNA response, we conducted a further TaqMan experiment assessing the levels of six miRNAs (tgu-miR-124, tgu-miR-92, tgu-miR-129-5p, and three miRNAs derived from the tgu-miR-2954 locus, next section), in birds who had heard either a normal song or a carefully matched non-song acoustic stimulus, "song enveloped noise" (SEN). [score:1]
Figure S2 shows a comparative mapping in other avian transcriptomes of tgu-mir-2954. [score:1]
The novel miRNA referred to here as "miR-2954-5p" is now identified in miRBase as "miR-2954*". [score:1]
Figure 3 Analysis of miRNAs produced at the tgu-mir-2954 locus. [score:1]
BLAST analysis of the mir-2954 hairpin precursor sequence against the NCBI nr database identified a putative mature miRNA in chicken (gi|145279910|emb|AM691163.1|), and BLAT analysis of a collection of transcripts from crocodile and 11 other bird species [36] detected mir-2954 transcripts in 2 non-passerine species (two hummingbirds) and 3 passerine species (the American crow, the pied flycatcher, and the golden collared manakin) (Additional File 2, Figure S2). [score:1]
[1 to 20 of 24 sentences]
2
[+] score: 23
Using the inflammation related target genes of differentially expressed miRNAs predicted by the TargetScan only, a potential relationship between miRNA changes and cytokine changes was presented in Figure 6. No immune related target genes were found for gga-miR-2954. [score:9]
Target genes of 14 differentially expressed miRNAs (gga-miR-122-5p, gga-miR-193a-5p, gga-miR-194, gga-miR-215-5p, gga-miR-217-3p, gga-miR-375, gga-miR-1559-3p, gga-miR-1769-3p, gga-miR-1788-3p, gga-miR-1798-5p, gga-miR-2954, gga-miR-3525, and gga-miR-3531-3p) were predicted by using the miRDB and TargetScan programs. [score:7]
A total of 14 differentially expressed miRNAs were detected (gga-miR-2954, gga-miR-215-3p, gga-miR-1798-5p, gga-miR-194, gga-miR-217-3p, gga-miR-1769-3p, gga-miR-1788-3p, gga-miR-1559-3p, gga-miR-3531-3p, gga-miR-215-5p, gga-miR-3525, gga-miR-193a-5p, gga-miR-122-5p, and gga-miR-375). [score:3]
There was no immune related target gene for gga-miR-2954. [score:3]
miR-1769-3p, miR-3531-3p, miR-1559-3p, miR-1798-5p, miR-1788-3p, miR-2954, and miR-3525 have not been found in the human and mouse genomes. [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 19
Other miRNAs from this paper: hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-30a, hsa-mir-32, hsa-mir-33a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-147a, hsa-mir-34a, hsa-mir-187, hsa-mir-204, hsa-mir-205, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-138-2, hsa-mir-142, hsa-mir-144, hsa-mir-125b-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-190a, hsa-mir-200c, hsa-mir-155, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-365b, hsa-mir-328, gga-mir-33-1, gga-mir-125b-2, gga-mir-155, gga-mir-17, gga-mir-148a, gga-mir-138-1, gga-mir-187, gga-mir-32, gga-mir-30d, gga-mir-30b, gga-mir-30a, gga-mir-30c-2, gga-mir-190a, gga-mir-204-2, gga-mir-138-2, gga-let-7d, gga-let-7f, gga-mir-146a, gga-mir-205b, gga-mir-200a, gga-mir-200b, gga-mir-34a, gga-mir-30e, gga-mir-30c-1, gga-mir-205a, gga-mir-204-1, gga-mir-23b, gga-mir-142, hsa-mir-449a, hsa-mir-489, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-33b, hsa-mir-449b, gga-mir-146b, gga-mir-147, gga-mir-489, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-144, gga-mir-460a, hsa-mir-147b, hsa-mir-190b, gga-mir-22, gga-mir-460b, gga-mir-1662, gga-mir-1684a, gga-mir-449c, gga-mir-146c, gga-mir-449b, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, gga-mir-365b, gga-mir-33-2, gga-mir-125b-1, gga-mir-190b, gga-mir-449d, gga-mir-205c
We noticed the miR-33-5p, miR-460a-5p, miR-365b-5p, miR-125b-5p and miR-2954 correlated with inflammatory genes including MEOX2, IL-1BETA, TRAF2, TNFRSF1B and MAP3K8, and except for the up-regulated miR-33-5 correlated with under expression of MEOX2, other down-regulated miRNAs all correlated with overexpression targets. [score:13]
Based on the present data, both down-regulated miR-365b-5p and miR-2954 correlated with NHE1 expression. [score:6]
[1 to 20 of 2 sentences]
4
[+] score: 6
The most down-regulated miRNA, which decreased in expression by almost 10-fold, was gga-miR-2954. [score:6]
[1 to 20 of 1 sentences]
5
[+] score: 6
Gga-miR-2954 has 100% homology with tgu-miR-2954-3p (zebra finch) and is highly expressed in brain (cerebrum, cerebellum), liver, heart and breast muscle, while it is undetected in other tissues. [score:3]
Gga-mir-2954 and gga-mir-1736 are also absent in the mammalian lineage. [score:1]
However, only the six miRNAs (miR-2954, gga-miR-2188-5p, gga-miR-365-3p, gga-miR-193b-3p, gga-miR-204 and mmu-miR-145a-5p) which compose Cluster 1 are found to be almost three-fold more abundant when concurrently considering R− and R+ animals (Table S2). [score:1]
The gga-mir-2954 family is avian specific [42]. [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 2
At the bottom are shown the results of gel electrophoresis of PCR products from each genomic DNA for pre-miRNA hairpin precursors for miR-1559, miR-2131, and miR-2954. [score:1]
We used PCR to confirm that five of these (miR-1559, miR-2131, miR-2131*, miR-2954, and miR-2954*) are conserved across, but are specific to, the entire avian lineage. [score:1]
[1 to 20 of 2 sentences]