sort by

34 publications mentioning hsa-mir-1260b

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1260b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 88
b miRNA RT-qPCR analysis showing the complete regulation of Hsa-miR-93, Hsa-miR-20a, Hsa-miR-125b and Hsa-miR-27b and, significant increase in the expression of Hsa-miR-1260 and Hsa-miR-1224-3p in metastatic tumors as compared to the non-metastatic xenograftTo validate the altered expression levels observed with whole genome miRNA array, we examined the expression levels of select miRNAs including hsa-miR-1260, hsa-miR-1224-3p (showing significant upregulation; see Fig.   2), hsa-miR-93, hsa-miR-20a, hsa-miR-125b, hsa-miR-27b (showing significant downregulation; see Fig.   3a), using individual miRNA QPCR analysis. [score:13]
b miRNA RT-qPCR analysis showing the complete regulation of Hsa-miR-93, Hsa-miR-20a, Hsa-miR-125b and Hsa-miR-27b and, significant increase in the expression of Hsa-miR-1260 and Hsa-miR-1224-3p in metastatic tumors as compared to the non-metastatic xenograft To validate the altered expression levels observed with whole genome miRNA array, we examined the expression levels of select miRNAs including hsa-miR-1260, hsa-miR-1224-3p (showing significant upregulation; see Fig.   2), hsa-miR-93, hsa-miR-20a, hsa-miR-125b, hsa-miR-27b (showing significant downregulation; see Fig.   3a), using individual miRNA QPCR analysis. [score:13]
In order to validate the miRNA expression obtained from whole genome profiling, expression of selected metastamiRs, including hsa-miR-1224-3p, hsa-miR-1260 (both significantly upregulated), hsa-miR-125b, hsa-miR-27b, hsa-miR-93,and hsa-miR-20a (all significantly downregulated) were confirmed using QPCR. [score:11]
To define the effect of characterized metastamiRs on the putative target proteins, we adopted two approaches: (i) inhibited hsa-miR-1224-3p or hsa-miR-1260 (both significantly upregulated) and (ii) functionally mimicked hsa-miR-125b, hsa-miR-27b, hsa-miR-93 or hsa-miR-20a (all significantly downregulated) and examined for the miRNA -dependent modulations in protein targets. [score:11]
miRNA mimic (hsa-miR-125b, hsa-miR-27b, hsa-miR-93, hsa-miR-20a) and inhibitor (hsa-miR-1224-3p, hsa-miR-1260) approach for select miRNAs revealed the direct influence of the altered metastamiRs in the regulation of identified protein targets. [score:7]
c Histograms of mean cell–Alexa Fluor intensity showing alterations in the expression of (i) ADAMTS-1 and CREB with hsa-miR-1224-3p inhibition and, (ii) ADAMTS-1, ASK1, FOSB and AKT-1 with hsa-miR-1260 inhibition. [score:7]
Thus, we validated our microarray results with RT-qPCR for upregulation (Hsa-miR-1260; Hsa-miR-1224-3p) and downregulation (Hsa-miR-20a, Hsa-miR-27b, Hsa-miR-125b, Hsa-miR-93) profiles (see Fig.   3b). [score:7]
Next, MSDACs transiently transfected with inhibitors for hsa-miR-1224-3p or hsa-miR-1260 (both showed profound induction in metastatic tumors) and examined for the alterations in protein targets. [score:5]
Transient transfection of MSDACs with hsa-miR-125b-, hsa-miR-27b-, hsa-miR-93- or hsa-miR-20a- mimics (MISSION® microRNA Mimics, Sigma-Aldrich) as well as hsa-miR-1224-3p- and hsa-miR-1260 -inhibitors (MISSION® Synthetic miRNA Inhibitors, Sigma-Aldrich) were carried out by using either TurboFectin 8.0 reagent (Origene) or Neon electroporation transfection system (Life Technologies). [score:5]
Conversely, we observed a significant (P < 0.001) upregulation of hsa-miR-1260 and hsa-miR-1224-3p in metastatic tumor compared with the non-metastatic control (Fig.   3b). [score:3]
Like-wise, inhibiting hsa-miR-1260 markedly (P < 0.001) induced ADAMTS-1 and ASK1 (Fig.  6c ii). [score:3]
However, inhibiting hsa-miR-1260 did not result in the induction of FOSB and AKT-1 in this setting. [score:3]
[1 to 20 of 12 sentences]
2
[+] score: 35
Hirata H. Hinoda Y. Shahryari V. Deng G. Tanaka Y. Tabatabai Z. L. Dahiya R. Genistein downregulates onco-miR-1260b and upregulates sFRP1 and Smad4 via demethylation and histone modification in prostate cancer cells Br. [score:7]
GEN down-regulated miR-1260b expression as well as Wnt-signaling [108]. [score:6]
Hirata H. Ueno K. Nakajima K. Tabatabai Z. L. Hinoda Y. Ishii N. Dahiya R. Genistein downregulates onco-miR-1260b and inhibits Wnt-signalling in renal cancer cells Br. [score:6]
miR-1260b is an onco-miR up-regulated in prostate cancer. [score:4]
Overexpression of miR-1260b in a normal prostate cell line increased cell proliferation, whereas knock-down decreased proliferation as well as invasion ability and increased the number of apoptotic PC-3 cells. [score:4]
This might be due to the fact that miR-1260b targets SFRP1, a Wnt-antagonist, as described previously [104]. [score:3]
Hirata et al. confirmed SFRP1 (a Wnt-antagonist) and Smad4 (transforming growth factor beta signalling mediator) as targets of miR-1260b. [score:3]
High miR-1260b levels also correlated with shorter survival. [score:1]
Transfection of renal cancer cell lines with pre-miR-1260b increased cell viability and invasion and repressed apoptosis. [score:1]
[1 to 20 of 9 sentences]
3
[+] score: 18
Exosomal miR-1260 expression levels were upregulated by 50.6 ± 0.23 and 10.87 ± 0.43 fold in influenza infected A549 and MDCK cells respectively. [score:6]
Among these upregulated miRNAs, miR-1260, -335* and -664 consistently exhibited similar expression patterns in blood, cells and exosomes in response to influenza infection. [score:6]
Further analysis identified 16 miRNAs (miR-1260, -1285, -18a, -185*, -299-5p, -26a, -30a, -335*, -34b, -519e, -576-3p, -628-3p, -664, -665, -765 and -767-5p) whose expression were markedly different from healthy individuals (Figure 1C). [score:3]
miR-1260, -26a, -335*, 576-3p, -628-3p and -664 exhibited similar expression patterns to that observed in blood. [score:3]
[1 to 20 of 4 sentences]
4
[+] score: 13
Figure 4 A. Histograms of individual miRNA QPCR analysis showing circulating levels of randomly selected miRNAs (miR-20a, miR-27b, miR-1224-3p, miR-1260, and miR-93) in the serum of animals with non-metastatic primary disease or with high-risk metastatic disease. [score:5]
Compared with the non-metastatic favorable disease animals, we observed marginal variations in the expression of miR-20a, miR-27b, miR-93, miR-1260, and miR-1224 (Figure 4A). [score:4]
For the present study, we used QPCR to confirm expression of selected miRNAs, including hsa-miR-1224-3p, hsa-miR-1260, hsa-miR-27b, hsa-miR-93, and hsa-miR-20a. [score:3]
B. Correlation analysis of the serum-circulating profiles of miR-20a, miR-27b, miR-1224-3p, miR-1260, and miR-93 observed using the miRnome approach. [score:1]
[1 to 20 of 4 sentences]
5
[+] score: 11
miR-1260 and miR-1280 were downregulated in Gem -treated HuCCT1 cells. [score:4]
However, when miR-1260 or miR-1280 was overexpressed by transfection of the respective mimic miRNA, the relative cell viability of Gem -treated mimic -transfected cells did not differ from that of Gem -treated mock -transfected cells or of Gem -treated cells transfected with a scrambled control siRNA. [score:3]
In HuCCT1 cells, the expression levels of two miRNAs, miR-1260 and miR-1280, were lower in Gem -treated cells than in untreated cells (normalized log [2] ratio: −2.24 and −2.66, respectively. [score:3]
Therefore, we used miRNA mimic transfection to examine the influence of miR-1260 and of miR-1280 on Gem sensitivity (Figure 2C). [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 11
Control versus curcuminControl versus H [2]O [2]Control versus H [2]O [2]+curcumin Downregulated Downregulated DownregulatedmiRNA (miR)P valueFR (FC)miRNA (miR)P valueFR (FC)miRNA (miR)P valueFR (FC)miR-302c0.033−4.26 (0.24)miR-15a0.041−13.98 (0.07)miR-70.011−4.18 (0.24)miR-30e0.016−7.37 (0.14)let-7a0.031−5.91 (0.17)miR-30d0.014−3.40 (0.29)miR-30d0.019−4.19 (0.24)miR-1260.045−19.01 (0.05)miR-140–5p0.017−10.42 (0.10)miR-30b0.02−3.97 (0.30)miR-27a0.024−22. [score:10]
83miR-125a-5p0.003−3.84 (0.26)miR-146a0.0373.64miR-1240.01714.23miR-1950.004−4.06 (0.25)miR-20a0.0023.4miR-1220.0043.82miR-28–3p0.036−4.06 (0.25)miR-1260.04111.9miR-125b0.0325miR-1280.018−6.17 (0.16)miR-29b0.0015.79miR-1410.0014.13miR-27b0.009−8.62 (0.12)miR-220.0013. [score:1]
[1 to 20 of 2 sentences]
7
[+] score: 10
Genistein downregulates onco-miR-1260b and inhibits Wnt-signalling in renal cancer cells. [score:6]
While miR-1260a was shown to be up-regulated in patients with pelvic organ prolapse (Jeon et al., 2015), miR-1260b plays a role in kidney cancer (Hirata et al., 2013). [score:4]
[1 to 20 of 2 sentences]
8
[+] score: 10
Among the whole miRNA profile, miR-1260b and miR-720 were the two most highly expressed miRNAs in MP cells, whereas miR-200b and miR-607 were highly expressed in SP cells. [score:5]
Name Predicted targets 1 miR-1260b DNMT3A, HOXD1, OCT1, FGF12, GDF11 2 miR-720 DNMT3A, NANOG 3 miR-1280 JAG2, ZNF544, UBTF 4 miR-491-3p EGFR, SOX-11, COL12A1, NOV/CCN3 5 miR-1260a DNMT3A, PDGFD, HOXD1, SEMA3A, FGF12 6 miR-138-1 TIEG2, JMJD1C, CYCLIN D3, ROCK2, PPARδ Table shows the selected possible mRNA targets related to stemness and cell differentiation. [score:5]
[1 to 20 of 2 sentences]
9
[+] score: 8
FOXM1 is targeted by miR-1260 and miR-320, which were downregulated in our analysis, suggesting abnormal (increased) FOXM1 expression in DLBCL. [score:8]
[1 to 20 of 1 sentences]
10
[+] score: 8
Furthermore, at 18, and 24-hour post-infection, miR-1260, miR-1274a, miR-1274b, miR-141, miR-18b, miR-21*, miR-720, miR-100*, miR-1260, miR1280, and miR21* were found to be down-regulated (>3-fold, p<0.05) in H5N1 infected cells. [score:4]
For H1N1 infected cells, at 18 and 24-hour post-infection, miR-188-5p, miR-1260, miR-1274a, miR-1274b, miR141, miR183*, miR-18b, miR-19a, miR21*, miR-301a, miR-572, miR-720, and miR-939 were found to be up-regulated (>1.5-fold, p<0.05) (Table 1). [score:4]
[1 to 20 of 2 sentences]
11
[+] score: 8
Oncogenic microRNA miR-1260b targets both Smad4 and secreted frizzled-related protein 1 (sFRP1, an endogenous Wnt pathway inhibitor) [13], suggesting that there is a population of prostate cancer patients in which the Wnt pathway is up-regulated while the BMP and TGFβ pathways are inactivated. [score:8]
[1 to 20 of 1 sentences]
12
[+] score: 7
Hirata H. Hinoda Y. Shahryari V. Deng G. Tanaka Y. Tabatabai Z. L. Dahiya R. Genistein downregulates onco-miR-1260b and upregulates sFRP1 and Smad4 via demethylation and histone modification in prostate cancer cells Br. [score:7]
[1 to 20 of 1 sentences]
13
[+] score: 7
As expected, most majority of the miRNAs, either upregulated in the cancer tissues, such as miR-223-3p [61], miR-421 [62], miR-424-5p [63], miR-1260b [64] etc, or downregulated in the penile cancer, such as miR-205-5p [65], miR-211-5p [65– 66], miR-365-3p [67] and miR-1247 [68] etc, were entitled the similar roles in carcinogenesis of bladder cancer, retinoblastoma, breast cancer, nasopharyngeal cancer, pancreatic cancer and several other cancer types [61– 68]. [score:7]
[1 to 20 of 1 sentences]
14
[+] score: 7
detected the expression profile of miRNAs from blood samples of influenza A H1N1 virus-infected patients and then exhibited that the expression levels of 193 miRNA molecules were altered in all influenza patients, of which 16 highly dysregulated miRNAs (miR-1260, miR-1285, miR-18a, miR-185*, miR-299-5p, miR-26a, miR-30a, miR-335*, miR-34b, miR-519e, miR-576-3p, miR-628-3p, miR-664, miR-665, miR-765 and miR-767-5p) were able to provide a clear distinction between infected and healthy individuals [39]. [score:6]
miRNA △△Ct2 [−] [△△Ct] hsa-miR-1290 −10.05 1063.66 hsa-miR-1275 −9.36 655.36 hsa-miR-1260 −9.25 609.09 hsa-miR-574-3p −4.49 22.48 hsa-miR-454 −4.45 21.93 hsa-miR-148a −4.38 20.85 hsa-miR-539 −4.36 20.57 hsa-miR-223 −4.27 19.29 hsa-miR-142-5p −4.27 19.26 hsa-miR-485-3p −4.21 18.56 hsa-miR-548c-5p −4.13 17.56 hsa-miR-17 −4.12 17.41 hsa-miR-484 −4.10 17.17 hsa-miR-652 −4.09 17.01 hsa-miR-660 −4.07 16.78 hsa-miR-20b −4.06 16. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 7
In the R5-supernatant treated LX2 cells, miR-3687 and miR-138-2* were the most upregulated (fold change, >2; p-value, <0.01) of all miRNAs while miR-4286 and miR-1260 were the most downregulated (fold change, >−2; p-value, <0.05). [score:7]
[1 to 20 of 1 sentences]
16
[+] score: 5
Target name Sequence Tm(°C) Let-7 AAACCGTTACCATTACTGAG 47,4 miR-21 TAGCTTATCAGACTGATGTT 47,9 miR-1260b ATCCCACCACTGCCACC 57,9 miR-1908 CGGCGGGGACGGCGATTGG 66,9 miR-143 TGAGATGAAGCACTGTAGC 51,9 miR-145 GTCCAGTTTTCCCAGGAATCC 55,7 miR-338 TCCAGCATCAGTGATTTTGT 52,1 miR-451 AAACCGTTACCATTACTGAG 49,8 EXOs were purified from xeno-free cell culture supernatants of adipose derived stem cells by ultracentrifugation. [score:3]
This is the case of miR-338-3p, miR-1260b and miR-1908. [score:1]
T-test analysis of miRNA levels in ADSCs and their EXOs showed no significant differences (p>0.05) between some miRNAs (including miR-1908, and miR-338-3p) indicating that they are present at similar levels in both compartments: cells and vesicles, while other miRNAs (including let-7-a-1, miR-21 and miR-1260b) showed significant differences (p<0.05), suggesting that they preferentially pack into EXOs (Figure S2). [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 4
Significantly deregulated miRNAs were miR-3163 (fold change 2.0, p = 0.05), miR-539 (fold change 0.5, p = 0.001), miR-1305 (fold change 0.5, p = 0.05), miR-1260 (fold change 0.5, p = 0.03) and let-7a (fold change 0.3, p = 0.02, in all cases unadjusted p-values; 30 most deregulated probes). [score:3]
Among the panel of miRNAs, there are some with relatively unknown cell cycle function, such as miR-3163, miR-1305, miR-1260. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
Further analyses showed that six of these miRNAs (miR-1260, miR-335*, miR-664, miR-26a, miR-576-3p, and miR-628-3p) had similar expression signatures in human A549 and Madin–Darby canine kidney (MDCK) cells infected with H1N1 in vitro. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
24 *** hsa-mir-770-5p 19 *** 75.47 *** hsa-mir-93* 9.5 *** 92.1 - Inhibited differentiation & low cell count *** hsa-let-7b* 4.75 *** 28.64 *** hsa-mir-1224-3p 2.38 *** 51.46 *** hsa-mir-1228 2.38 ** 9.43 *** hsa-mir-1249 1.66 *** 53.17 *** hsa-mir-125a-5p 19 *** 69.8 *** hsa-mir-1260 7.12 *** 61.75 *** hsa-mir-1280 11.88 *** 68.95 *** hsa-mir-129-3p 9.5 *** 65.64 - hsa-mir-1296 9.5 *** 36.36 *** hsa-mir-133a/hsa-mir-133b 42.75 * 0.85 *** hsa-mir-150 4.75 *** 60.37 *** hsa-mir-197 4.75 *** 27.79 *** hsa-mir-204 2.85 *** 27.44 *** hsa-mir-328 0.1 ** 30.87 *** hsa-mir-342-3p 33.25 *** 58. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
Six miRNAs were altered in expression due to exhaustive exercise in controls, namely hsa-miR-1260, hsa-miR-27a, hsa-miR-30e, hsa-miR-320c, hsa-miR-320d, and hsa-miR-320e. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
It was observed that in whole blood of H1N1 patients, miR-1260, miR-26a, miR-335, miR-576-3p, miR-628-3p and miR-664 are differentially expressed [57]. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
The boxplots show the expression levels of miR-197-5p (a), miR-4697-5p (b), miR-4721 (c), miR-5006-5p (d), miR-575 (e), miR-6893-5p (f), miR-125a-5p (g), miR-1260b (h), miR-224-3p (i), miR-331-3p (j), miR-365a-3p (k), miR-495-3p (l), miR-518b (m), miR-518f-3p (n), miR-543 (o) and miR-7977 (p). [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 2
Therefore, a total of 13miRNAs, namely miR-21-5p, miR-27a-3p, miR-27b-3p, miR-103a-3p, miR-106a-5p, miR-107, miR-126-5p, miR-130a-3p, miR-142-5p, miR-206, miR-371b-5p, miR-491-3p, and miR-1260b, were selected. [score:1]
In this study, we investigated 12 miRNAs predicted to target CYP3A4/5 mRNA and a negative control miRNA (miR-1260b). [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 2
Twelve miRNAs in this group (miR-196b, miR-485-3p, miR-589, miR-324-3p, miR-342-3p, miR-92a-1#, miR-155, miR-146b, miR-142-3p, miR-1260, miR-143, and miR-142-5p) seem to be influential on patient prognosis. [score:1]
Twelve miRNAs in group 5 (miR-196b, miR-485-3p, miR-589, miR-324-3p, miR-342-3p, miR-92a1#, miR-155, miR-146b, miR-142-3p, miR-1260, miR-143, and miR-142-5p) have strong loading (absolute value ≥ 0.8). [score:1]
[1 to 20 of 2 sentences]
25
[+] score: 2
Another example is hsa-miR-1260b with the most abundant form showing an A→G mutation at position 8 (Supplementary Figure S6). [score:2]
[1 to 20 of 1 sentences]
26
[+] score: 2
In conclusion, we identified 24 novel differentially abundant miRNAs in the plasma of patients with class IV lupus nephritis (hsa-miR-589-3p, hsa-miR-1260b, hsa-miR-4511, hsa-miR-485-5p, hsa-miR-584-5p, hsa-153-3p, hsa-miR-6087, hsa-miR-3942-5p, hsa-miR-7977, hsa-miR-323b-3p, hsa-miR-4732-3p, hsa-miR-6741-3p) that are good candidates for further assessment as diagnostic biomarkers of class IV lupus nephritis. [score:1]
Alterations in the relative abundance of miR-589-3p, miR-1260b, miR-4511, miR-485-5p, miR-584-5p, miR-543, miR-153-3p, miR-6087, miR-3942-5p, miR-7977, miR-323b-3p, miR-4732-3p and miR-6741-3p, and its possible association with lupus nephritis is described for the first time. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 1
The c-miRNA profile of the housed cattle at time 0 showed that the top 20 miRNAs comprised 84.38% of the total miRNAs, of which the most and second-most abundant were miR-2478 (33.68%) and miR-1260b (9.49%), respectively (Fig 4). [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Similar observation was made on Kinesin Family Member 1 C (KIF1C) gene: five miRNAs interacted with KIF1C in three stages of KIRC (1.8-fold, miR-484 and miR-769-3p (Stage I); 1.9-fold, miR-1260b, let-7b-5p, miR-149-5p, miR-769-3p and miR-484 (Stage II); 2.0-fold, miR-769-3p (Stage III); 2.2-fold, none (Stage IV)) (Fig.   4B). [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
As control we selected other miRNAs showing practically same average values: hsa-miR-1908-5p and hsa-miR-1260b (Table 2). [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
1 (2.47E-11) −10.1 (2.15E-11) −0.05 (1.0) hsa-miR-224-5p −7.6 (1.07E-06) −8.2 (1.86E-07) −0.6 (1.0) hsa-miR-708-5p −3.5 (8.07E-06) −4.0 (7.26E-07) −0.5 (1.0) hsa-miR-338-3p 1.8 (1.0) 1.6 (1.0) 0.2 (1.0) hsa-miR-149-5p −3.9 (4.33E-10) −4.9 (1.48E-08) −0.97 (1.0) hsa-miR-1260b −0.75 (0.4) −0. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
Other miRNAs from this paper: hsa-mir-491
It is suggested that such outliers (miR-1260b, -4286, -5100, -7975, and -7977) are incorporated into exosome cargos from the donor cytoplasm by natural inflow rather than RBP -mediated active translocation because they exist at high levels in HCT116 cells. [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-32, hsa-mir-33a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-27a, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-211, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-340, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-27a, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Actually, some miRNA were known only in bovine (for instance miR-1260b) or in goat (for instance miR-374e), enabling the identification of specific potential precursors (15 in bovine and 4 in goat). [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
In the 67 APAP-early patients, miR-122-5p identified subsequent liver injury when normalized by any of the 6 endogenous miRNA normalizers described above (miR-122-5p area under ROC curve normalized by miR-1913, 0.97 (95% CI 0.92–1.01); miR-671, 0.96 (0.92–1.01); miR-1287, 0.95 (0.90–1.00); let7-d, 0.94 (0.89–1.00); miR-1260, 0.93 (0.88–1.00); miR-324, 0.93 (0.87–1.00) miR-122-5p ROC-AUC significantly larger than all other miRNAs – P < 0.05). [score:1]
[1 to 20 of 1 sentences]
34
[+] score: 1
Despite the fact that this fetus has a similar number of D4Z4 contractions as the FSHD 14.1, they share only four modulated miRNAs (Fig. 4); miR-195, miR-451, miR-1260 and miR-628–5p. [score:1]
[1 to 20 of 1 sentences]