sort by

16 publications mentioning ssc-mir-451

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-451. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 68
When comparing different times post-infection with the E75-virulent strain, more than half of the spleen miRNAs expressed at higher levels (highest copy number), were DE (64.3%), when considering as DE those miRNAs with a FC > 5. Interestingly, two were up-regulated at 7 dpi (miR-451 and miR-145-5p), while the rest were down-regulated. [score:9]
From the 22 more expressed miRNAs (>80 reads) in spleen, 7 miRNAs (31.8%) were DE, four up-regulated in virulent ASFV infected animal (miR-92a, miR-126-5p, miR-92c and miR-30e-5p) and 3 down-regulated (miR-125b, miR-451 and miR-125a) (Table  4). [score:9]
Of the 8 differentially expressed miRNAs identified at the same time post-infection in infected animals with the virulent strain compared with animals infected with its attenuated strain, miR-126-5p, miR-92c, miR-92a, miR-30e-5p and miR-500a-5p presented up-regulation whereas miR-125b, miR-451 and miR-125a were down-regulated. [score:8]
From the 14 miRNAs expressed at higher levels (>80 reads) in spleen, 9 miRNAs (64.3%) were DE, two were up-regulated at 7 dpi when compared with 3 dpi (miR-451 and miR-145-5p) and 6 down-regulated (Table  2). [score:8]
Of these, miR-451, miR-145-5p, miR-181a and miR-122 presented up-regulation at late times post-infection while miR-92a, miR-23a, miR-92b-3p, miR-126-5p, miR-126-3p, miR-30d, miR-23b and miR-92c showed down-regulation. [score:7]
Thus, miR-451 is down-regulated at 3 dpi and up-regulated at 7 dpi. [score:7]
From the gene network analysis, we found that some miRNAs like miR-451 and miR-145-5p, which are the most represented DE miRNAs in spleen, and are highly up-regulated at 7 dpi, are associated with the viral gene 1242 L. This gene, also regulated by miR-125a and miR-125b, is involved in RNA transcription and processing [50]. [score:5]
Interestingly, miR-451, was also DE at 3 dpi in spleen of E75CV1-infected pigs, on this occasion, showing a clear up-regulation. [score:4]
Ten miRNAs were selected for target prediction according to the highest representation by tissue and conditions: miR-23a, miR-30e-5p, miR-92a, miR-122, miR-125b, miR-126-5p, miR-145-5p, miR-125a, miR-451 and miR-126-3p. [score:3]
For miR-451, miR-126-3p and miR-145-5p, no pathways were identified, although some of the target genes have been related to ASFV infection. [score:3]
As described for miR-451, no pathways related to immune response have been predicted for this miRNA, among the 293 target genes identified. [score:3]
miR-451 was the most represented miRNA in spleen of the virulent infected animals and is also DE between 3 and 7 dpi. [score:1]
Interestingly, miR-451 and miR-145-5p were the most represented miRNAs among all miRNAs, with more than two and one thousand counts found at day 7 for E75-infected pigs, respectively. [score:1]
[1 to 20 of 13 sentences]
2
[+] score: 23
0057156.g002 Figure 2 ssc-let-7c, ssc-miR-361-5p, ssc-423-3p, ssc-miR-425-3p and ssc-miR-451 were up-regulated, while ssc-miR-30e-3p, ssc-miR-320, ssc-miR-324 and ssc-miR-361-3p were down-regulated after GnRH challenge. [score:7]
ssc-let-7c, ssc-miR-361-5p, ssc-423-3p, ssc-miR-425-3p and ssc-miR-451 were significantly up-regulated in the GnRH treatment group, while ssc-miR-30e-3p, ssc-miR-320, ssc-miR-324 and ssc-miR-361-3p were significantly down-regulated (Figure 2 ). [score:7]
The panels with different letters were considered statistically significant (p<0.05), N = 6. ssc-let-7c, ssc-miR-361-5p, ssc-423-3p, ssc-miR-425-3p and ssc-miR-451 were up-regulated, while ssc-miR-30e-3p, ssc-miR-320, ssc-miR-324 and ssc-miR-361-3p were down-regulated after GnRH challenge. [score:6]
d AAAGUGC ssc-miR-361-3p 0.76 miR-361-3p CCCCCAG To validate the differentially expressed miRNAs revealed via microarray, 10 miRNAs were selected randomly (ssc-let-7c, ssc-miR-30e-3p, ssc-miR-320, ssc-miR-324, ssc-miR-361-3p, ssc-miR-361-5p, ssc-423-3p, ssc-miR-425-3p, ssc-miR-451 and ssc-miR-708-5p) for further analysis by using a special tail-added Real-time PCR method, taking U6 as an endogenous control. [score:3]
[1 to 20 of 4 sentences]
3
[+] score: 16
Repression of miR-451 has been associated to ABCB1 up-regulation, impairing S. Typhimurium ability to invade host cells by reducing adhesion to epithelial cells [66, 67]; on the other hand, ABCB1 down-regulation (as in the present study) is associated with inflammatory reaction (TNF activation) in the gut in response to bacterial infections [66, 68]. [score:7]
We also found miR-451 overexpression in ileum, in agreement with a recent study of porcine blood miRNA profile after S. Typhimurium infection [40]. [score:3]
Assessment of some of the best candidates by qPCR confirmed the microarray results but the fold changes obtained by qPCR were very modest compared with the fold changes found in the microarray data, with the exception of miR-451 which showed highly significant differential expression. [score:2]
Although we validated the array results by qPCR (Table  2), we could observe that in general miRNA expression values were very moderate compared to mRNA results, and only miR-451 was found to be statistically significant and biologically meaningful (FC > 2, P < 0.001). [score:2]
miRNA qPCR microArray miR-374a-5p 1.18* 2.27* miR-30a-5p 1.02 2.4* miR-451 2.87*** 2.3* miR-454-3p −1.09 −2.27 Let-7b-5p 1.11 3.22* miR-27b-3p 1.07 2.62* All values are expressed in fold change (FC) compared to controls. [score:2]
[1 to 20 of 5 sentences]
4
[+] score: 9
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
They detected let-7a-3p as a regulator of zonadhesin-like and growth hormone 2 gene, miR-142-5p as a regulator of heparin -binding growth factor 1, and miR-144 as a regulator of the growth factor receptor-bound protein 2. They also found that miR-430 regulates the transforming growth factor-beta -induced protein ig-h3, miR-451 blocks the anti-dorsalizing morphogenic protein, and miR-1594 activates both titin-cap (telethonin)-like mRNA and growth hormone receptor isoform 2. All of these miRNAs and targets are associated with growth and developmental processes. [score:8]
Seven miRNAs (miR-126-3p, miR-101a, miR-451, miR-22a, miR-146, miR-142a-5p, and miR-192) were found to have optimal stability and should be individually prioritized according to the stage and tissue of interest. [score:1]
[1 to 20 of 2 sentences]
5
[+] score: 8
MiR-142-5p, miR-148a and miR-451 target over five mRNAs, whereas only two predictions were found for miR-126. [score:3]
Group 1: microRNAs up-regulated in all or some of the infected samples compared to control (miR-144* (miR-144-5p in the newest miRBase 18.0 in human), miR-223, miR-451, miR-664-5p, miR-d5, SNORD15), (p-values shown in ). [score:3]
The ncRNAs chosen for RT-qPCR validation were: miR-15a, miR-21, miR-126, miR-142-5p, miR-143-3p, miR-144*, miR-146a-5p, miR-148a, miR-155, miR-223, miR-451, miR-664-5p, miR-d5 and SNORD15. [score:1]
Moreover, miR-664-5p, miR-451 and miR-15a appear as very promising candidates for microRNAs involved in response to pathogen infection. [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 6
Three of the up-regulated miRNAs (ssc-miR-7, ssc-miR-221-5p, and ssc-miR-451) likewise overlapped with miRNAs we have previously found to be up-regulated in necrotic lung tissue compared to visually unaffected lung tissue of pigs experimentally infected with the Gram -negative bacterium Actinobacillus pleuropneumoniae [49], suggesting a potential common function of these during both viral and Gram -negative bacterial pulmonary infection in pigs. [score:6]
[1 to 20 of 1 sentences]
7
[+] score: 5
In G1 (down-regulated), the stages from 35 to 63 dpc showed the most significant differences between breeds, in which miR-20, miR-499, miR-451 and miR-335 had drastic changes. [score:4]
By contrast, in G1 (down), 35–63 dpc showed the most significant differences between breeds; in this group, miR-20, miR-451, miR-499 and miR-335 showed drastic changes. [score:1]
[1 to 20 of 2 sentences]
8
[+] score: 4
OCT1 regulates the expression of a variety of genes, including immunoglobulin genes (Dreyfus, Doyen & Rougeon, 1987), β-casein gene (Zhao, Adachi & Oka, 2002), miR-451/AMPK signaling (Ansari et al., 2015), sex-determining region Y gene (Margarit et al., 1998), synbindin —related ERK signaling (Qian et al., 2015). [score:4]
[1 to 20 of 1 sentences]
9
[+] score: 3
Three category patterns from the DEMs were clustered based on the expression percentages including early-middle embryonic stage from miR-124 to miR-424, late embryonic stage from miR-345 to miR-451 and adult stage from miR-29b to miR-133a, respectively. [score:3]
[1 to 20 of 1 sentences]
10
[+] score: 3
The expressions of five genes (IRS1, CARNS1, MYOZ2, ANKRD2, and PLIN2) and four miRNAs (miR-4332, miR-451, miR-196a, and miR-29b) were significantly different between the DSP and the YY (S5 and S6 Figs). [score:3]
[1 to 20 of 1 sentences]
11
[+] score: 2
Among these DEMs, miR-133a, miR-451 and miR-739 are also identified as DEMs in the present study. [score:1]
Among the 40 DEMs obtained by deep sequencing, 8 (miR-100, miR-140, miR-184, miR-193a-5p, miR-222, miR-4332-3p, miR-451, and miR-574) were detectable in microarray. [score:1]
[1 to 20 of 2 sentences]
12
[+] score: 2
Other miRNAs from this paper: ssc-mir-122, ssc-mir-486-1, ssc-mir-192, ssc-mir-504, ssc-mir-486-2
Table 1 Primers used for the validation of selected miRNA and their target mRNA miRNA/mRNA Primers ssc-mir-122 GTGGAGTGTGACAATGGTGTTTGA ssc-mir-451 CGAGGAAACCGTTACCATTACTGAGTT ssc-mir-504 GGAGACCCTGGTCTGCACTCTATCT ssc-mir-486 CCTGTACTGAGCTGCCCCGA ssc-mir-192 CCTGACCTATGAATGACAGCCAAA 5SRNA GGTTAGTACTTGGATGGGAGACTGCCT GAPDH-F TCTTCTGGGTGGCAGTGAT GAPDH-R GTTTGTGATGGGCGTGAA NFAT5-F AGGGTAGTCGTGGCTCAGTA NFAT5-R CAGGGAGTTGTATTTCGCC NPEPPS-F AGATGGTGTGTGTGTCCGT NPEPPS-R CGTGATGAAGAACAGGAGTTFor the mRNA, the was performed using the TaKaRa PrimeScript™ RT Reagent Kit and gDNA Eraser (TaKaRa), which comprised a genomic DNA elimination reaction, reverse-transcription reaction and RT-PCR. [score:1]
Table 1 Primers used for the validation of selected miRNA and their target mRNA miRNA/mRNA Primers ssc-mir-122 GTGGAGTGTGACAATGGTGTTTGA ssc-mir-451 CGAGGAAACCGTTACCATTACTGAGTT ssc-mir-504 GGAGACCCTGGTCTGCACTCTATCT ssc-mir-486 CCTGTACTGAGCTGCCCCGA ssc-mir-192 CCTGACCTATGAATGACAGCCAAA 5SRNA GGTTAGTACTTGGATGGGAGACTGCCT GAPDH-F TCTTCTGGGTGGCAGTGAT GAPDH-R GTTTGTGATGGGCGTGAA NFAT5-F AGGGTAGTCGTGGCTCAGTA NFAT5-R CAGGGAGTTGTATTTCGCC NPEPPS-F AGATGGTGTGTGTGTCCGT NPEPPS-R CGTGATGAAGAACAGGAGTT For the mRNA, the was performed using the TaKaRa PrimeScript™ RT Reagent Kit and gDNA Eraser (TaKaRa), which comprised a genomic DNA elimination reaction, reverse-transcription reaction and RT-PCR. [score:1]
[1 to 20 of 2 sentences]
13
[+] score: 1
Interestingly, seven methylated miRNAs were identified in our study: ssc-mir-935, ssc-mir-7144, ssc-mir-671, ssc-mir-451, ssc-mir-21, ssc-mir-1306, and ssc-mir-127. [score:1]
[1 to 20 of 1 sentences]
14
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Sharbati-Tehrani et al., [67] have reported 4 new miRNAs (miR-326, miR-423-3p, miR-484 and miR-451,) that could not be identified in our study, which could be attributed to the use of very specialized tissues (Jejunium, spleen, ileum and kidney) for their study. [score:1]
[1 to 20 of 1 sentences]
15
[+] score: 1
569 AMP miR-10, miR-126, let-7, miR-27, miR-450 9.860E-05–5.804E-04 0.789–0.730 ADP miR-15, miR-885, miR-322, miR-450, miR-338 1.316E-04–4.540E-03 0.781–0.636 ATP miR-15, miR-450, miR-210, miR-885, miR-451 4.811E-04–9.562E-03 0.737–0.593 Correlations between gene expression derived from post quality-filtered 17,820 mRNA probes and each phenotypic- trait were calculated for both Duroc and PiNN pigs. [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
From lung tissue of pigs infected with Actinobacillus pleuropneumoniae, Podolska et al. (2012) identified miR-664-5p, miR-451, and miR-15a as promising miRNA candidates involved in response to bacterial infection. [score:1]
[1 to 20 of 1 sentences]