sort by

4 publications mentioning ssc-mir-1343

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-1343. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 13
Of these, 10 miRNAs (ssc-miR-210, ssc-miR-1343, 12_3058, ssc-miR-676-5p, GL894044.2_23796, 1_4279, 13_5125, ssc-miR-194b-5p, ssc-miR-142-5p, and ssc-miR-421-5p) were up-regulated and 10 (ssc-miR-101, 1_1126, 4_13655, GL892805.1_27591, ssc-miR-320, ssc-miR-7136-5p, ssc-miR-214, ssc-miR-10b, 7_17790, and ssc-miR-206) were downregulated in the TP relative to the YP. [score:7]
Four DE miRNAs (ssc-miR-210, ssc-miR-1343, ssc-miR-142-5p, and ssc-miR-421-5p) that are involved in the renal cell carcinoma pathway were upregulated in TPs, and the corresponding target genes were EPAS1, EGLN3, EGLN1, and VEGFC. [score:6]
[1 to 20 of 2 sentences]
2
[+] score: 9
Unfortunately, 10 miRNAs including 4 up-regulated (miR-129*, miR-1343, miR-193b* and miR-590) and 6 down-regulated (miR-2887, miR-2904, miR-2904-3p, miR-4332-3p, miR-4332-5p and miR-739) do not have orthologous genes in human, so they do not have target genes in the database. [score:9]
[1 to 20 of 1 sentences]
3
[+] score: 6
Take MAPK signaling pathway for instance, as shown in Fig. S1A, on PID 4, there are 38 DE miRNAs involved in MAPK signaling pathway and most DE miRNAs such as miR-450b-5p, miR-146b, miR-1343, miR-128, and miR-30a-5p were down-regulated while their targets such as MEF2C, NFKB1, TGFBR1, EGFR, JUN, and MAPK1 are key factors in MAPK signaling pathway (see map 04010 in KEGG database). [score:6]
[1 to 20 of 1 sentences]
4
[+] score: 6
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
The expressions of miR-1343, miR-2320 and miR-2411 were slightly higher in Meishan samples; miR-2483 higher in large White samples (Table S2). [score:3]
A. miR-1343, miR-2320, miR-2411 and miR-2483 were cloned in porcine backfat tissue of Large White and Meishan samples. [score:1]
miR-1343, miR-2320, miR-2411 and miR-2483 were cloned in porcine backfat tissue of Large White and Meishan samples. [score:1]
miRNA-name precusor-miRNA Minimum free energy(kcal/mol) bta-mir-1343 GGCTTCGGTGCTGGGGAGCGGCCCCCGGGCGGGCCTCTGCTCTGGCCC CTCCTGGGGCCCGCACTCTCGCTCCGGGCC ssc-mir-1343 GGCTTCGGTGCTGGGGAGCGGCCCCCGGGCGGGCCTCTGCTCTGGCCC CTCCTGGGGCCCGCACTCTCGCTCCGGGTC −50.3 bta-mir-2320 TGTCCCCA TGGCACAGGGTCCAGCTGTCGGCCGTGATACCCGATGGGTCGATGATGGTCCCTGTGTTTTGGGGCG ssc-mir-2320 TGTCCCCA TGGCACAGGGTCCAGCTGTCGGCTGTAATACCCGATGGGTCGATGATGGTCCCTGTGTTTGGGGCG −37.7 bta-mir-2366 CCCCGGGGTCCTCTTGTCTGAGCCCCAGAAAGAGGAGAGAGTGC TGGGTCACAGAAGAGGGTCTGGGGG ssc-mir-2366 CCCCAGGGTCCTCTTGTCTGAGCCCCAGAAAGAGGAGAGAGCGC TGGGTCACAGAAGAGGGTCTGGGGG −31.6 bta-mir-2411 GAGGAAATG TGGAGTGACTGTCAGATGCAGCCAGCAGAATAAGTGGTTTGGCTGAACTGTCTTACTCCCACATCCTC ssc-mir-2411 GAGGCAATGT GGAGTGACTGTCAGATGCAGCCATCAGAATAGGTGATTTGGCTGAACTGTCATACTCCCACATCCTC −29.2 bta-mir-2483 GAGTGAAAAGTTCCGTCAACCATCCAGCTGTTTGAGGTGATGC AAACAAACATCTGGTTGGTTGAGAGAATTTTTTACTT ssc-mir-2483 GAGTGAAAAGTTCCGTCAACCATCCAGCTGTTTGGGGTGATGC AAACAAACATCTGGTTGGTTGAGAGAATTTTTTACTT −37.3 Note: The bold are the mature miRNA sequences. [score:1]
[1 to 20 of 4 sentences]