sort by

15 publications mentioning mdm-MIR172c

Open access articles that are associated with the species Malus domestica and mention the gene name MIR172c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 133
Other miRNAs from this paper: mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR319a, mdm-MIR319b, mdm-MIR393a, mdm-MIR393b, mdm-MIR393c, mdm-MIR398a, mdm-MIR398b, mdm-MIR398c, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, mdm-MIR3627a, mdm-MIR3627b, mdm-MIR3627c, mdm-MIR391, mdm-MIR535a, mdm-MIR535b, mdm-MIR535c, mdm-MIR535d, mdm-MIR827, mdm-MIR5225c, mdm-MIR159c, mdm-MIR5225a, mdm-MIR5225b, mdm-MIR319c, mdm-MIR7125, mdm-MIR7126, mdm-MIR393d, mdm-MIR393e, mdm-MIR393f, mdm-MIR171o, mdm-MIR7128, mdm-MIR858, mdm-MIR1511, mdm-MIR3627d, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR399k, mdm-MIR319d, mdm-MIR319e, mdm-MIR319f, mdm-MIR319g, mdm-MIR171p, mdm-MIR393g, mdm-MIR393h, mdm-MIR319h, mdm-MIR171q, mdm-MIR172p
The expression patterns of these miRNAs and their targets could be divided into four types: (1) mdm-miR156, mdm-miR160, mdm-miR535 and their targets, the SBP, AP2, AP2-like, ARF16, AFB, DC19 and RD19 genes, had the highest expression levels in roots but relatively low expression levels in fruit (Figure  9A,B,D,F and H); (2) mdm-miR393, mdm-miR398a, mdm-miR398b and their targets, the SPL2, SPL9 and ACA8 genes, were found to be expressed most abundantly in flowers but had relatively low expression levels in fruit and roots (Figure  9A,C,E,F,G and H); (3) mdm-miR172, mdm-miR162, mdm-miR162, mdm-miR5225 and their targets, the ARF17, LETM1-LIKE and ADH2 genes, showed high expression levels in leaf tissue but relatively low levels were observed in stems (Figure  9B,D,E,G and I); (4) mdm-miR858 and mdm-miR3627 and their targets, the TIR1 and MYB5 genes, had high expression levels in fruit but low levels in stems (Figure  9C,G and J). [score:25]
The overexpression of miR156 in transgenic Populus ×  canadensis reduced the expression of miR156 -targeted SPL genes and miR172, and drastically prolonged the juvenile phase [1]. [score:7]
However, the expression levels of the targets AP2 and AP2-like (mdm-miR172 targets) were significantly higher in the J than in the A leaves from March to May (Figure  7B). [score:7]
The miRNAs within cluster 1 (miR172 for A and J) typically displayed high expression levels during the later stages of leaf development (August), but miRNAs within cluster 6 (miR156, 169, 393 and 858 for A and miR156 and 5225 for J) displayed opposite results, with high expression levels during the early stages (April and May) (Figure  7 and Additional file 12A). [score:6]
The expression levels of mdm-miR172 targets AP2 and AP2-like were significantly higher in J than in A leaves during early leaf development (from March to May); however, they were relatively low later (from June to August) (Figure  7B). [score:6]
The higher expression level of mdm-miR156 and lower expression level of mdm-miR172 in the juvenile phase leaves implied that these two small miRNAs regulated the phase transition. [score:6]
Compared with the expression profile of mdm-miRNA156, mdm-miR172 showed a high expression level in older tree leaves (4-, 5- and 6-years-old) and this expression increased gradually in 1- to 6-year-olds (Figure  8A,B). [score:6]
miR172 down-regulates GLOSSY15 expression, which promotes the vegetative phase change in maize [15]. [score:6]
The expression of miRNAs and their targets in leaves of different ages: mdm-miR156 (A); mdm-miR172 (B); mdm-miR393 (C); mdm-miR160 (D); mdm-miR162 (E); mdm-miR535 (F); mdm-miR3627 and mdm-miR5225 (G); mdm-miR398a (H); mdm-miR398b (I); and mdm-miR858 (J). [score:5]
miR156 family numbers (A) and other known miRNA family numbers (B) expressed higher in J than in A; miR172 family numbers (C) and other known miRNA family numbers (D) expressed higher in A than in J. The reference genome sequences of the domesticated apple (Malus × domestica Borkh. ) [score:5]
miR156 family numbers (A) and other known miRNA family numbers (B) expressed higher in J than in A; miR172 family numbers (C) and other known miRNA family numbers (D) expressed higher in A than in J. Putative novel miRNA in M. hupehensisThe reference genome sequences of the domesticated apple (Malus × domestica Borkh. ) [score:5]
Expression of miRNAs and their targets in different tissue: mdm-miR156 (A); mdm-miR172 (B); mdm-miR393 (C); mdm-miR160 (D); mdm-miR162 (E); mdm-miR535 (F); mdm-miR3627 and mdm-miR5225 (G); mdm-miR398a (H); mdm-miR398b (I); and mdm-miR858 (J). [score:5]
The expression of miRNAs and their targets in A and J leaves: mdm-miR156 (A); mdm-miR172 (B); mdm-miR393 (C); mdm-miR160 (D); mdm-miR162 (E); mdm-miR535 (F); mdm-miR3627and mdm-miR5225 (G); mdm-miR398a (H); mdm-miR398b (I); and mdm-miR858 (J). [score:5]
Our research showed that miRNA172 and its targets participated in the regulation of the juvenile to adult phase transition and the formation of floral organs. [score:4]
The qRT-PCR experiments also validated the deep-sequencing results of a down-regulation of mdm-miR172 in the J library compared with the A library during leaf development (Figure  7B). [score:4]
Previous research showed that miR172 could promote flowering, but that its targets were floral repressors, such as AP2-like, AP2, EAT1 and EAT2, which play important roles in the regulation of leaf traits in A. thaliana[44, 46]. [score:4]
It was reported that GA accelerates flowering through the degradation of transcription repressors, DELLAs, and that DELLAs directly bind to miRNA156 -targeted TFs (SPL family members), which promote flowering by activating miR172 and MADS-box genes [21]. [score:4]
The qRT-PCR experiments also validated the deep-sequencing results of the down-regulation in J compared with A leaves for mdm-miR172, mdm-miR398a and mdm-miR398a in April, May and June (Figure  7B,H and I). [score:3]
mdm-miR156 is highly abundant in J leaves and decreases in A leaves, while mdm-miR172 has the opposite expression pattern in the two leave types. [score:3]
In our study, the expression of mdm-miR172 family members was significantly higher in the A leaf library than in the J leaf library, implying that they were active in adult stage maintenance (Figure  5C). [score:3]
However, the expression levels of mdm-miR172 and four other miRNA family members, mdm-miR398, 397, 7125 and 408, were significantly higher in the A library than in the J library (Figure  5C,D). [score:3]
We also found that the sit-miR172 family members’ expression levels were significantly higher in adult leaves and flower tissues in olives (Olea europaea L. ) [47]. [score:3]
miR172 may be involved in regulating the juvenile to adult transition during developmental stages [47, 48]. [score:3]
In total, 127 targets of 25 known miRNA families, including mdm-miR156, mdm-miR159, mdm-miR166 and mdm-miR172, were detected in our library (Table  3; Additional file 6). [score:3]
A majority of the 42 known miRNA families had several members, and five families, mdm-miR156, mdm-miR171, mdm-miR172, mdm-miR167 and mdm-miR399, had 31, 15, 15, 10 and 10 members, respectively. [score:1]
Our results showed that the juvenile to adult phase transition and flowering were controlled by mdm-miRNA156 and mdm-miRNA172. [score:1]
[1 to 20 of 26 sentences]
[+] score: 40
Other miRNAs from this paper: mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR168a, mdm-MIR168b, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR390a, mdm-MIR390b, mdm-MIR390c, mdm-MIR390d, mdm-MIR390e, mdm-MIR390f, mdm-MIR393a, mdm-MIR393b, mdm-MIR393c, mdm-MIR394a, mdm-MIR394b, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR397a, mdm-MIR397b, mdm-MIR398a, mdm-MIR398b, mdm-MIR398c, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, mdm-MIR403a, mdm-MIR403b, mdm-MIR408a, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR159c, mdm-MIR393d, mdm-MIR393e, mdm-MIR393f, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR399k, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR393g, mdm-MIR393h, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR169o
Gleave et al. [55] previously reported putative orthologues of SPL encoding genes as apple miR156 targets, an apple ARF16 as a miR167 target, orthologues of AP2 and TOE1 as miR172 targets and a copper superoxid dismutase, MdCSD as a miR398 target. [score:9]
Conservation status miRNA family Arabidopsis Oryza(rice) Populus(poplar) Predicted target gene(s) miR156 √ √ √Squamosa promoter -binding proteins[57] miR159/319 √ √ √GAMYB transcription factors[57] miR160 √ √ √Auxin response factors (ARF) [57] miR162 √ √ √DICER-LIKE 1 (DCL1) [57] miR164 √ √ √NAC domain transcription factors[57] miR156/166 √ √ √HD-ZIP transcription factors[57] miR167 √ √ √Auxin response factors (ARF) [57] miR168 √ √ √ARGONAUTE 1 (AGO1) [57] miR169 √ √ √HAP2-like transcription factors[57] miR171 √ √ √Scarecrow-like transcription factors[57] miR172 √ √ √APETALA 2 transcription factors[58] miR390 √ √ √TAS3[59] miR393 √ √ √F-box transcription factors (TIR1) [60] miR394 √ √ √F-box transcription factors[60] miR396 √ √ √GRF, rhodenase[60] miR397 √ √ √laccase[60] miR398 √ √ √Copper superoxid dismutase, CytC oxidase[60] miR403 √ √ √ARGONAUTE 2 (AGO2)[20] miR408 √ √Peptide chain release factor, laccase[20] miR475 √PPR proteins[8] miR476 √PPR proteins[8] Figure 1 Differential expression of miRNAs in apple tissues. [score:5]
Conservation status miRNA family Arabidopsis Oryza(rice) Populus(poplar) Predicted target gene(s) miR156 √ √ √Squamosa promoter -binding proteins[57] miR159/319 √ √ √GAMYB transcription factors[57] miR160 √ √ √Auxin response factors (ARF) [57] miR162 √ √ √DICER-LIKE 1 (DCL1) [57] miR164 √ √ √NAC domain transcription factors[57] miR156/166 √ √ √HD-ZIP transcription factors[57] miR167 √ √ √Auxin response factors (ARF) [57] miR168 √ √ √ARGONAUTE 1 (AGO1) [57] miR169 √ √ √HAP2-like transcription factors[57] miR171 √ √ √Scarecrow-like transcription factors[57] miR172 √ √ √APETALA 2 transcription factors[58] miR390 √ √ √TAS3[59] miR393 √ √ √F-box transcription factors (TIR1) [60] miR394 √ √ √F-box transcription factors[60] miR396 √ √ √GRF, rhodenase[60] miR397 √ √ √laccase[60] miR398 √ √ √Copper superoxid dismutase, CytC oxidase[60] miR403 √ √ √ARGONAUTE 2 (AGO2)[20] miR408 √ √Peptide chain release factor, laccase[20] miR475 √PPR proteins[8] miR476 √PPR proteins[8] Figure 1 Differential expression of miRNAs in apple tissues. [score:5]
Accumulation of MdSPL target transcripts varied among tissues and was not obviously related to differential accumulation of miR156, as was the case for miR172 and MdTOE1 (Figure 6C). [score:3]
A, Gel blot analyses of miR156, miR159, miR166, miR167 and miR172 expression. [score:3]
B, Stem-loop RT-PCR analyses of miR156, miR159, miR166, miR167 and miR172 expression. [score:3]
Increased sensitivity of this method allowed for detection of low levels of miR172 expression across all tissues analysed. [score:3]
RNA gel-blot analysis was used to examine the expression of miR156, miR159, miR166, miR167 and miR172 in shoot apex, leaf and stem tissues. [score:3]
The relative levels of expression were higher for miR159, miR166 and miR167 than for miR156 and especially miR172, which was barely detectable. [score:3]
Indeed, a demonstration of shoot-to-root transport and biological activity of shoot-derived miR399 in roots is consistent with the role as a long-distance signal for the regulation of plant phosphate homeostasis [44, 45] and the graft-transmissible induction of potato tuberisation by miR172 implies its long-distance signalling role [75]. [score:2]
Using this approach miR156, miR159, miR160, miR162, miR167, miR169, miR396 and miR398 were clearly detectable; miR172, miR390 and miR393 produced a weak amplification signal; miR166 and miR397 amplification did not produce the expected product, but resulted in a smear not detected in the minus-RT control; miR164, miR168, miR171, miR394, miR403, miR408 and the miRNAs specific to poplar (miR475 and miR476) were not detected (Figure 4). [score:1]
[1 to 20 of 11 sentences]
[+] score: 26
Other miRNAs from this paper: mdm-MIR482a, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR319a, mdm-MIR319b, mdm-MIR390a, mdm-MIR390b, mdm-MIR390c, mdm-MIR390d, mdm-MIR390e, mdm-MIR390f, mdm-MIR393a, mdm-MIR393b, mdm-MIR393c, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR398a, mdm-MIR398b, mdm-MIR398c, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, mdm-MIR408a, mdm-MIR3627a, mdm-MIR3627b, mdm-MIR3627c, mdm-MIR477b, mdm-MIR477a, mdm-MIR482b, mdm-MIR482c, mdm-MIR535a, mdm-MIR535b, mdm-MIR535c, mdm-MIR535d, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR2118a, mdm-MIR2118b, mdm-MIR2118c, mdm-MIR482d, mdm-MIR5225c, mdm-MIR159c, mdm-MIR7124a, mdm-MIR7124b, mdm-MIR5225a, mdm-MIR5225b, mdm-MIR319c, mdm-MIR393d, mdm-MIR393e, mdm-MIR393f, mdm-MIR171o, mdm-MIR1511, mdm-MIR3627d, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR399k, mdm-MIR319d, mdm-MIR319e, mdm-MIR319f, mdm-MIR319g, mdm-MIR395j, mdm-MIR171p, mdm-MIR393g, mdm-MIR393h, mdm-MIR395k, mdm-MIR319h, mdm-MIR171q, mdm-MIR172p, mdm-MIR395l
In Arabidopsis, miR156 targets a gene family of 11 SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factors; whereas miR172 regulates six members of the APETALA2 (AP2) transcription factors. [score:4]
The flowering regulators miR156 expressed stronger in the vegetative buds, while miR172 was abundant in the floral buds (Table S4). [score:4]
miR156 and miR172 could also regulate flowering time in response to vernalization through the opposite expression trends (Bergonzi et al., 2013). [score:4]
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
On the other hand, constitutive expression of apple miR172 leads to earlier flowering in transgenic Arabidopsis (Zhao et al., 2015). [score:3]
In both annual mo del plant Arabidopsis and polycarpic perennial crops such as Cardamine flexuosa, miR156, and miR172 were first identified to regulate phase transition, the process that also represents the first time of floral transition during plant life circle. [score:2]
In conclusion, in this study we found that the classic mo del of miR156-miR172 in flowering appears to apply to floral transition of apple trees. [score:1]
In addition to miR156 and miR172, numerous DE-miRNAs were also identified to involve in floral transition in apple trees. [score:1]
Among these families, major malus miRNAs, including miRNA156 (9 members), miRNA171 (14), miRNA172 (14), miRNA167 (10), and miRNA395 (9), were detected (Figure 2A). [score:1]
Notably, mdm-miR398b/c, instead of miR156 or miR172, represents the most significant difference among all the DE-miRNAs (Figure 2B, Table S4). [score:1]
miR156 functions to extend juvenile phase and delay flowering, while miR172 leads to early flowering (Wu et al., 2009; Zhou C. M. et al., 2013). [score:1]
In many previous studies in Arabidopsis and other plants, it has shown that the function of miR156 and miR172 in phase transition also include the repression/promotion of flowering process, respectively. [score:1]
[1 to 20 of 12 sentences]
[+] score: 20
SmallRNA SmallRNA_seq Transcript Transcript Annotation KEGG_pathways Alignment Score Alignment Range P-value mdm-miR403a TTAGATTCACGCACAAACTCG XM_008373619.1 Argonaute – 1 3231–3251 0.00E+00 mdm-miR397a_L+1R+2_1ss22AG ATTGAGTGCAGCGTTGATGAAGGT XM_008365682.1 Nitrite reductase (NO-forming) ko00910(Nitrogen metabolism) 2.5 738–760 0.00E+00 mdm-miR172a_R+1_1 AGAATCTTGATGATGCTGCAA XM_008359912.1 AP2-like factor, euAP2 lineage – 2 1715–1735 0.00E+00 mdm-miR396c_R-2 TTCCACAGCTTTCTTGAAC XM_008372783.1 E3 ubiquitin-protein ligase ko04120(Ubiquitin mediated proteolysis); ko04144(Endocytosis) 4 2420–2438 8.13E−42 mdm-miR3627a_R-1 TCGCAGGAGAGATGGCACT XM_008393337.1Ca [2+]-transporting ATPase – 1.5 334–352 8.36E−76 mdm-miR162a TCGATAAACCTCTGCATCCAG XM_008360618.1 Endoribonuclease Dicer – 2 3720–3741 2.00E−31 gma-MIR5368-p3_1ss3GA CCAAGGGACAGTCTCAGGT XM_008373238.1 Autophagy-related protein 7 ko04140(Regulation of autophagy) 3 946–964 3.22E−20 gma-MIR5368-p5_1ss2AT GTGAGATACCACTCTGGA XM_008360074.1 Cellulose synthase A – 4 1825–1842 5.69E−09 ppe-MIR172c-p5 GCGGCATCATCAAGATTCAC XM_008393540.1 Monodehydroascorbate reductase ko00053(Ascorbate and aldarate metabolism) 4 518–536 1.92E−28 PC-3p-202837_7 AGGAATGTAAAATGAGATT XM_008392258.1 Pyruvate dehydrogenase kinase – 3.5 909–928 1.69E−19 PC-3p-370429_4 AGTGTAGAATGAGATTTTTTGAAG XR_524420.1 Glutathione S-transferase ko00980(Metabolism of xenobiotics by cytochrome P450);ko00982(Drug metabolism - cytochrome P450) 3 514–537 1.69E−08 PC-5p-154495_9 AGATGAATTTGAATTTTGAGATTT XM_008355882.1 ATP -binding cassette ko02010 (ABC transporters) 2.5 2608–2631 1.61E−29 Target annotation of differentially expressed miRNAs in apple response to VmThe GO annotation showed that these target genes could participate in various cellular processes, such as apoptosis, transcription regulation, auxin -mediated signaling pathway, ATP binding, DNA binding and protein binding activity (Table S6). [score:9]
The gene ppe-MIR172c-p5 was found to regulate the expression of monodehydroascorbate reductase, and PC-5p-154495_9 could affect the ABC transporters pathway (KEGG) by targeting ATP -binding cassette (Table 2). [score:6]
SmallRNA SmallRNA_seq Transcript Transcript Annotation KEGG_pathways Alignment Score Alignment Range P-value mdm-miR403a TTAGATTCACGCACAAACTCG XM_008373619.1 Argonaute – 1 3231–3251 0.00E+00 mdm-miR397a_L+1R+2_1ss22AG ATTGAGTGCAGCGTTGATGAAGGT XM_008365682.1 Nitrite reductase (NO-forming) ko00910(Nitrogen metabolism) 2.5 738–760 0.00E+00 mdm-miR172a_R+1_1 AGAATCTTGATGATGCTGCAA XM_008359912.1 AP2-like factor, euAP2 lineage – 2 1715–1735 0.00E+00 mdm-miR396c_R-2 TTCCACAGCTTTCTTGAAC XM_008372783.1 E3 ubiquitin-protein ligase ko04120(Ubiquitin mediated proteolysis); ko04144(Endocytosis) 4 2420–2438 8.13E−42 mdm-miR3627a_R-1 TCGCAGGAGAGATGGCACT XM_008393337.1Ca [2+]-transporting ATPase – 1.5 334–352 8.36E−76 mdm-miR162a TCGATAAACCTCTGCATCCAG XM_008360618.1 Endoribonuclease Dicer – 2 3720–3741 2.00E−31 gma-MIR5368-p3_1ss3GA CCAAGGGACAGTCTCAGGT XM_008373238.1 Autophagy-related protein 7 ko04140(Regulation of autophagy) 3 946–964 3.22E−20 gma-MIR5368-p5_1ss2AT GTGAGATACCACTCTGGA XM_008360074.1 Cellulose synthase A – 4 1825–1842 5.69E−09 ppe-MIR172c-p5 GCGGCATCATCAAGATTCAC XM_008393540.1 Monodehydroascorbate reductase ko00053(Ascorbate and aldarate metabolism) 4 518–536 1.92E−28 PC-3p-202837_7 AGGAATGTAAAATGAGATT XM_008392258.1 Pyruvate dehydrogenase kinase – 3.5 909–928 1.69E−19 PC-3p-370429_4 AGTGTAGAATGAGATTTTTTGAAG XR_524420.1 Glutathione S-transferase ko00980(Metabolism of xenobiotics by cytochrome P450);ko00982(Drug metabolism - cytochrome P450) 3 514–537 1.69E−08 PC-5p-154495_9 AGATGAATTTGAATTTTGAGATTT XM_008355882.1 ATP -binding cassette ko02010 (ABC transporters) 2.5 2608–2631 1.61E−29 The GO annotation showed that these target genes could participate in various cellular processes, such as apoptosis, transcription regulation, auxin -mediated signaling pathway, ATP binding, DNA binding and protein binding activity (Table S6). [score:5]
[1 to 20 of 3 sentences]
[+] score: 18
Other miRNAs from this paper: mdm-MIR482a, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR168a, mdm-MIR168b, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR393a, mdm-MIR393b, mdm-MIR393c, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR397a, mdm-MIR397b, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, mdm-MIR391, mdm-MIR482b, mdm-MIR482c, mdm-MIR535a, mdm-MIR535b, mdm-MIR535c, mdm-MIR535d, mdm-MIR827, mdm-MIR828a, mdm-MIR828b, mdm-MIR482d, mdm-MIR7123a, mdm-MIR7123b, mdm-MIR5225c, mdm-MIR159c, mdm-MIR7124a, mdm-MIR7124b, mdm-MIR5225a, mdm-MIR5225b, mdm-MIR7125, mdm-MIR7126, mdm-MIR393d, mdm-MIR393e, mdm-MIR393f, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, mdm-MIR7128, mdm-MIR858, mdm-MIR1511, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR399k, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR393g, mdm-MIR393h, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
Based on the GO annotation of the target genes and with the KEGG pathway analysis, the potential targets of miR164, miR166, miR171, miR172, and miR482 are involved in meristem development (Table 3). [score:6]
In contrast, five members of mdm-miR164, three members of mdm-miR171, six members of mdm-miR172, three members of mdm-miR393, nine members of mdm-miR395, two members of mdm-miR396, six members of mdm-miR399, two members of mdm-miR5225, two members of mdm-miR7124, and mdm-miR858 were all downregulated in YF shoot tips. [score:4]
The potential targets of miR159, miR166, miR167, miR171, miR172, miR393, miR858, and miR828 are involved in cell growth. [score:3]
The juvenile to adult phase transition related microRNAs, mdm-miR156 and mdm-miR172, and the flowering related, mdm-miR535, mdm-miR168, and mdm-miR167, also showed high expression levels in apple shoot tips. [score:3]
In contrast, mdm-miR172a, mdm-miR172o, and mdm-miR172g-h, members of the mdm-miR172 family (15 members), had a high read count, while mdm-miR172 a-c, mdm-miR172i-k, and mdm-miR172 m-o had a moderate read count, and mdm-miR172l had a low count. [score:1]
The top five miRNA families, mdm-miR156, mdm-miR172, mdm-miR171, mdm-miR167, and mdm-miR399, had more than 10 members. [score:1]
[1 to 20 of 6 sentences]
[+] score: 11
Other miRNAs from this paper: mdm-MIR482a, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR168a, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR393a, mdm-MIR393b, mdm-MIR393c, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR397a, mdm-MIR397b, mdm-MIR398a, mdm-MIR398b, mdm-MIR398c, mdm-MIR399a, mdm-MIR399d, mdm-MIR399i, mdm-MIR408a, mdm-MIR3627a, mdm-MIR3627b, mdm-MIR3627c, mdm-MIR391, mdm-MIR477b, mdm-MIR477a, mdm-MIR482b, mdm-MIR482c, mdm-MIR535a, mdm-MIR535b, mdm-MIR535c, mdm-MIR535d, mdm-MIR827, mdm-MIR828a, mdm-MIR828b, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR7121a, mdm-MIR7121b, mdm-MIR7121c, mdm-MIR7121d, mdm-MIR7121e, mdm-MIR7121f, mdm-MIR7121g, mdm-MIR7121h, mdm-MIR5225c, mdm-MIR7124a, mdm-MIR5225a, mdm-MIR5225b, mdm-MIR7125, mdm-MIR393d, mdm-MIR393e, mdm-MIR393f, mdm-MIR7127a, mdm-MIR7127b, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, mdm-MIR858, mdm-MIR3627d, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR393g, mdm-MIR393h, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
For example, we found that miR160, miR156, miR171, miR172, miR395, and miR398 were differentially expressed upon debagging, these families are predicted to be regulated by UV-B radiation in Arabidopsis and juvenile maize leaves, respectively (Zhou et al., 2007). [score:4]
AP2 (apetala2) transcription factors were the possible target genes of miR172. [score:3]
While differentially-expressed miR172 and miR398 were only present in the T1/N1 group, miR167, miR391, miR7121, and miR858 were only in the T2/N2 group, and miR535 and miR7127 only in the T3/N3 group. [score:3]
The largest miRNA family, miR156, had 29 members, followed by miR171 and miR172 with both 15 members (Figure 3). [score:1]
[1 to 20 of 4 sentences]
[+] score: 9
Other miRNAs from this paper: ppe-MIR171f, ppe-MIR394a, ppe-MIR828, ppe-MIR171h, ppe-MIR171a, ppe-MIR171e, ppe-MIR171g, ppe-MIR171b, ppe-MIR171c, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR396e, mdm-MIR828a, mdm-MIR828b, mdm-MIR159c, mdm-MIR171o, mdm-MIR858, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR159, ppe-MIR160a, ppe-MIR160b, ppe-MIR164a, ppe-MIR164b, ppe-MIR164c, ppe-MIR164d, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR171d, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR394b, ppe-MIR858, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR171p, mdm-MIR171q, mdm-MIR172p
The expression of miR172-resistant AP2 induces the formation of variable numbers of floral organs with numerous petals and lacking inner whorl organs [63, 64]. [score:3]
miR172 (Figure  5C) is crucial for development of reproductive organs and for timely termination of floral stem cells by regulating AP2 RNA stability [63]. [score:3]
Additionally, for other miRNAs (miR159, miR172, miR164, miR394, and miR160 families), we confirmed miRNA-directed cleavage in one or two Rosa cultivars (Figure  5B-F). [score:2]
According to previous studies, miR156, miR159, and miR160 are evolutionary conserved in all land plants, and miR164, and miR172 are conserved in seed-bearing plants [57]. [score:1]
[1 to 20 of 4 sentences]
[+] score: 7
Other miRNAs from this paper: sly-MIR160a, sly-MIR167a, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR172a, sly-MIR172b, sly-MIR399, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR168a, mdm-MIR168b, mdm-MIR172a, mdm-MIR172b, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, sly-MIR168a, sly-MIR168b, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR160a, ppe-MIR160b, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR168, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR399a, ppe-MIR399b, ppe-MIR399c, ppe-MIR399d, ppe-MIR399e, ppe-MIR399f, ppe-MIR399g, ppe-MIR399h, ppe-MIR399i, ppe-MIR399j, ppe-MIR399k, ppe-MIR399l, ppe-MIR399m, ppe-MIR399n, sly-MIR156d, sly-MIR156e, sly-MIR167b, sly-MIR172c, sly-MIR172d, mdm-MIR399k, mdm-MIR172p
This number was soon increased to include miR168 (inhibiting ARGONAUTE1), miR172 (inhibiting APETALA2) (Itaya et al., 2008), and miR156 (targeting CNR) (Zhang et al., 2011). [score:7]
[1 to 20 of 1 sentences]
[+] score: 6
Other miRNAs from this paper: mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR168a, mdm-MIR168b, mdm-MIR172a, mdm-MIR172b, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR319a, mdm-MIR319b, mdm-MIR390a, mdm-MIR390b, mdm-MIR390c, mdm-MIR390d, mdm-MIR390e, mdm-MIR390f, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, mdm-MIR2111a, mdm-MIR2111b, mdm-MIR3627a, mdm-MIR3627b, mdm-MIR3627c, mdm-MIR535a, mdm-MIR535b, mdm-MIR535c, mdm-MIR535d, mdm-MIR828a, mdm-MIR828b, mdm-MIR159c, mdm-MIR319c, mdm-MIR858, mdm-MIR3627d, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR399k, mdm-MIR319d, mdm-MIR319e, mdm-MIR319f, mdm-MIR319g, mdm-MIR319h, mdm-MIR172p
Although lower expression (between 1,500 and 4,000 RPM) was observed for the miR162, miR164, miR168, miR172 and miR399 families, their overall expression level was 3 to 20 times greater than any of the remaining 12 conserved miRNA families (Figure 1a; Table S3 in Additional file 1). [score:5]
For example, miR172 RPM values and blot signals for leaf and flower were in agreement, while the blot signal for fruit, which should be nearly four-fold higher than for root, based on RPM values, was barely detectable. [score:1]
[1 to 20 of 2 sentences]
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
However, miRNA156, miRNA159 and miR172 targeted more than one gene family. [score:3]
miR396, miR166, miR172, miR169 and miR395 were also present at multiple loci in date palm, and these miRNAs had the highest average copy number in the other plant species. [score:1]
In the miR164, miR172 and miR395 families, all miRNA members were involved in duplication events. [score:1]
[1 to 20 of 3 sentences]
[+] score: 4
Profiling microRNAs in Eucalyptus grandis reveals no mutual relationship between alterations in miR156 and miR172 expression and adventitious root induction during development. [score:4]
[1 to 20 of 1 sentences]
[+] score: 3
For example, wild-type potatoes grafted as stocks with scions overexpressing miR172 showed induced tuberization [15]. [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Using their precursor sequences, the 16 miRNA172 genes identified in apple [26] were clustered into four clades (Supplementary Fig.   11 ). [score:1]
No differentiated SNPs were detected in the 16 miRNA172 genes between M. domestica and M. sieversii. [score:1]
Therefore, besides the previously discovered miRNA172p [25], we identified two additional miRNA172 genes (miRNA172g and miRNA172h) that might have contributed to the increase of fruit size during Malus speciation prior to domestication. [score:1]
[1 to 20 of 3 sentences]
[+] score: 3
Also, two highly conserved microRNAs (miRNAs), miR156 and miR172 [76, 112] target SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family transcription factors, which promote the transition from the juvenile to the adult phase, in Populus [110] and key floral repressors belonging to the AP2-like transcription factor family genes [118], respectively. [score:3]
[1 to 20 of 1 sentences]
[+] score: 1
The GIGANTEA-regulated MicroRNA172 mediates photoperiodic flowering independent of CONSTANS in Arabidopsis. [score:1]
[1 to 20 of 1 sentences]