![]() |
miRBase |
![]() |
![]() |
![]() 4 publications mentioning chi-mir-182Open access articles that are associated with the species Capra hircus and mention the gene name mir-182. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary. |
|
1 |
![]()
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-21, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-200b, hsa-let-7g, hsa-mir-30b, hsa-mir-145, hsa-mir-200c, hsa-mir-200a, hsa-mir-494, chi-let-7g, chi-mir-145, chi-mir-16a, chi-mir-16b, chi-mir-183, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-21, chi-mir-29b, chi-mir-30b, chi-mir-30d, chi-mir-494, chi-mir-96
Thus, we conclude the following: miR-182 is up-regulated in the EECs during the WOI, and it induces cell apoptosis by down -regulating the expression of PTN at both mRNA and protein levels; miR-182 plays a role in the development of endometrial receptivity by down -regulating PTN levels and up -regulating or maintaining the expression levels of OPN, COX-2 and PRLR in dairy goat EECs.
[score:12]
In this study, the miR-182 mimics did not regulate the protein levels of PRLR in the EECs of dairy goats, but the miR-182 inhibitors down-regulated the levels, suggesting that miR-182 may be an essential factor to keep the expression of PRLR protein levels in the EECs of dairy goats.
[score:9]
Bcl-2 protein expression levels were decreased significantly 48 h after treatment with miR-182 mimics (P < 0.01) and 72 h (P < 0.05), and the levels were significantly up-regulated after the EECs were treated with the miR-182 inhibitors at 72 h (P < 0.05).
[score:8]
Confusingly, miR-182 inhibitors down-regulated the protein expression level of Bcl-2 at 48 h (P < 0.01) (Fig 12A).
[score:8]
WB results further indicated that PTN was down-regulated by miR-182 in dairy goats at 48 h, however, inhibition of PTN protein expression by miR-182 disappeared at 72 h. And the reasoning behind that would be miR-182 mimics used in this study was an artificially synthesized mature miRNA with a shorter effective time; thus, its function may have reduced with time.
[score:8]
We found that the COX2 protein levels were down-regulated by the miR-182 inhibitors, but the levels changed when the cells were treated with the miR-182 mimics, suggesting that miR-182 may be an essential factor to maintain the expression of COX2 protein levels in dairy goat EECs.
[score:8]
Thus, we inferred that miR-182 may participate in regulating dynamic changes in goat uterine gene expression patterns via down-regulated PTN.
[score:7]
Our previous sequencing data indicated that miR-182 expression was increased 15.55-fold in the receptive endometrium (RE, D15) compared with the pre-receptive endometrium (PE, D5) in dairy goats [30], and its predicted target gene, PTN, was down-regulated 20.97-fold [31].
[score:7]
After confirming the increase of miR-182 and the low abundance of PTN mRNA in the RE of healthy multiparous dairy goats, the psiCHECKTM-2 reporter plasmid, RT-qPCR, and Western blotting (WB) were used to confirm that miR-182 down-regulated the expression of PTN in EECs of dairy goats.
[score:6]
In dairy goats, the VEGF protein levels were down-regulated by the miR-182 mimics, and the miR-182 inhibitors increased VEGF levels in the EECs.
[score:6]
We verified for the first time that miR-182 induced EEC apoptosis by directly targeting the 3’ untranslated region of PTN.
[score:6]
miR-182 down-regulated the expression level of PTN via the 3′ UTR.
[score:6]
Therefore, we hypothesized that miR-182 down-regulates the expression of PTN in the endometrial cells of dairy goats.
[score:6]
To explore the role of miR-182 in EECs, miR-182 mimics and inhibitors were used to perform miR-182 overexpression or knockdown, respectively.
[score:6]
To determine whether miR-182 directly targets goat PTN through the predicted binding sites in the PTN 3′ UTR, the full-length 3′ UTR-containing miR-182 targeted sites were cloned and inserted downstream of the luciferase gene in the psiCHECKTM-2 reporter plasmid, and the mutated plasmids were constructed by inserting PTN-3′ UTR with the mutated miR-182 binding site (Fig 9A and 9B).
[score:6]
Importantly, the predicted target site is also conserved, and miR-182 was found to directly target goat PTN through its 3′-UTR sequence.
[score:6]
Overall, this study has shown that miR-182 is wi dely expressed in different tissues in dairy goats and that the expression levels are regulated by E2 and P4 in EECs.
[score:6]
However, the miR-182 inhibitors had no effect on the mRNA expression levels at 24 h and 48 h (P > 0.05).
[score:5]
Human PTN was predicted to be the target of miR-182 based on the information from Targetscan (www.
[score:5]
The adherent cells were cotransfected with 0.5 μg of luciferase reporter and miR-182 mimics, miR-182 inhibitors, NC, or NC inhibitors (100 nM).
[score:5]
In the present study, miR-182 decreased the expression of total AKT protein levels at both the 48 h and 72 h time points, and the miR-182 inhibitors increased the levels at 72 h (Fig 11A).
[score:5]
0179783.g006 Fig 6 The cell cycle analysis of EEC were made after the cells were transfected with miR-182 mimic (A); NC (B); miR-182 inhibitor (C); NC inhibitor (D).
[score:5]
In this study, we found that the miR-182 mimics increased the Caspase-3 protein levels at 48 h, and miR-182 inhibitors decreased the levels of Caspase-3. Furthermore, Schulte reported a retroviral SP1 binding site in the PTN promoter is important for the expression in human choriocarcinoma cells [115].
[score:5]
In this study, EECs treated with the miR-182 mimics exhibited an obvious decrease in SP1 expression after 72 h. This result suggested that miR-182 may regulate SP1, but the specific molecular regulation mechanism needs further study.
[score:5]
Furthermore, the expression levels of miR-182 in various tissues of dairy goats were studied, and miR-182 was found to be wi dely expressed in different tissues at both biophysical stages.
[score:5]
We found that miR-182 decreased the expression of total AKT protein levels both at 48 h (P < 0.05) and 72 h (P < 0.05), and the miR-182 inhibitors increased AKT levels at 72 h (P < 0.05, Fig 11A).
[score:5]
The miR-182 mimics decreased VEGF protein levels in EECs at 48 h (P < 0.05) but not at 72 h (P > 0.05), and the miR-182 inhibitors increased VEGF protein levels at 72 h but not 48 h (Fig 13B), suggesting that the miR-182 mimics and inhibitors exert their effects on different timelines.
[score:5]
0179783.g007 Fig 7 The cell apoptosis analysis of EEC were made after the cells were transfected with miR-182 mimic (A); NC (B); miR-182 inhibitor (C); NC inhibitor (D).
[score:5]
And the result showed that overexpression of miR-182 dramatically decreased the mRNA levels of PTN at 48 h; in contrast, miR-182 inhibition increased PTN levels in EECs.
[score:5]
The wild-type (psiCHECK-PTN-UTR-WT) or mutated (psiCHECK-PTN-UTR-Mut) plasmids were co -transfected with either the miR-182 mimics, miR-182 inhibitors, NC, or NC -inhibitors into HEK293T cells.
[score:5]
The cell apoptosis analysis of EEC were made after the cells were transfected with miR-182 mimic (A); NC (B); miR-182 inhibitor (C); NC inhibitor (D).
[score:5]
EEC cells were plated at a density of 7.5×10 [5] in 6-well plates, seventy percent confluent cells were transfected with miR-182, miR-182 inhibitors, NC, and NC -inhibitors at final concentrations of 100 nM using the X-tremeGENE siRNA Transfection Reagent (Roche, Switzerland) according to the manufacturer′s protocols.
[score:5]
In this study, we found that the miR-182 mimics increased the Caspase-3 protein levels at 48 h, and miR-182 inhibitors decreased the levels of Caspase-3. Furthermore, Schulte reported a retroviral SP1 binding site in the PTN promoter is important for the expression in human choriocarcinoma cells [115].
[score:5]
The expression levels of FAS were not affected in miR-182 inhibitors -treated EECs at 48 h (P < 0.01).
[score:5]
Briefly, the cells were seeded in 96-well plates at a density of 2×10 [3] cells/well; the cells were transfected with miR-182, miR-182 inhibitors, NC, and NC inhibitors, and then were incubated at 37°C in a 5% CO [2] incubator for 24 h after the cells adhered to the plate; and then the MTT reagent (0.5 mg/mL) were added into 96-well plates and incubated for 4h.
[score:5]
The cell cycle analysis of EEC were made after the cells were transfected with miR-182 mimic (A); NC (B); miR-182 inhibitor (C); NC inhibitor (D).
[score:5]
We transfected EECs with a miR-182 mimics, miR-182 inhibitors, NC (negative control), or NC -inhibitors at a cell density of 80–90% using Lipofectamine 2000.
[score:5]
miR-182 regulates the expression of PTN-related genes.
[score:4]
We further investigated whether miR-182 down-regulated the expression levels of PTN in EECs of dairy goats.
[score:4]
In addition, miR-182 may be an essential factor for the regulation of the expression of OPN, COX2 and PRLR protein levels in dairy goat EECs.
[score:4]
After confirming the high abundance of miR-182 and low levels of PTN mRNA in the RE of goats, we further investigated if miR-182 down-regulates the expression levels of PTN in EECs.
[score:4]
The miR-182 levels were down-regulated when the cells were treated with combination of E2 and P4 (Fig 3).
[score:4]
Moreover, it is known that miR-182 up-regulated in various cancer type [16, 80, 81], striking similarities are present between the behavior of placental cells during the WOI and that of cancer cells [82].
[score:4]
Several studies have reported that miR-182 up-regulated in various cancer types, including prostate cancer [15, 16], glioblastoma [12], hepatocellular carcinoma [17].
[score:4]
What’s more, miR-182 could promote cellular differentiation by regulating the expression of snail family transcriptional repressor 2 (SNAI2) and induce the mesenchymal-to-epithelial transition [18].
[score:4]
Therefore, we inferred that miR-182 may participate in regulating dynamic changes in goat uterine gene expression patterns that occur during the transition from the pre-receptive to the receptive phase.
[score:4]
miR-182 regulates PTN expression in EECs.
[score:4]
The OPN protein levels were up-regulated at both 48 h and 72 h (P < 0.05) in miR-182 mimics -treated EECs.
[score:4]
No statistical differences were found in COX-2 levels between the miR-182 mimics and NC in EECs at either 48 h or 72 h (P > 0.05), but COX-2 expression levels in the EECs were significantly decreased 48 h and 72 h after treatment with the miR-182 inhibitors compared with NC (P < 0.05).
[score:4]
miR-182 down-regulated the PTN in endometrial epithelium cells (EECs).
[score:4]
miR-182 regulates the expression of endometrial receptivity marker genes.
[score:4]
In his study, an MTT assay showed that the miR-182 mimics inhibited and miR-182 inhibitors promoted the proliferation of EECs (Fig 5), although the differences were not significant (P > 0.05).
[score:4]
Furthermore, the upstream proteins of Bcl-2, MAPK (p44/42) and p-MAPK (p44/42), were also monitored by WB, and these results showed that miR-182 decreased the total MAPK levels at 72 h. Because of their key role in cell signalling, a rigorous regulation of MAPKs is essential in eukaryotic physiology [105], p-MAPKs target different downstream effectors that lead to changes in transcriptional programs [106].
[score:4]
miR-182 regulates AKT expression in EECs.
[score:4]
In this study, MTT assay (3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide) showed that miR-182 mimics inhibited cell proliferation and miR-182 inhibitors promoted cell proliferation, but the differences were not statistically significant in EEC cells (Fig 5).
[score:4]
Thus, we proposed that the expression of Bcl-2 family proteins may be altered under miR-182 conditions in EECs.
[score:3]
miR-182 was first identified as a retina-specific miRNA, with its expression abundantly increasing postnatally and reaching the peak in adult retina [14].
[score:3]
Therefore, changes in OPN, VEGF, COX-2 and PRLR protein levels were investigated in EECs after they were treated with miR-182 mimics, miR-182 inhibitors, NC (negative control), or NC -inhibitors.
[score:3]
The present study shows that miR-182 is wi dely expressed in different tissues in dairy goats, and the levels vary in association with the concentrations of E2 and P4 in EECs.
[score:3]
The effect of E2/P4 on the expression levels of miR-182 in EEC.
[score:3]
Expression levels of miR-182 in endometrium at D5 and D15.
[score:3]
The expression of miR-182 in dairy goats.
[score:3]
Thus, the induction of miR-182 may be a critical event for the development of endometrial receptivity, and this induction may be regulated by E2 and P4.
[score:3]
The miR-182 mimics increased the protein expression levels of FAS in EECs at 48 h (P < 0.01) and 72 h (P < 0.05) (Fig 12D).
[score:3]
The effect of E2/P4 on the expression levels of miR-182 in EECs.
[score:3]
Based on the above information, the EEC surface morphology was observed by scanning electron microscopy after the cells were transfected with a miR-182 mimics or inhibitors in this study.
[score:3]
Furthermore, the protein levels of Bcl-2, FAS, MAPK, Caspase-3, SP1, and other marker genes of endometrial receptivity (OPN, VEGF, COX-2, PRLR) were analyzed in EECs that were treated with a miR-182 mimics or inhibitors.
[score:3]
We screened target genes for miR-182 using microRNA.
[score:3]
The expression of total MAPK and p-MAPK proteins were detected, and these data showed that miR-182 decreased the MAPK protein levels in EECs at 72 h (Fig 12B).
[score:3]
The apoptosis rate of EECs treated with a scrambled miR-182 mimics was 15.76%, and this rate decreased to 7.58% upon treatment with miR-182 inhibitors, suggesting that miR-182 induces EEC apoptosis in this study.
[score:3]
In the present study, we found lower levels of BCL-2 protein in the miR-182 -treated EECs, suggesting that miR-182 might induce EEC apoptosis by decreasing Bcl-2 expression.
[score:3]
Thus, cell proliferation, cell cycle and apoptosis events of EECs were also analyzed after treatment with a miR-182 mimics or inhibitors.
[score:3]
Furthermore, EECs treated with a miR-182 inhibitors became round, the microvilli on the surface of the cell membrane disappeared, and the cell membrane sprouted and formed apoptotic bodies.
[score:3]
Notably, the expression levels of FAS increased in miR-182 treated EECs at protein levels in dairy goats.
[score:3]
Primer sequences(5′→3′) GADPH AF_030943.1 F: GCAAGTTCCACGGCACAG R: GGTTCACGCCCATCACAA PTN XM_005679509.1 F: TCTCCATTTCCCTTCCTTCC R: TCTCTCTCCACTTCGGCTTT PTN XM_005679509.1F: GC CTCGAGGACCGTGAAAAGGACATCR: GC GCGGCCGCCAGCATCACCTTGATTTA 18S / F: GTGGTGTTGAGGAAAGCAGACA R: TGATCACACGTTCCACCTCATC U6 / F: CTCGCTTCGGCAGCACA R: AACGCTTCACGAATTTGCGT miR-182-Loop / gtcgtatccagtgcagggtccgaggtattcgcactggatacgacAGTGTGAG miR-182-FW / ggTGAAAAGTTCGTTCGG Reverse Primer / GTGCAGGGTCCGAGGT Note: the underscore characters were restriction enzyme cutting site of xho І and not І. A mature miR-182 mimics (5’-TTTGGCAATGGTAGAACTCACACT-3’) and inhibitors (5’-AGUGUGAGUUCUACCAUUGCCAAA-3’), a nonspecific control (NC) and NC -inhibitors were synthesized by GenePharma (Shanghai, China).
[score:3]
In the present study, the expression level of miR-182 in the PE was remarkably higher than that in the RE (Fig 2), which was inconsistent with the previous sequencing data [30].
[score:3]
Further study showed that miR-182 displayed a diurnal variation in the retina of mice, revealed its role in retina development and the regulation of mammalian circadian rhythm [69].
[score:3]
After being treated with miR-182 mimics or miR-182 inhibitors for 48 h, EEC cells were collected and incubated with Annexin V-FITC and PI at room temperature for 5 min in the dark.
[score:3]
The effect of E2 and P4 on the expression levels of miR-182 in endometrial epithelium cells (EECs).
[score:3]
What’s more, miR-182 is demonstrated to function either as a tumor suppressor or an oncomir in various human cancers [12, 17, 70].
[score:3]
Furthermore, miR-182 also decreased p-AKT protein levels at 48 h (P < 0.05), and the miR-182 inhibitors increased p-AKT levels at both 48 h (P < 0.05) and 72 h (P < 0.05, Fig 11B).
[score:3]
The results showed that miR-182 expression level in the RE was higher (Fig 1) than that in the PE using either reference, which was inconsistent with previous sequencing data.
[score:3]
Meanwhile, miR-182 decreased the p-AKT protein levels at 48 h, and the miR-182 inhibitors increased the levels at both 48 h and 72 h (Fig 11B).
[score:3]
We confirmed the high abundance of miR-182 and the lower levels of PTN in the receptive endometrium of goats and miR-182 directly regulates PTN through its 3′UTR.
[score:3]
However, cells treated with miR-182 inhibitors became significantly shrinked and gradually became round shape with poorly adhesion (Fig 4).
[score:3]
In addition, an Annexin V-FITC/PI assay combined with flow cytometry 48 h after transfection with miR-182 mimics or inhibitors, NC or NC- inhibitors showed increased apoptosis of EECs (Fig 7A–7D) upon treatment with the miR-182 mimics compared with NC.
[score:3]
This result suggested that the expression levels of miR-182 were affected by sex hormones in EECs.
[score:3]
In addition, miR-182 inhibitors did not affect SP1 protein levels at either the 48 h or 72 h time points in EECs.
[score:3]
However, cells treated with a miR-182 inhibitors became round, the microvilli on the surface of the cell membrane disappeared, and the cell membrane sprouted (buds) and formed apoptotic bodies (Fig 4).
[score:3]
The contours of miR-182 mimic -transfected EEC cells are clear and microvilli regularly distributed on the surface; after the EEC cells were transfected with miR-182 inhibitor, cells became significantly shrinked and gradually became round shape with poorly adhesion.
[score:3]
The miR-182 inhibitors decreased Caspase-3 levels at 48 h (P < 0.05) and 72 h (P < 0.05).
[score:3]
miR-182 was expressed in various tissues of dairy goats.
[score:3]
The expression levels of miR-182 were significantly enhanced with the constituents of E2, and the highest level was 10 nM in this study.
[score:3]
Surprisingly, both the miR-182 mimics and inhibitors increased the p-MAPK levels at 48 h (P < 0.01) and decreased at 72 h (P < 0.05, Fig 12C).
[score:3]
The expression levels of miR-182 were significantly enhanced in a concentration -dependent manner, with the highest level observed in the presence of P4 alone with 1 nM.
[score:3]
In addition, an Annexin V-FITC/PI assay combined with flow cytometry 48 h after transfection with miR-182 mimics, miR-182 inhibitors, NC or NC -inhibitors showed that EEC apoptosis (Fig 7) increased upon the introduction of miR-182 mimics compared with NC.
[score:3]
This study is the first to our knowledge that the expression levels of miR-182 are affected by sex hormones in the EECs of dairy goats.
[score:3]
miR-182 directly regulates PTN through its 3′ UTR.
[score:3]
miR-182 affects the expression of apoptosis-related genes.
[score:3]
And the results showed that there was a target site for miR-182 in the 3′UTR PTN of mRNA.
[score:3]
Furthermore, this study showed extensive expression of miR-182 in other tissues, especially in the kidney at D5 and oviduct at D15.
[score:3]
Furthermore, the miR-182 inhibitors decreased PRLR protein levels at 72 h (P < 0.05) in EECs (Fig 13D), but no significant difference in PRLR protein level was found with the mimics (P > 0.05).
[score:3]
Thus, we detected the protein levels of OPN in EECs and found that miR-182 significantly increased OPN protein levels in EECs, and the levels decreased after treatment with the miR-182 inhibitors.
[score:3]
In addition, miR-182 inhibitors decreased OPN levels at 48 h and 72 h (P < 0.05, Fig 13A).
[score:3]
The wild-type (psiCHECK-PTN-WT) or mutated (psiCHECK- PTN-UTR-Mut) plasmid was co -transfected with the miR-182 mimics or inhibitors into 293T cells.
[score:3]
The apoptosis rate of EECs treated with the scrambled miR-182 mimics was 15.76%, and the apoptosis rate decreased to 7.59% when treated with the miR-182 inhibitors.
[score:3]
These results confirm that miR-182 targets goat PTN.
[score:3]
0179783.g004 Fig 4 The contours of miR-182 mimic -transfected EEC cells are clear and microvilli regularly distributed on the surface; after the EEC cells were transfected with miR-182 inhibitor, cells became significantly shrinked and gradually became round shape with poorly adhesion.
[score:3]
Nevertheless, the transcriptional regulation of miR-182 as well as its role in EECs during WOI is not clear.
[score:2]
miR-182 regulates proliferation, cell cycle, and apoptosis in EECs.
[score:2]
Total RNAs were extracted and stem-loop qRT-PCR was used to validate the expression levels of miR-182 compared with the 18S rRNA and U6 reference controls in the dairy goat endometrium.
[score:2]
The nucleotides in red represented “seed sequence” of miR-182, the mutation nucleotides were in yellow color.
[score:2]
0179783.g010 Fig 10 (A) miR-182 down-regulated the PTN mRNA levels in EEC, PTN mRNA levels were measured by RT-qPCR and normalized to GAPDH.
[score:2]
After co-transfection with the plasmids, the luciferase activity of the miR-182 group was significantly lower than that of the NC group (P < 0.01) after 48 h after transfection, and this reduction was rescued in the mutation groups (Fig 9C).
[score:2]
Our previous study indicated that miR-182 was a differentially expressed miRNA and had a 15.55-fold increase in the receptive endometrium (RE) compared with the pre-receptive endometrium (PE) in dairy goats [30].
[score:2]
PTN protein levels were significantly decreased in miR-182 -transfected cells compared with NC at both 48 h and 72 h (P < 0.05), and miR-182 inhibitors significantly increased PTN levels in EECs at 48 h (P < 0.01) but not at 72 h (P > 0.05).
[score:2]
2015; 5. 17 Du C, Weng X, Hu W, Lv Z, Xiao H, Ding C, et al Hypoxia-inducible MiR-182 promotes angiogenesis by targeting RASA1 in hepatocellular carcinoma.
[score:2]
miR-182 regulated cell proliferation, cycle and apoptosis of EEC.
[score:2]
Our previous sequencing data have indicated that miR-182 is a differentially expressed miRNA with a 15.55-fold increase in the RE compared with the PE of dairy goats [30].
[score:2]
miR-182 regulates the phosphorylation of AKT.
[score:2]
0179783.g003 Fig 3 The effect of E2 and P4 on the expression levels of miR-182 in EEC were measured by Stem-loop RT-qPCR and normalized to 18S.
[score:1]
The effect of miR-182 on the cell apoptosis of endometrial epithelium cells (EECs).
[score:1]
Thus, the protein levels of Bcl-2, FAS, MAPK, Caspase-3, and SP1 were detected in the EECs treated with miR-182.
[score:1]
The miR-182 mimics increased the Caspase-3 protein levels at both 48 h (P < 0.05) and 72 h (P > 0.05) in EECs (Fig 12E).
[score:1]
This result suggested that miR-182 may be indispensable for the establishment of endometrial receptivity in dairy goats.
[score:1]
miR-182 affected the surface microtopography of EEC.
[score:1]
To determine whether the anti-proliferative effect of miR-182 was due to cell cycle disruption, flow cytometry was used to analyze changes in the cell cycle.
[score:1]
The effect of miR-182 on some marker protein of endometrial receptivity in endometrial epithelium cells (EECs).
[score:1]
The mRNA levels of PTN significantly decreased at both 24 h (P < 0.01) and 48 h (P < 0.05) after the EEC was transfected with the miR-182 mimics (Fig 10A).
[score:1]
Together with its family members (miR-96 and miR-183), miR-182 was described in mouse neurosensory cells, specifically in the retina, inner ear, and dorsal root ganglia [12– 14].
[score:1]
The distribution of cells in the different phases of the cell cycle did not significantly change following miR-182 exposure in EECs (Fig 6), suggesting that miR-182 did not cause EEC cell cycle arrest under the conditions described.
[score:1]
The effect of miR-182 on the surface microtopography of endometrial epithelium cells (EECs).
[score:1]
miR-182 may participate in the formation of endometrial receptivity.
[score:1]
The present report for the first time studies the effect of miR-182 on apoptosis-related proteins (Bcl-2, FAS, and Caspase-3) in the EECs of dairy goats.
[score:1]
The effect of miR-182 on the surface morphology of EEC was detected by SEM (Scanning Electron Microscopy) [38].
[score:1]
The miR-182 levels in endometrium at D5 and D15 were detected by stem-loop qRT-PCR, 18S rRNA (A) and U6 (B) were used as the references.
[score:1]
The above results suggest that, and we sought to analyze AKT protein levels after the cells were treated with miR-182.
[score:1]
On the surface of cells treated with miR-182, we observed microridges with uniform and regularly-distributed microvilli.
[score:1]
The effect of miR-182 on the cell cycle of endometrial epithelium cells (EECs).
[score:1]
The effect of miR-182 on the surface morphology of EECs.
[score:1]
The effect of miR-182 on AKT and p-AKT levels in endometrial epithelium cells (EECs).
[score:1]
This study suggested that miR-182 induced EECs apoptosis.
[score:1]
Furthermore, the miR-182 mimics decreased SP1 protein levels at 48 h (P < 0.05) in EECs (Fig 12F), but the difference was not significant at 72 h (P > 0.05).
[score:1]
To investigate the response of miR-182 expression levels on sex hormones in EECs, β-estradiol (E2) and progesterone (P4) were diluted in cell medium to different concentrations.
[score:1]
0179783.g001 Fig 1 The miR-182 levels in endometrium at D5 and D15 were detected by stem-loop qRT-PCR, 18S rRNA (A) and U6 (B) were used as the references.
[score:1]
The effect of miR-182 on PTN-related protein levels in endometrial epithelium cells (EECs).
[score:1]
Stem-loop qPCR was used to detect the transfection efficiency of miR-182 in this study [34].
[score:1]
On the surface cells treated with mimics of miR-182, microridges with uniform and regularly distributed microvilli were observed.
[score:1]
The DNA contents of miR-182 -treated or control NC cells were quantitated for cell cycle analysis.
[score:1]
To investigate the response of miR-182 expression levels to sex hormones in EECs, E2 and P4 were diluted in cell medium to different concentrations.
[score:1]
The highest level of miR-182 was observed after treatment with 1 nM P4.
[score:1]
The effect of E2 and P4 on the expression levels of miR-182 in EEC were measured by Stem-loop RT-qPCR and normalized to 18S.
[score:1]
The effect of miR-182 on the proliferation of endometrial epithelium cells (EECs).
[score:1]
To determine whether the anti-proliferative effect of miR-182 is due to cell cycle disruption, flow cytometry was used to analyze the changes in the cell cycle in EECs.
[score:1]
The distribution of cells in the different phases of the cell cycle did not significantly change after miR-182 exposure in EECs (Fig 6), suggesting that miR-182 does not cause EEC cell cycle arrest under the conditions described.
[score:1]
[1 to 20 of 155 sentences]
|
2 |
![]()
Other miRNAs from this paper: chi-mir-10a, chi-mir-154b, chi-mir-183, chi-mir-184, chi-mir-187, chi-mir-200a, chi-mir-26a, chi-mir-429, chi-mir-449a, chi-mir-449b, chi-mir-449c
One miRNA can target multiple genes, for example, 1,030 annotated mRNA transcripts were predicted as putative targets for hsa-miR-449a, which the most differentially expressed miRNA, and 756 putative targets for bta-miR-182 (Table 7).
[score:9]
Further study suggested that miRNA-182 binds directly to a conserved 8 bp sequence in the 3’-UTR of its target gene transcription elongation factor A-like 7 (TCEAL7), and then promots cell proliferation by targeting the tumor suppressor gene TCEAL7 and modulating the activity of its downstream effectors c-Myc, cyclin D1 and NFκB in EC cell lines compared with normal endometrial epithelial cells [51].
[score:7]
In addition, five known miRNAs (miR-449a, miR-182, miR-187-3p_R+1, miR-183-_L-1, miR-200a-5p) were detected by stem-loop qRT-PCR because they highly and differently expressed between P and R libraries in this study.
[score:3]
Studies have identified that miR-182 was significantly up-regulated in endometrial carcinoma tissues (EC) compared with complex atypical hyperplasia, simple hyperplasia and normal endometrial tissues [48– 50].
[score:3]
Moreover, bta-miR-182 had the high expression level (NE = 3518.63) and increased 14.55-fold in R library compare with P library (Table 7).
[score:3]
Five conserved miRNAs (miR-449a, miR-182, miR-200a-5p, miR-187-3p_R+1, miR-183_L-1, miR-216a_R-2 and miR-431_R-3) and ten potential novel miRNAs (PC-5p-6424_145, PC-5p-2673_284, PC-5p-5933_158 PC-5p-20799_45, PC-5p-35677_26, PC-3p-25064_36, PC-3p-82208_8, PC-5p-108241_6, PC-5p-26648_38 and PC-3p-215602_2) were selected due to these miRNAs differential expression between R and P libraries, and may participate in the formation of endometrial receptivity.
[score:3]
In addition, bta-miR-182 aroused our interest for it was the highest expressed miRNA in receptive endometrium (NE = 3518.63) and increased 14.55-fold compare with pre-receptive endometrium.
[score:3]
The expression levels of twelve miRNAs (miR-449a, miR-182, miR-183, miR-187, PC-5p-5933_158, PC-5p-2673_284 and PC-5p-6424_145, PC-5p-20799_45, PC-5p-35677_26, PC-3p-25064_36, PC-3p-82208_8, and PC-5p-108241_6) in the receptive endometrium determined by Solexa deep sequencing or qRT-PCR were higher than those in pre-receptive endometrium (Fig 8).
[score:3]
The top five key miRNAs in the network were miR-449a, miR-182, PC-5p-6424_145, PC-5p-2673_284, and miR-138-5p.
[score:1]
[1 to 20 of 9 sentences]
|
3 |
![]()
Other miRNAs from this paper: ssc-mir-205, ssc-let-7f-1, bta-mir-26a-2, bta-let-7f-2, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-92a-2, bta-mir-10b, bta-mir-30a, bta-let-7f-1, bta-mir-137, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-182, bta-mir-202, bta-mir-211, bta-mir-26a-1, bta-mir-92a-1, bta-mir-1307, bta-mir-181a-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, ssc-mir-143, ssc-mir-10b, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-1307, ssc-mir-202, ssc-mir-146a, ssc-let-7f-2, ssc-mir-137, ssc-mir-182, chi-let-7f, chi-mir-10b, chi-mir-1307, chi-mir-137, chi-mir-143, chi-mir-146a, chi-mir-146b, chi-mir-202, chi-mir-211, chi-mir-27b, chi-mir-30a, chi-mir-92a
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels.
[score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels.
[score:5]
[1 to 20 of 2 sentences]
|
4 |
![]()
Other miRNAs from this paper: chi-let-7f, chi-let-7i, chi-mir-143, chi-mir-145, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-194, chi-mir-195, chi-mir-200b, chi-mir-21, chi-mir-23a, chi-mir-26a, chi-mir-27b, chi-mir-29c, chi-mir-335, chi-mir-34a, chi-mir-592, chi-mir-7, chi-mir-92b
In this study, differentially expressed miRNAs such as miR-182 (Kim et al., 2012), miR-23a (Wang et al., 2012), and miR-195-3p (Chen et al., 2011) were reported to mainly take part in the regulation of cell proliferation, differentiation, and apoptosis.
[score:4]
miR-182 is a negative regulator of osteoblast proliferation, differentiation, and skeletogenesis through targeting FoxO1.
[score:4]
[1 to 20 of 2 sentences]
|