sort by

6 publications mentioning chi-mir-196a

Open access articles that are associated with the species Capra hircus and mention the gene name mir-196a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 12
confirmed the down-regulation of 8 miRNAs (novel-miR-51, novel-miR-99, miR-30d, miR-574, miR-222, miR-196a, miR-3613a, and miR-27a-5p) and the up-regulation of 4 miRNAs (novel-miR-75, miR-1246, miR-2478, and miR-2904) in infected MDBK cells compared with the uninfected (Figure 4A). [score:6]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
[1 to 20 of 3 sentences]
2
[+] score: 9
For example, 22 continuously down-regulated miRNAs (e. g. miR-196a/b) across all sampled stages were significantly enriched into Profile 0 (Fig 5), whereas the miRNAs showing gradually increasing expression (miR-1/miR-133a-3p/miR-133a-5p) did not cluster significantly. [score:6]
In addition, miR-196a/b was continuously expressed until fetal day 45, when it started to decrease. [score:3]
[1 to 20 of 2 sentences]
3
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
4
[+] score: 5
In addition, seven known (miR-99a-3p, miR-188-5p, miR-196a-5p, miR-204-5p, miR-222-3p, miR-223-3p and miR-494-3p) and six predicted miRNA (chr3_4386-3p, chr3_4386-5p, chr12_17655-3p, chr19_26739-5p, chr23_30758-5p and chr27_34538-5p) were expressed at moderate levels with normalized read counts of between 100 and 1,000, and three known (miR-223-5p, miR-541-5p and miR-671-5p) and five predicted (chr3_3319-5p, chr4_6064-5p, chr9_13534-5p, chr12_18027-5p and chr23_30758-5p) were weakly expressed with normalized read counts below 100. [score:5]
[1 to 20 of 1 sentences]
5
[+] score: 5
Previous studies have identified a few miRNAs and revealed their function in HF morphogenesis and development, such as miR-214, miR-21, miR-24 and miR-196a [22– 24]. [score:2]
Among these miRNAs, miR-214-3p, miR-196a and miR-34c-5p had been reported with HF development and cycling functions [20, 24, 32]. [score:2]
We found that miR-214 and miR-196a might also play an important role in HF cycling of cashmere goat. [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 4
Moreover, miR-200b and miR-196a have been implicated in the control of HF development as potential targets for the Wnt signalling pathway [14]. [score:4]
[1 to 20 of 1 sentences]