miRBase entry: cel-lin-4

Stem-loop cel-lin-4


Accession
MI0000002
Description
Caenorhabditis elegans cel-lin-4 precursor miRNA lin-4
Gene
family?
RF00052; lin-4

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. Cel-lin-4, a microRNA from Caenorhabditis elegans, exhibits high expression levels in young adult hermaphrodites, although these levels are influenced by the age of the adult [PMC3282659]. It is utilized as a normalization control in RNA isolation from serum due to its consistent detection in qRT-PCR assays [PMC3854222], [PMC4648542]. Specifically, 6 μL of 1 nM cel-lin-4 are added to serum samples during RNA isolation to ensure accurate normalization [PMC4951333]. Additionally, cel-lin-4 is employed as a negative control in assays due to its absence of expression in human tissues [PMC2383925], and it is used alongside other negative controls such as ath-mir159a and cel-miR-2 for validating the specificity of miRNA detection assays [PMC1874652]. The relative expression levels of other miRNAs, such as miRNA-29c, are normalized against cel-lin-4 using a logarithmic equation based on threshold cycle (Ct) differences [PMC3696003]. Despite its use for normalization purposes, no significant differences were observed in the raw Ct values of cel-lin-4 among different groups (AIH, CHC, and control) when recombinant cel-lin-4 was added to samples; hence cel-miR39 was used instead for normalization in these cases [PMC4648542]. The expression levels of miRNAs are calculated using the 2−ΔΔCt method where ΔΔCt represents the normalized Ct differences relative to controls or calibrators [PMC5641166].

Literature search
305 open access papers mention cel-lin-4
(952 sentences)

Sequence

1608162 reads, 4478.0 reads per million, 91 experiments
augcuuccggccuguUCCCUGAGACCUCAAGUGUGAguguacuauugaugcuucACACCUGGGCUCUCCGGGUACCaggacgguuugagcagau
.((((((((.((((..(((.((((.((((.(((((((.((((....).)))))))))).)))).)))).)))...)))).)))...)))))...

Structure
--a     ---   g    -uU   U    C    A       u   - u 
   ugcuu   ccg ccug   CCC GAGA CUCA GUGUGAg gua c a
   |||||   ||| ||||   ||| |||| |||| ||||||| ||| |  
   acgag   ggc ggaC   GGG CUCU GGGU CACAcuu cgu g u
uag     uuu   a    CAU   C    C    C       -   a u 


Annotation confidence High
Do you think this miRNA is real?
Comments
lin-4 is found on chromosome II in Caenorhabditis elegans [1] and is complementary to sequences in the 3' untranslated region (UTR) of lin-14 mRNA. lin-4 acts to developmentally repress the accumulation of lin-14 protein. This repression is essential for the proper timing of numerous events of Caenorhabditis elegans larval development [2].

Genome context
chrII: 5902254-5902347 [+]

Database links

Mature cel-lin-4-5p

Accession MIMAT0000002
Description Caenorhabditis elegans cel-lin-4-5p mature miRNA
Sequence 16 - UCCCUGAGACCUCAAGUGUGA - 36
Evidence experimental
cloned [1,3-4], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

Mature cel-lin-4-3p

Accession MIMAT0015092
Description Caenorhabditis elegans cel-lin-4-3p mature miRNA
Sequence 55 - ACACCUGGGCUCUCCGGGUACC - 76
Evidence experimental
CLIPseq [7]
Database links

References

  1. PubMed ID: 11679671
    An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans
    "Lau NC, Lim LP, Weinstein EG, Bartel DP"
    "Science (2001) 294:858-862

  2. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  3. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  4. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  5. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  6. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  7. PubMed ID: 10642801
    The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation
    "Olsen PH, Ambros V"
    "Dev Biol (1999) 216:671-680