Accession
MI0000002
Description
Caenorhabditis elegans
cel-lin-4 precursor miRNA lin-4
Gene
family?
family?
RF00052;
lin-4
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Cel-lin-4, a microRNA from Caenorhabditis elegans, exhibits high expression levels in young adult hermaphrodites, although these levels are influenced by the age of the adult [PMC3282659]. It is utilized as a normalization control in RNA isolation from serum due to its consistent detection in qRT-PCR assays [PMC3854222], [PMC4648542]. Specifically, 6 μL of 1 nM cel-lin-4 are added to serum samples during RNA isolation to ensure accurate normalization [PMC4951333]. Additionally, cel-lin-4 is employed as a negative control in assays due to its absence of expression in human tissues [PMC2383925], and it is used alongside other negative controls such as ath-mir159a and cel-miR-2 for validating the specificity of miRNA detection assays [PMC1874652]. The relative expression levels of other miRNAs, such as miRNA-29c, are normalized against cel-lin-4 using a logarithmic equation based on threshold cycle (Ct) differences [PMC3696003]. Despite its use for normalization purposes, no significant differences were observed in the raw Ct values of cel-lin-4 among different groups (AIH, CHC, and control) when recombinant cel-lin-4 was added to samples; hence cel-miR39 was used instead for normalization in these cases [PMC4648542]. The expression levels of miRNAs are calculated using the 2−ΔΔCt method where ΔΔCt represents the normalized Ct differences relative to controls or calibrators [PMC5641166].
Literature search
49 open access papers mention cel-lin-4
(381 sentences)
(381 sentences)
Sequence
348252
reads,
1877
reads per million, 15 experiments
augcuuccggccuguUCCCUGAGACCUCAAGUGUGAguguacuauugaugcuucACACCUGGGCUCUCCGGGUACCaggacgguuugagcagau
.((((((((.((((..(((.((((.((((.(((((((.((((....).)))))))))).)))).)))).)))...)))).)))...)))))...
.((((((((.((((..(((.((((.((((.(((((((.((((....).)))))))))).)))).)))).)))...)))).)))...)))))...
Structure
--a --- g -uU U C A u - u ugcuu ccg ccug CCC GAGA CUCA GUGUGAg gua c a ||||| ||| |||| ||| |||| |||| ||||||| ||| | acgag ggc ggaC GGG CUCU GGGU CACAcuu cgu g u uag uuu a CAU C C C - a u
Annotation confidence
Medium
Do you think this miRNA is real?
Comments
lin-4 is found on chromosome II in Caenorhabditis elegans [1] and is complementary to sequences in the 3' untranslated region (UTR) of lin-14 mRNA. lin-4 acts to developmentally repress the accumulation of lin-14 protein. This repression is essential for the proper timing of numerous events of Caenorhabditis elegans larval development [2].
Genome context
chrII: 5902254-5902347 [+]
Database links
Mature cel-lin-4-5p
| Accession | MIMAT0000002 |
| Description | Caenorhabditis elegans cel-lin-4-5p mature miRNA |
| Sequence | 16 - UCCCUGAGACCUCAAGUGUGA - 36 |
| Evidence |
experimental
cloned [1,3-4], 454 [5], Illumina [6], CLIPseq [7] |
| Database links |
|
| Predicted targets |
|
Mature cel-lin-4-3p
| Accession | MIMAT0015092 |
| Description | Caenorhabditis elegans cel-lin-4-3p mature miRNA |
| Sequence | 55 - ACACCUGGGCUCUCCGGGUACC - 76 |
| Evidence |
experimental
CLIPseq [7] |
| Database links |
|
