miRBase entry: cel-mir-87

Stem-loop cel-mir-87


Accession
MI0000058
Description
Caenorhabditis elegans cel-mir-87 precursor miRNA mir-87
Gene
family?
RF00726; mir-87

Literature search
6 open access papers mention cel-mir-87
(13 sentences)

Sequence

50801 reads, 946 reads per million, 16 experiments
gguugugccauccggcCGCCUGAUACUUUCGUCUCAACCUcgcugucagauuggucguagGUGAGCAAAGUUUCAGGUGUGCcggaacacaccc
(((.(((...(((((((((((((.(((((.(.((((.((((((((......))).)).))))))))))))).))))))).)))))).)))))).

Structure
-   u   cca      -       U     C U    A   -  -   uc 
 ggu gug   uccggc CGCCUGA ACUUU G CUCA CCU cg cug  a
 ||| |||   |||||| ||||||| ||||| | |||| ||| || |||   
 cca cac   aggcCG GUGGACU UGAAA C GAGU Gga gc ggu  g
c   -   --a      U       U     - -    -   u  u   ua 


Annotation confidence High
Do you think this miRNA is real?
Comments
mir-87 is has found to be most abundant in the L1 stage of larval development in Caenorhabditis elegans. mir-87 orthologues have been found in C. briggsae, Drosophila melanogaster and humans [1]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [4].

Genome context
chrV: 12038688-12038781 [-]

Database links

Mature cel-miR-87-3p

Accession MIMAT0000060
Description Caenorhabditis elegans cel-miR-87-3p mature miRNA
Sequence 61 - GUGAGCAAAGUUUCAGGUGUGC - 82
Evidence experimental
cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

Mature cel-miR-87-5p

Accession MIMAT0020325
Description Caenorhabditis elegans cel-miR-87-5p mature miRNA
Sequence 17 - CGCCUGAUACUUUCGUCUCAACCU - 40
Evidence experimental
Illumina [7]
Database links

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  3. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  4. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  5. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  6. PubMed ID: 11679672
    An extensive class of small RNAs in Caenorhabditis elegans
    "Lee RC, Ambros V"
    "Science (2001) 294:862-864

  7. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577