MIRLET7B is the host gene for the microRNA miR-let-7b, which is known to increase during oxygen exposure, leading to oxidative stress and cellular senescence in the choroid and retinal pigment epithelium via the p53–let-7b–IGF-1R pathway [PMC9022335]. The regulation of MIRLET7B is complex, with LYPLAL1-AS1 directly interacting with its promoter to negatively control its activity [PMC9022335]. Additionally, FOXO3 is implicated in regulating MIRLET7B expression [PMC5695745]. The binding of LYPLAL1-AS1 to the MIRLET7B promoter has been mapped using ChIRP-seq technology [PMC9022335]. During retinal pigment epithelium epithelial-mesenchymal transition (RPE-EMT), MIRLET7B expression is upregulated after 12 hours of dissociation [PMC8024778]. Furthermore, mutated transcription factor NKX2-5 has been shown to positively influence MIRLET7B expression [PMC6566633]. Research has also been conducted on targeting miRNAs like those from MIRLET7B using a novel conditional allele in mouse embryonic stem cells [PMC3814644]. Despite these insights, the precise role of miR-let-7b in cellular senescence remains an area for further investigation [PMC9022335].
U ----- --a u
cgggg GAGGUAGUAGGUUGUGUGGU Uuc gggcag g
||||| |||||||||||||||||||| ||| |||||| a
guCCC UUCCGUCAUCCAACAUAUCa agg cccguu u
- auaga cuc g
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000063 |
| Description | Homo sapiens hsa-let-7b-5p mature miRNA |
| Sequence | 6 - UGAGGUAGUAGGUUGUGUGGUU - 27 |
| Evidence |
experimental
cloned [1,3-5], Northern [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004482 |
| Description | Homo sapiens hsa-let-7b-3p mature miRNA |
| Sequence | 60 - CUAUACAACCUACUGCCUUCCC - 81 |
| Evidence |
experimental
cloned [4-5] |
| Database links |
|
| Predicted targets |
|
|