MIRLET7B is the host gene for the microRNA miR-let-7b, which is known to increase during oxygen exposure, leading to oxidative stress and cellular senescence in the choroid and retinal pigment epithelium via the p53–let-7b–IGF-1R pathway [PMC9022335]. The regulation of MIRLET7B is complex, with LYPLAL1-AS1 directly interacting with its promoter to negatively control its activity [PMC9022335]. Additionally, FOXO3 is implicated in regulating MIRLET7B expression [PMC5695745]. The binding of LYPLAL1-AS1 to the MIRLET7B promoter has been mapped using ChIRP-seq technology [PMC9022335]. During retinal pigment epithelium epithelial-mesenchymal transition (RPE-EMT), MIRLET7B expression is upregulated after 12 hours of dissociation [PMC8024778]. Furthermore, mutated transcription factor NKX2-5 has been shown to positively influence MIRLET7B expression [PMC6566633]. Research has also been conducted on targeting miRNAs like those from MIRLET7B using a novel conditional allele in mouse embryonic stem cells [PMC3814644]. Despite these insights, the precise role of miR-let-7b in cellular senescence remains an area for further investigation [PMC9022335].
U ----- --a u cgggg GAGGUAGUAGGUUGUGUGGU Uuc gggcag g ||||| |||||||||||||||||||| ||| |||||| a guCCC UUCCGUCAUCCAACAUAUCa agg cccguu u - auaga cuc g
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000063 |
Description | Homo sapiens hsa-let-7b-5p mature miRNA |
Sequence | 6 - UGAGGUAGUAGGUUGUGUGGUU - 27 |
Evidence |
experimental
cloned [1,3-5], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004482 |
Description | Homo sapiens hsa-let-7b-3p mature miRNA |
Sequence | 60 - CUAUACAACCUACUGCCUUCCC - 81 |
Evidence |
experimental
cloned [4-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|