miRBase entry: hsa-let-7b

Stem-loop hsa-let-7b


Accession
MI0000063
Symbol
HGNC: MIRLET7B
Description
Homo sapiens hsa-let-7b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7B is the host gene for the microRNA miR-let-7b, which is known to increase during oxygen exposure, leading to oxidative stress and cellular senescence in the choroid and retinal pigment epithelium via the p53–let-7b–IGF-1R pathway [PMC9022335]. The regulation of MIRLET7B is complex, with LYPLAL1-AS1 directly interacting with its promoter to negatively control its activity [PMC9022335]. Additionally, FOXO3 is implicated in regulating MIRLET7B expression [PMC5695745]. The binding of LYPLAL1-AS1 to the MIRLET7B promoter has been mapped using ChIRP-seq technology [PMC9022335]. During retinal pigment epithelium epithelial-mesenchymal transition (RPE-EMT), MIRLET7B expression is upregulated after 12 hours of dissociation [PMC8024778]. Furthermore, mutated transcription factor NKX2-5 has been shown to positively influence MIRLET7B expression [PMC6566633]. Research has also been conducted on targeting miRNAs like those from MIRLET7B using a novel conditional allele in mouse embryonic stem cells [PMC3814644]. Despite these insights, the precise role of miR-let-7b in cellular senescence remains an area for further investigation [PMC9022335].

Literature search
1157 open access papers mention hsa-let-7b
(6991 sentences)

Sequence

11516291 reads, 27396 reads per million, 159 experiments
cggggUGAGGUAGUAGGUUGUGUGGUUucagggcagugauguugccccucggaagauaaCUAUACAACCUACUGCCUUCCCug
(((((.(((((((((((((((((((((((.((((((.....))))))...))).....)))))))))))))))))))))))))

Structure
     U                    -----   --a      u 
cgggg GAGGUAGUAGGUUGUGUGGU     Uuc   gggcag g
||||| ||||||||||||||||||||     |||   |||||| a
guCCC UUCCGUCAUCCAACAUAUCa     agg   cccguu u
     -                    auaga   cuc      g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr22: 46113686-46113768 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-let-7b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-let-7b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-let-7b-5p

Accession MIMAT0000063
Description Homo sapiens hsa-let-7b-5p mature miRNA
Sequence 6 - UGAGGUAGUAGGUUGUGUGGUU - 27
Evidence experimental
cloned [1,3-5], Northern [1]
Database links
Predicted targets

Mature hsa-let-7b-3p

Accession MIMAT0004482
Description Homo sapiens hsa-let-7b-3p mature miRNA
Sequence 60 - CUAUACAACCUACUGCCUUCCC - 81
Evidence experimental
cloned [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043