Hsa-mir-15a is a member of the hsa-mir-15 family cluster and has been identified as a tumor suppressor. It regulates the expression of oncogenes BCL2, CCND1, and WNT3, thereby inhibiting tumor growth [PMC5814839]. Hsa-mir-15a targets a total of 56 genes, including CCND1 [PMC5814839]. Hsa-miR-16, another member of the hsa-mir-15 family cluster, targets 63 genes including CCND1 [PMC5355656]. Hsa-miR-155 targets 20 genes, including CCND1 and SMAD2 [PMC5355656]. Hsa-miR-375 targets 44 genes, including AKT2 and CDK6 [PMC5355656]. Lastly, hsa-miR-429 targets 59 genes, including CCND1 [PMC5355656]. Among these microRNAs in the regulatory network studied, hsa-miR-16 targets the highest number of genes [PMC5355656]. In conclusion, hsa-mir-15a is a tumor suppressor that regulates oncogenes BCL2, CCND1 and WNT3. It is part of the hsa-mir-15 family cluster and has been shown to target 56 genes. Other microRNAs in this cluster such as hsa-miR16 also target CCND1 but target different numbers of total genes in the regulatory network studied. These findings highlight the importance of microRNAs in cancer regulation and provide potential therapeutic targets for cancer treatment.
gaguaaa UA UA gauuu ccuug g GCAGCACA AUGGUUUGUG u ||||| | |||||||| |||||||||| g ggaac C CGUCGUGU UACCGGACgu a auaaaaA UC UA ggaaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000068 |
Description | Homo sapiens hsa-miR-15a-5p mature miRNA |
Sequence | 14 - UAGCAGCACAUAAUGGUUUGUG - 35 |
Evidence |
experimental
cloned [1,3-6], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004488 |
Description | Homo sapiens hsa-miR-15a-3p mature miRNA |
Sequence | 51 - CAGGCCAUAUUGUGCUGCCUCA - 72 |
Evidence |
experimental
cloned [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|