miRBase entry: hsa-mir-15a

Stem-loop hsa-mir-15a


Accession
MI0000069
Symbol
HGNC: MIR15A
Description
Homo sapiens hsa-mir-15a precursor miRNA mir-15
Gene
family?
RF00455; mir-15

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-15a is a member of the hsa-mir-15 family cluster and has been identified as a tumor suppressor. It regulates the expression of oncogenes BCL2, CCND1, and WNT3, thereby inhibiting tumor growth [PMC5814839]. Hsa-mir-15a targets a total of 56 genes, including CCND1 [PMC5814839]. Hsa-miR-16, another member of the hsa-mir-15 family cluster, targets 63 genes including CCND1 [PMC5355656]. Hsa-miR-155 targets 20 genes, including CCND1 and SMAD2 [PMC5355656]. Hsa-miR-375 targets 44 genes, including AKT2 and CDK6 [PMC5355656]. Lastly, hsa-miR-429 targets 59 genes, including CCND1 [PMC5355656]. Among these microRNAs in the regulatory network studied, hsa-miR-16 targets the highest number of genes [PMC5355656].

In conclusion, hsa-mir-15a is a tumor suppressor that regulates oncogenes BCL2, CCND1 and WNT3. It is part of the hsa-mir-15 family cluster and has been shown to target 56 genes. Other microRNAs in this cluster such as hsa-miR16 also target CCND1 but target different numbers of total genes in the regulatory network studied. These findings highlight the importance of microRNAs in cancer regulation and provide potential therapeutic targets for cancer treatment.

Literature search
482 open access papers mention hsa-mir-15a
(1792 sentences)

Sequence

565656 reads, 3371 reads per million, 143 experiments
ccuuggaguaaagUAGCAGCACAUAAUGGUUUGUGgauuuugaaaaggugCAGGCCAUAUUGUGCUGCCUCAaaaauacaagg
(((((.......(..((((((((..((((((((((.............))))))))))..))))))))..).......)))))

Structure
     gaguaaa UA        UA          gauuu 
ccuug       g  GCAGCACA  AUGGUUUGUG     u
|||||       |  ||||||||  ||||||||||     g
ggaac       C  CGUCGUGU  UACCGGACgu     a
     auaaaaA UC        UA          ggaaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
Reference [1] named this sequence miR-15. This is renamed miR-15a here to avoid confusion with miR-15b (MIR:MI0000438) identified later by others. This gene and miR-16 are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [2].

Genome context
chr13: 50049119-50049201 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-15a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-15a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-15a-5p

Accession MIMAT0000068
Description Homo sapiens hsa-miR-15a-5p mature miRNA
Sequence 14 - UAGCAGCACAUAAUGGUUUGUG - 35
Evidence experimental
cloned [1,3-6], Northern [1]
Database links
Predicted targets

Mature hsa-miR-15a-3p

Accession MIMAT0004488
Description Homo sapiens hsa-miR-15a-3p mature miRNA
Sequence 51 - CAGGCCAUAUUGUGCUGCCUCA - 72
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  6. PubMed ID: 12434020
    Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia
    "Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM"
    "Proc Natl Acad Sci U S A (2002) 99:15524-15529