WARNING: This summary was generated by AI. Hsa-mir-25 is a microRNA that exhibits a high number of target genes, ranking in the top 5.0% according to TargetScan predictions, although it is less prominent in the miRanda database, where it falls within the top 60.0% [PMC5581471]. It is one of several miRNAs predicted to target ERS signature genes such as EDEM1 and BAX, indicating its potential involvement in endoplasmic reticulum stress-related pathways [PMC9022475]. Expression profiling has revealed that hsa-mir-25 is upregulated in certain colon cancer cell lines, suggesting its role in processes such as cell cycle regulation and invasion [PMC9941246]. Furthermore, hsa-mir-25 has been implicated in the invasion of prostate cancer and may interact with signaling pathways involving aurora kinase A or integrin [PMC8426106].
a ag G UU G UG acg
ggcc guguug AGGC GAGAC G GCAAU cugg c
|||| |||||| |||| ||||| | ||||| ||||
ccgg cgugac UCUG CUCUG C CGUUA gguc u
c AG G UU A Cg ccg
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004498 |
| Description | Homo sapiens hsa-miR-25-5p mature miRNA |
| Sequence | 14 - AGGCGGAGACUUGGGCAAUUG - 34 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000081 |
| Description | Homo sapiens hsa-miR-25-3p mature miRNA |
| Sequence | 52 - CAUUGCACUUGUCUCGGUCUGA - 73 |
| Evidence |
experimental
cloned [1-4], Northern [1] |
| Database links |
|
| Predicted targets |
|
|