miRBase entry: hsa-mir-25

Stem-loop hsa-mir-25


Accession
MI0000082
Symbol
HGNC: MIR25
Description
Homo sapiens hsa-mir-25 precursor miRNA mir-25
Gene
family?
RF02020; mir-25

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-25 is a microRNA that exhibits a high number of target genes, ranking in the top 5.0% according to TargetScan predictions, although it is less prominent in the miRanda database, where it falls within the top 60.0% [PMC5581471]. It is one of several miRNAs predicted to target ERS signature genes such as EDEM1 and BAX, indicating its potential involvement in endoplasmic reticulum stress-related pathways [PMC9022475]. Expression profiling has revealed that hsa-mir-25 is upregulated in certain colon cancer cell lines, suggesting its role in processes such as cell cycle regulation and invasion [PMC9941246]. Furthermore, hsa-mir-25 has been implicated in the invasion of prostate cancer and may interact with signaling pathways involving aurora kinase A or integrin [PMC8426106].

Literature search
252 open access papers mention hsa-mir-25
(933 sentences)

Sequence

1044210 reads, 2971 reads per million, 148 experiments
ggccaguguugagAGGCGGAGACUUGGGCAAUUGcuggacgcugcccugggCAUUGCACUUGUCUCGGUCUGAcagugccggcc
((((.((((((..((((.(((((..(.(((((..((((........))))..))))).)..))))).))))..)))))).))))

Structure
    a      ag    G     UU G     UG    acg 
ggcc guguug  AGGC GAGAC  G GCAAU  cugg   c
|||| ||||||  |||| |||||  | |||||  ||||    
ccgg cgugac  UCUG CUCUG  C CGUUA  gguc   u
    c      AG    G     UU A     Cg    ccg 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr7: 100093560-100093643 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-25
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-25 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-25 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-25 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-25-5p

Accession MIMAT0004498
Description Homo sapiens hsa-miR-25-5p mature miRNA
Sequence 14 - AGGCGGAGACUUGGGCAAUUG - 34
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-25-3p

Accession MIMAT0000081
Description Homo sapiens hsa-miR-25-3p mature miRNA
Sequence 52 - CAUUGCACUUGUCUCGGUCUGA - 73
Evidence experimental
cloned [1-4], Northern [1]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043