miRBase entry: hsa-mir-26b

Stem-loop hsa-mir-26b


Accession
MI0000084
Symbol
HGNC: MIR26B
Description
Homo sapiens hsa-mir-26b precursor miRNA mir-26
Gene
family?
RF00244; mir-26

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR26B is a microRNA implicated in the regulation of gene expression, specifically involved in the repression of EZH2, an enzyme that contributes to gene silencing through histone methylation [PMC6925750]. The genetic locus of MIR26B has been experimentally manipulated by incorporating loxP sites, a technique that allows for the conditional deletion of the 160 base pair segment of genomic DNA containing MIR26B [PMC8243710]. This modification is significant for research as it enables scientists to study the functional consequences of MIR26B deletion on EZH2 expression and potentially on broader genomic regulation mechanisms.

Literature search
601 open access papers mention hsa-mir-26b
(2141 sentences)

Sequence

4384241 reads, 7621.0 reads per million, 188 experiments
ccgggacccagUUCAAGUAAUUCAGGAUAGGUUgugugcuguccagCCUGUUCUCCAUUACUUGGCUcggggaccgg
((((..((((((.((((((((..(((((((((((.(......))))))))))))..))))))))))).)))..))))

Structure
    ga   -   U        UC           u ug 
ccgg  ccc agU CAAGUAAU  AGGAUAGGUUg g  c
||||  ||| ||| ||||||||  ||||||||||| |   
ggcc  ggg UCG GUUCAUUA  UCUUGUCCgac c  u
    ag   c   -        CC           - ug 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr2: 218402646-218402722 [+]

Disease association
hsa-mir-26b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-26b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-26b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-26b-5p

Accession MIMAT0000083
Description Homo sapiens hsa-miR-26b-5p mature miRNA
Sequence 12 - UUCAAGUAAUUCAGGAUAGGUU - 33
Evidence experimental
cloned [1,3-5], Northern [1]
Database links
Predicted targets

Mature hsa-miR-26b-3p

Accession MIMAT0004500
Description Homo sapiens hsa-miR-26b-3p mature miRNA
Sequence 47 - CCUGUUCUCCAUUACUUGGCU - 67
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043