WARNING: This summary was generated by AI. hsa-mir-28 is a microRNA that has been identified as one of several miRNAs overexpressed in resting CD4+ T cells, which target the 3' end of the HIV-1 RNA, leading to the silencing of viral protein transcription [PMC4070032]. This miRNA has also been observed to have lower expression levels in monomorphic malignant ventricular premature contractions (MMVP) specimens compared to focal ectopic dysplasia (FED) samples, suggesting a potential role in cardiac conditions [PMC4881574]. Studies on hsa-mir-28-5p, a specific variant of hsa-mir-28, have shown that it generally exerts an inhibitory effect on tumor cells in vitro [PMC8752235]. Furthermore, hsa-mir-28 is part of a group that includes the hsa-miR-548 family and is derived from genetic elements that contribute to its expression and function [PMC2952848]. Despite its involvement in various biological processes and conditions, hsa-mir-28 has been identified as one of the less frequently highly expressed miRNAs in certain contexts [PMC4486185].
c A U ---- cc ggu cuugcccuc AGGAGCUCACAGUCUA UG AGuua u ||| ||||||||| |||||||||||||||| || ||||| uca ggacgggAG UCCUCGAGUGUUAGAU AC ucagu u c G C ccuu cu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000085 |
| Description | Homo sapiens hsa-miR-28-5p mature miRNA |
| Sequence | 14 - AAGGAGCUCACAGUCUAUUGAG - 35 |
| Evidence |
experimental
cloned [1-3], Northern [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004502 |
| Description | Homo sapiens hsa-miR-28-3p mature miRNA |
| Sequence | 54 - CACUAGAUUGUGAGCUCCUGGA - 75 |
| Evidence |
experimental
cloned [2-4] |
| Database links |
|
| Predicted targets |
|
|