WARNING: This summary was generated by AI. MIR30A is a microRNA encoded on human chromosome 6, along with its clustered pair MIR30C2, and is a member of the miR-30 family, which is distributed across three different chromosomes [PMC4873751]. This microRNA plays a significant role in cellular processes, as evidenced by the fact that targeting MIR30A can decrease autophagy in primary LMC cells and increase their sensitivity to the drug Imatinib [PMC6888542]. The human MIR30A loop sequence (MIR30Ahsp) is utilized for its ability to express high levels of siRNAs when used in shRNAmirs [PMC2737240]. Furthermore, the inhibition of exosomal MIR30A expression has been shown to reduce the protective effects of EGCG during hypoxic injury [PMC7054242]. In gene expression studies, MIR30A has been identified as one of several genes with downregulated expression when 191 genes were upregulated and 284 were downregulated in a specific context [PMC7260613]. Additionally, MIR30A has been found to target specific genes such as DC-STAMP which are unique to osteoclast-specific fusogens [PMC7504439].
a UC ----- a gcg cUGUAAACAUCC GACUGGAAGcu gug a ||| |||||||||||| ||||||||||| ||| cgu GACGUUUGUAGG CUGACUUUCgg cac g C -- guaga c
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000087 |
| Description | Homo sapiens hsa-miR-30a-5p mature miRNA |
| Sequence | 6 - UGUAAACAUCCUCGACUGGAAG - 27 |
| Evidence |
experimental
cloned [2,4-6] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000088 |
| Description | Homo sapiens hsa-miR-30a-3p mature miRNA |
| Sequence | 47 - CUUUCAGUCGGAUGUUUGCAGC - 68 |
| Evidence |
experimental
cloned [1,4-5], Northern [1] |
| Database links |
|
| Predicted targets |
|
|