Stem-loop hsa-mir-31

Accession

MI0000089

Symbol

HGNC: MIR31

Description

Homo sapiens hsa-mir-31 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR31 is a microRNA that has been shown to act as a tumor suppressor when transferred to HepG2 and primary hepatocarcinoma cells by HLSC-EVs [PMC8107725]. It is believed that MIR31 represses the expression of tumor suppressor genes, such as LATS2, and indirectly promotes the transcription of genes related to cell cycle control and tumorigenesis [PMC4067122]. Researchers have investigated the potential of modulating MIR31 using morpholino oligomers in a dystrophic context [PMC4972457]. MIR31, along with miR17-3p, has been found to regulate the expression of E-selectins and ICAM-1, reducing neutrophil adhesion and post-stroke leukocyte infiltration [PMC6732937]. Specific primers were used for amplifying MIR31 in experiments [PMC8906324]. It has been suggested that infected cells modulate the expression of certain microRNAs, including MIR31, which sustains CIITA expression [PMC9591123]. The MIR31 locus generates both MIR31 and a long non-coding RNA (lnc-MIR31) via mutually exclusive pathways [PMC4972457]. Comparison of all MIR31 outliers with non-outliers showed that MIR31 outliers were most similar to CMS4-mesenchymals in terms of biological characteristics [PMC6590447]. Additionally, WAVE3-targeting microRNAs provide further support for the function of WAVE3 as a metastasis-promoter gene [PMC3428347].

Literature search

385 open access papers mention hsa-mir-31
(2789 sentences)

Sequence

61511 reads, 2296 reads per million, 128 experiments

ggagaggAGGCAAGAUGCUGGCAUAGCUguugaacugggaaccUGCUAUGCCAACAUAUUGCCAUcuuucc
(((((((.(((((.(((.(((((((((.(((........)))..))))))))).))).))))).)))))))

Structure

       A     G   C         -U   gaa 
ggagagg GGCAA AUG UGGCAUAGC  guu   c
||||||| ||||| ||| |||||||||  |||    
ccuuucU CCGUU UAC ACCGUAUCG  caa   u
       A     A   A         Uc   ggg 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chr9: 21512115-21512185 [-]

Disease association

hsa-mir-31 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-31-5p

• Accession: MIMAT0000089
• Description: Homo sapiens hsa-miR-31-5p mature miRNA
• Sequence: 8 - AGGCAAGAUGCUGGCAUAGCU - 28
• Evidence: experimental ; cloned [1-3], Northern [1]

Mature hsa-miR-31-3p

• Accession: MIMAT0004504
• Description: Homo sapiens hsa-miR-31-3p mature miRNA
• Sequence: 44 - UGCUAUGCCAACAUAUUGCCAU - 65
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 11679670
   Identification of novel genes coding for small expressed RNAs
   "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
   "Science (2001) 294:853-858


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043