Stem-loop hsa-mir-31

Accession

MI0000089

Symbol

HGNC: MIR31

Description

Homo sapiens hsa-mir-31 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR31 is a microRNA implicated in various cellular processes, including tumorigenesis and immune response regulation. Studies have identified MIR31 as a tumor suppressor in HepG2 and primary hepatocarcinoma cells, where it is transferred by HLSC-EVs [PMC8107725]. However, MIR31 also has the potential to act as an oncomir by repressing tumor suppressor genes like LATS2 and may indirectly promote genes associated with the cell cycle and tumorigenesis [PMC4067122]. Research has explored modulating MIR31 using morpholino oligomers to investigate its role in a dystrophic context [PMC4972457]. Additionally, MIR31 has been shown to regulate the expression of E-selectins and ICAM-1, which reduces neutrophil adhesion and leukocyte infiltration after a stroke [PMC6732937]. The expression of MIR31 can be modulated by infections that sustain CIITA expression or through epigenetic downregulation that leads to NFκB activation [PMC9591123]. The complexity of the MIR31 locus is highlighted by its ability to produce both microRNA and a long non-coding RNA (lnc-MIR31) through mutually exclusive pathways [PMC4972457]. In colorectal cancer subtypes, MIR31 expression outliers are biologically most similar to CMS4-mesenchymal tumors [PMC6590447], suggesting its involvement in metastatic processes potentially through targeting genes like WAVE3 [PMC3428347].

Literature search

385 open access papers mention hsa-mir-31
(2789 sentences)

Sequence

61511 reads, 2296 reads per million, 128 experiments

ggagaggAGGCAAGAUGCUGGCAUAGCUguugaacugggaaccUGCUAUGCCAACAUAUUGCCAUcuuucc
(((((((.(((((.(((.(((((((((.(((........)))..))))))))).))).))))).)))))))

Structure

       A     G   C         -U   gaa 
ggagagg GGCAA AUG UGGCAUAGC  guu   c
||||||| ||||| ||| |||||||||  |||    
ccuuucU CCGUU UAC ACCGUAUCG  caa   u
       A     A   A         Uc   ggg 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chr9: 21512115-21512185 [-]

Disease association

hsa-mir-31 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-31-5p

• Accession: MIMAT0000089
• Description: Homo sapiens hsa-miR-31-5p mature miRNA
• Sequence: 8 - AGGCAAGAUGCUGGCAUAGCU - 28
• Evidence: experimental ; cloned [1-3], Northern [1]

Mature hsa-miR-31-3p

• Accession: MIMAT0004504
• Description: Homo sapiens hsa-miR-31-3p mature miRNA
• Sequence: 44 - UGCUAUGCCAACAUAUUGCCAU - 65
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 11679670
   Identification of novel genes coding for small expressed RNAs
   "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
   "Science (2001) 294:853-858


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043