miRBase entry: hsa-mir-92a-1

Stem-loop hsa-mir-92a-1


Accession
MI0000093
Symbol
HGNC: MIR92A1
Description
Homo sapiens hsa-mir-92a-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR92A1 is a microRNA that is part of the miR-17~92 cluster, which is encoded by the MIR17HG host gene and includes several other miRNAs such as MIR17, MIR18A, MIR19A, MIR20A, and MIR19B1 [PMC4005632]. This cluster has been found to be upregulated in Alzheimer's disease (AD), with a specific increase in the expression of MIR92A1 observed in the cortex of AD patients [PMC7564652]. The upregulation of miRNAs including MIR92A1 has been linked to the downregulation of their target genes in disease models [PMC6321611]. The role of these miRNAs in AD is complex and not fully understood; however, it has been suggested that MIR92A1 may be involved in memory processes [PMC7564652]. Additionally, a microduplication encompassing the miR-17~92 cluster genes suggests a potential genetic basis for their altered expression levels [PMC4005632]. The conservation of a p53 binding site within the human MIR92A1 locus indicates potential regulatory mechanisms that may be important for its expression and function [PMC9207587].

Literature search
361 open access papers mention hsa-mir-92a-1
(1567 sentences)

Sequence

1747087 reads, 7474 reads per million, 158 experiments
cuuucuacacAGGUUGGGAUCGGUUGCAAUGCUguguuucuguauggUAUUGCACUUGUCCCGGCCUGUugaguuugg
....((..((((((((((((.(((.(((((((((((......)))))))))))))).))))))))))))..)).....

Structure
-cuuu  ac            C   U           uu 
     cu  acAGGUUGGGAU GGU GCAAUGCUgug  u
     ||  |||||||||||| ||| |||||||||||   
     ga  UGUCCGGCCCUG UCA CGUUAUgguau  c
gguuu  gu            U   -           gu 


Annotation confidence High
Do you think this miRNA is real?
Comments
Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (named mir-92-13 in [1]) and mir-92a-2 (MIR:MI0000094) on chromosome X (named mir-92-X in [1]). miR-92a has also been cloned from mouse embryonic stem cells [2] and is predicted to be expressed from two closely related precursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [7].

Genome context
chr13: 91351314-91351391 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-92a-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-92a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-92a-1-5p

Accession MIMAT0004507
Description Homo sapiens hsa-miR-92a-1-5p mature miRNA
Sequence 11 - AGGUUGGGAUCGGUUGCAAUGCU - 33
Evidence experimental
cloned [7-8]
Database links
Predicted targets

Mature hsa-miR-92a-3p

Accession MIMAT0000092
Description Homo sapiens hsa-miR-92a-3p mature miRNA
Sequence 48 - UAUUGCACUUGUCCCGGCCUGU - 69
Evidence experimental
cloned [1,3,5-8], Northern [4]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  6. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  7. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  8. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358