WARNING: This summary was generated by AI. MIR99A is a microRNA that has been identified as a regulator of NOX4 expression by targeting the 3’-UTR [PMC7407884]. This microRNA is notably one of the most elevated plasma miRNAs in community-acquired pneumonia (CAP), suggesting its potential role in the pathophysiology or as a biomarker for this condition [PMC8358855].
cc A UC U g aag cauuggcaua ACCCGUAGA CGA CUUGUG ug u |||||||||| ||||||||| ||| |||||| || gugacuguGU UGGGUAUCU GCU GAACac gc g gu C UC C - cag
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000097 |
| Description | Homo sapiens hsa-miR-99a-5p mature miRNA |
| Sequence | 13 - AACCCGUAGAUCCGAUCUUGUG - 34 |
| Evidence |
experimental
cloned [1-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004511 |
| Description | Homo sapiens hsa-miR-99a-3p mature miRNA |
| Sequence | 50 - CAAGCUCGCUUCUAUGGGUCUG - 71 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|