MIR29B1 is a microRNA that has been observed to be downregulated in Alzheimer's disease (AD) patients [PMC7564652]. It has been found to target secretases, which are involved in AD pathogenesis, as well as have a protective effect on neuron survival [PMC7564652]. Additionally, MIR29B1 has been shown to regulate BACE1 expression, a gene involved in AD, in vitro [PMC7564652]. In the cortex of AD patients, MIR29B1 is downregulated along with other microRNAs such as MIR129-2, MIR1296, MIR219A1, MIR375, MIR411, and MIR431 [PMC7564652]. Conversely, microRNAs such as MIR199A2 and MIR92A1 are upregulated in the cortex of AD patients [PMC7564652]. In other contexts, such as dairy cattle domestication and breast cancer cells (MDA-MB-231S), upregulation of MIR29B1 has been observed [PMC6898964] [PMC4651668]. It is also a host gene for miR-22 and miR-29b which are downregulated in certain diseases like SMZL (splenic marginal zone lymphoma) [PMC7111612] [PMC8064455]. In rats with a homozygous mutation of the Mir29b-1/a gene that encodes nucleotides 6–9 in the sequence of mature miR-29b-3p (MIR29B1), reduced urine volume and urinary sodium excretion were observed due to reduced NO levels in the renal outer medulla [PMC6156712].
- - U GU uuaaa cuucaggaa GCUGGUUUCA AUGGUG UUAGAu u ||||||||| |||||||||| |||||| |||||| a gggguucUU UGACUAAAGU UACCAC GAUcug g g G U -- uuagu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004514 |
Description | Homo sapiens hsa-miR-29b-1-5p mature miRNA |
Sequence | 10 - GCUGGUUUCAUAUGGUGGUUUAGA - 33 |
Evidence |
experimental
cloned [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000100 |
Description | Homo sapiens hsa-miR-29b-3p mature miRNA |
Sequence | 51 - UAGCACCAUUUGAAAUCAGUGUU - 73 |
Evidence |
experimental
cloned [1-4], Northern [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|