miRBase entry: hsa-mir-29b-1

Stem-loop hsa-mir-29b-1


Accession
MI0000105
Symbol
HGNC: MIR29B1
Description
Homo sapiens hsa-mir-29b-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR29B1 is a microRNA gene that encodes for the miR-29b-3p sequence, a member of the miR-29 family, which is implicated in various cellular processes and diseases [PMC9601486]. In the context of Alzheimer's disease (AD), MIR29B1 has been found to be downregulated in the cortex of AD patients, suggesting a potential role in the disease's pathogenesis [PMC7564652]. This downregulation may influence AD by targeting genes directly involved in its pathogenesis, such as BACE1, which is involved in amyloid precursor protein processing [PMC7564652]. Additionally, MIR29B1's downregulation could indirectly affect neuron survival and thus contribute to AD progression [PMC7564652]. In other studies, MIR29B1 has been associated with various biological processes; for instance, it has been implicated in increasing milk yield in dairy cattle when co-expressed with MIR148A [PMC6898964], and its upregulation was observed upon knockdown of LASP-1 correlating with reduced MMP9 transcript levels in MDA-MB-231S cells [PMC4651668]. Furthermore, mutations in MIR29B1 have been linked to altered physiological responses such as reduced urine volume and increased renal fibrosis under certain dietary conditions in rats [PMC6156712], highlighting its significance beyond neurodegenerative diseases.

Literature search
661 open access papers mention hsa-mir-29b-1
(4447 sentences)

Sequence

369150 reads, 2447 reads per million, 159 experiments
cuucaggaaGCUGGUUUCAUAUGGUGGUUUAGAuuuaaauagugauugucUAGCACCAUUUGAAAUCAGUGUUcuuggggg
(((((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))))).

Structure
-         -          U      GU      uuaaa 
 cuucaggaa GCUGGUUUCA AUGGUG  UUAGAu     u
 ||||||||| |||||||||| ||||||  ||||||     a
 gggguucUU UGACUAAAGU UACCAC  GAUcug     g
g         G          U      --      uuagu 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.

Genome context
chr7: 130877459-130877539 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-29b-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-29b-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-29b-1-5p

Accession MIMAT0004514
Description Homo sapiens hsa-miR-29b-1-5p mature miRNA
Sequence 10 - GCUGGUUUCAUAUGGUGGUUUAGA - 33
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-29b-3p

Accession MIMAT0000100
Description Homo sapiens hsa-miR-29b-3p mature miRNA
Sequence 51 - UAGCACCAUUUGAAAUCAGUGUU - 73
Evidence experimental
cloned [1-4], Northern [2]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728