miRBase entry: hsa-mir-29b-2

Stem-loop hsa-mir-29b-2


Accession
MI0000107
Symbol
HGNC: MIR29B2
Description
Homo sapiens hsa-mir-29b-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR29B2 is a microRNA gene located on chromosome 1, encoding a precursor miRNA that is processed into mature miR-29bs, which have identical sequences to those encoded by MIR29B1 on chromosome 7 [PMC5643533]. MIR29B2 has been implicated in various cellular processes and its role in cancer has been observed, such as being up-regulated in late-relapse Hodgkin lymphoma samples [PMC7667426]. In MDA-MB-231S cells, the knockdown of LASP-1 led to the upregulation of MIR29B2 and a decrease in MMP9 transcript levels [PMC4651668]. MIR29B2 also inhibits the expression of its target gene MCT1 when activated by MAPK signaling cascades, potentially affecting insulin secretion [PMC7795239]. MicroRNAs, including MIR29B2, are frequently located in chromosomal regions susceptible to alterations in cancer models, with MIR29B2 specifically situated on the long arm of chromosome 1 [PMC2683874]. Differential expression of MIR29B2 has been noted not only in late-relapse Hodgkin lymphoma samples compared to early-relapse samples but also among precursor RNAs in various biological contexts [PMC6801644]. Additionally, in mouse brain endothelial cells exposed to homocysteine, an increase in miR-29b family members, including MIR29B2, was observed [PMC6651274].

Literature search
652 open access papers mention hsa-mir-29b-2
(4396 sentences)

Sequence

344586 reads, 1550 reads per million, 138 experiments
cuucuggaagCUGGUUUCACAUGGUGGCUUAGauuuuuccaucuuuguaucUAGCACCAUUUGAAAUCAGUGUUuuaggag
(((((((((((((((((((.((((((.((.((((..............)))))))))))).)))))))))).)))))))))

Structure
         -          C      G  U    uuuucc 
cuucuggaa gCUGGUUUCA AUGGUG CU AGau      a
||||||||| |||||||||| |||||| || ||||       
gaggauuUU UGACUAAAGU UACCAC GA Ucua      u
         G          U      -  -    uguuuc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was named mir-102-1 in reference [1]. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.

Genome context
chr1: 207802443-207802523 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-29b-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-29b-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-29b-3p

Accession MIMAT0000100
Description Homo sapiens hsa-miR-29b-3p mature miRNA
Sequence 52 - UAGCACCAUUUGAAAUCAGUGUU - 74
Evidence experimental
cloned [1-4], Northern [2]
Database links
Predicted targets

Mature hsa-miR-29b-2-5p

Accession MIMAT0004515
Description Homo sapiens hsa-miR-29b-2-5p mature miRNA
Sequence 11 - CUGGUUUCACAUGGUGGCUUAG - 32
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728