miRBase entry: hsa-mir-106a

Stem-loop hsa-mir-106a


Accession
MI0000113
Symbol
HGNC: MIR106A
Description
Homo sapiens hsa-mir-106a precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-106a is a microRNA that is involved in the regulation of gene expression [PMC7770216]. According to a study by Zhang et al., it was found that HPV E7/DGCR8 inhibits the expression of RUNX3 and enhances radiation sensitivity by promoting the expression of hsa-mir-106a [PMC7770216]. In another study by Liang et al., it was observed that hsa-mir-106a has a reverse pattern of expression compared to its target genes BDH1, UPP1, TUSC2, and KMO in the short-term survival group [PMC3852212]. These target genes were found to be over-expressed in the short-term survival group [PMC3852212].

Literature search
256 open access papers mention hsa-mir-106a
(962 sentences)

Sequence

47008 reads, 2817 reads per million, 148 experiments
ccuuggccauguAAAAGUGCUUACAGUGCAGGUAGcuuuuugagaucuaCUGCAAUGUAAGCACUUCUUACauuaccaugg
((.(((..(((((((((((((((((.(((((.(((.(((...))).)))))))).))))))))))).))))))..))).))

Structure
  u   cc      -           G     G   c   u 
cc ugg  auguAA AAGUGCUUACA UGCAG UAG uuu  
|| |||  |||||| ||||||||||| ||||| ||| ||| u
gg acc  uaCAUU UUCACGAAUGU ACGUC auc aga  
  u   au      C           A     -   u   g 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MIR:MI0000071). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chrX: 134170198-134170278 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-106a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-106a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-106a is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-106a is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-106a-5p

Accession MIMAT0000103
Description Homo sapiens hsa-miR-106a-5p mature miRNA
Sequence 13 - AAAAGUGCUUACAGUGCAGGUAG - 35
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-106a-3p

Accession MIMAT0004517
Description Homo sapiens hsa-miR-106a-3p mature miRNA
Sequence 50 - CUGCAAUGUAAGCACUUCUUAC - 71
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728