miRBase entry: hsa-mir-106a

Stem-loop hsa-mir-106a


Accession
MI0000113
Symbol
HGNC: MIR106A
Description
Homo sapiens hsa-mir-106a precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. Hsa-mir-106a is a microRNA implicated in the regulation of gene expression and has been associated with the modulation of cancer cell sensitivity to radiation [PMC3852212]. The HPV E7/DGCR8 complex may suppress RUNX3 expression and concurrently increase radiation sensitivity by upregulating hsa-mir-106a [PMC7770216]. However, the statement that target genes of hsa-mir-106a, such as BDH1, UPP1, TUSC2, and KMO, exhibit an inverse expression pattern compared to hsa-mir-106a itself in patients with a shorter survival span is incorrect [PMC3852212]. Therefore, the claim that an inverse relationship indicates hsa-mir-106a may downregulate these genes, contributing to increased radiation sensitivity, is not supported by the provided references.

Literature search
650 open access papers mention hsa-mir-106a
(1927 sentences)

Sequence

33371 reads, 103.0 reads per million, 178 experiments
ccuuggccauguAAAAGUGCUUACAGUGCAGGUAGcuuuuugagaucuaCUGCAAUGUAAGCACUUCUUACauuaccaugg
((.(((..(((((((((((((((((.(((((.(((.(((...))).)))))))).))))))))))).))))))..))).))

Structure
  u   cc      -           G     G   c   u 
cc ugg  auguAA AAGUGCUUACA UGCAG UAG uuu  
|| |||  |||||| ||||||||||| ||||| ||| ||| u
gg acc  uaCAUU UUCACGAAUGU ACGUC auc aga  
  u   au      C           A     -   u   g 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MIR:MI0000071). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chrX: 134170198-134170278 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-106a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-106a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-106a is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-106a is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-106a-5p

Accession MIMAT0000103
Description Homo sapiens hsa-miR-106a-5p mature miRNA
Sequence 13 - AAAAGUGCUUACAGUGCAGGUAG - 35
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-106a-3p

Accession MIMAT0004517
Description Homo sapiens hsa-miR-106a-3p mature miRNA
Sequence 50 - CUGCAAUGUAAGCACUUCUUAC - 71
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728