MIR107, a type of microRNA, has been studied in relation to sepsis and Alzheimer's disease [PMC7310770]. Decreased expressions of MIR107 have been found to have good predictive values for increased 28-day mortality risk in sepsis patients [PMC7310770]. This suggests that MIR107 may be a potential early biomarker for sepsis [PMC7310770]. Additionally, the decreased expression of MIR107 has also been associated with the onset of Alzheimer's disease [PMC4870937]. The study found that peripheral MIR107 and BACE1 mRNA may be important in the development of Alzheimer's disease, indicating that MIR107 could be a candidate biomarker for early detection of the disease [PMC4870937]. These findings highlight the potential significance of MIR107 in both sepsis and Alzheimer's disease research, suggesting its potential as a diagnostic tool and therapeutic target [PMC7310770][PMC4870937[PMC4870937].
c c --c u u c u a ucu ugcuuu agcu cu uacaguguugc uug ggc u ||| |||||| |||| || ||||||||||| ||| ||| g aga acgaaA UCGG GA AUGUUACGACG Aac uug g - c CUA - C - - a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000104 |
Description | Homo sapiens hsa-miR-107 mature miRNA |
Sequence | 50 - AGCAGCAUUGUACAGGGCUAUCA - 72 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|