WARNING: This summary was generated by AI. The microRNA hsa-mir-107 has been identified as significantly upregulated in the FGD5-AS1 KD CCC-HEH-2 cell line, which could indicate its involvement in specific cellular functions within this system [PMC8144506]. This cell line originates from cholangiocarcinoma, a cancer affecting the bile ducts, and the observed upregulation of hsa-mir-107 suggests it may influence the behavior of these cancer cells [PMC8144506]. In addition, hsa-mir-107 is also recognized for its potential tumor-suppressive effects in non-small cell lung cancer (NSCLC) cells, highlighting its relevance in cancer research [PMC6981095]. The connections of hsa-mir-107 with various cancer types underscore its significance in the field of cancer biology and emphasize the need for further studies to elucidate its role and therapeutic possibilities [PMC8144506; PMC6981095]..
c c --c U U C U a ucu ugcuuu AGCU CU UACAGUGUUGC UUG ggc u ||| |||||| |||| || ||||||||||| ||| ||| g aga acgaaA UCGG GA AUGUUACGACG Aac uug g - c CUA - C - - a
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0050677 |
| Description | Homo sapiens hsa-miR-107-5p mature miRNA |
| Sequence | 13 - AGCUUCUUUACAGUGUUGCCUUGU - 36 |
| Evidence |
experimental
Illumina [1] |
| Accession | MIMAT0000104 |
| Description | Homo sapiens hsa-miR-107-3p mature miRNA |
| Sequence | 50 - AGCAGCAUUGUACAGGGCUAUCA - 72 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|